CN102319440B - Preparation method of porcine parvovirus genetic engineering vaccine - Google Patents
Preparation method of porcine parvovirus genetic engineering vaccine Download PDFInfo
- Publication number
- CN102319440B CN102319440B CN 201110239759 CN201110239759A CN102319440B CN 102319440 B CN102319440 B CN 102319440B CN 201110239759 CN201110239759 CN 201110239759 CN 201110239759 A CN201110239759 A CN 201110239759A CN 102319440 B CN102319440 B CN 102319440B
- Authority
- CN
- China
- Prior art keywords
- porcine parvovirus
- genetic engineering
- yeast
- vaccine
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a preparation method of porcine parvovirus genetic engineering vaccine, which comprises the following steps: constructing and recombining a yeast expression carrier p GAPZ alpha-VP2; then carrying out electric shock to convert pichia pastoris SMD1168, so that VP2 protein is efficiently secreted and expressed in a YPD culture medium to form viruslike particles without virus nucleic acid; purifying protein, carrying out SDS-PAGE and Western Blot and electric microscope detection; and adding a corresponding immunologic adjuvant to prepare the porcine parvovirus genetic engineering vaccine. The porcine parvovirus genetic engineering vaccine prepared by the invention solves the defects in the current porcine parvovirus genetic engineering vaccine, can be used for preventing and treating porcine parvovirus genetic infection and relative diseases caused by the porcine parvovirus genetic infection, and is also suitable for preparing and detecting the envelope antigen of a porcine parvovirus antibody ELISA kit.
Description
Technical field
The present invention relates to the genetic engineering field, be specifically related to a kind of preparation method of porcine parvovirus genetic engineering vaccine.
Background technology
Pig parvoviral (Porcine parvovirus, PPV) be a kind of self-replicating type virus, to cause that sow produces one of principal element of monster, usually first farrowing sow can cause breeding difficulty after infecting PPV, main manifestations for miscarriage, infertile, produce stillborn fetus and mummy tire etc., bring great economic loss to pig industry.PPV, pig circular ring virus (PCV), porcine reproductive and respiratory syndrome virus (PRRSV) are the focuses of swine diseases research always, and research recently finds that PPV is playing the part of important role in multisystemic exhaustion syndrome (PMWS) after the pig wean.
The PPV genome is strand wire DNA molecular, and size is about 5000 nucleotide, and ripe virion only contains the minus-strand dna genome.The research discovery, PPV has very high homology with the genome of other parvovirus that parvovirus belongs to.In addition, the genome structure of PPV is similar to other parvovirus, and there is hairpin structure at two ends, " Y " font hairpin structure that 3 ' end has the palindrome of 102 bp to be folded to form; 5 ' end has the palindrome of 127 bp, middle " U " font hairpin structure that is interrupted by the short palindrome of 24 bp and be folded to form, and it is very important that this end structure copies it.Genome has 2 open reading frames (ORF), the ORF1 coding non-structural protein (namely regulating albumen) of 5 ' end, and the ORF2 coding structure albumen of 3 ' end, structural protein are the main immunogenic antigen of PPV.NS gene code 3 kinds of non-structural protein NS 1s, NS2 and NS3 by promoter P4 transcriptional start; By promoter P40 transcriptional start translation 3 kinds of structural protein VP1, VP2 and VP3, their molecular mass is about respectively 83,64,60ku.
The vaccine of anti-PPV processed mainly contains inactivated vaccine and attenuated vaccine in the market.Find that in clinical practice inactivated vaccine has following shortcoming: (1) needs heavy dose of inoculation or uses concentrated antigen, and duration of immunity is short, often needs to strengthen inoculation; (2) can not cause local immunity, so that a little less than the effect of cellular immunization; (3) producing complete immunity needs 2-3 week, is unfavorable for urgent prophylactic immunization and reduces the vaccine expense; (4) exist deactivation not thoroughly and the possibility of loose poison.And attenuated vaccine exists that virulence is returned by force, the danger of restructuring and latent infection, is difficult to apply in practice.Therefore traditional vaccine exposes increasing problem in anti-PPV processed, a kind of novel not only safe but also reliable recombinant vaccine is extremely urgent.
VP2 is the main component that consists of the PPV capsid protein, is also the target protein of neutralizing antibody effect, contains virulent major antigen determinant, also has hemagglutination activity.The polypeptide of VP2 gene code can the oneself be assembled into viroid particle (VLPs), can induce very strong immunne response.Zhao Junlong etc. research is found PPV VP2 at 60-68,81-88, and 266-275, there are the dominant area of antigen site in 351-357 and 398-404 aminoacid place.The section that the discovery VP2 albumen such as beam is beautiful may become the B cell epitope is positioned at N end 10-18,34-39,94-103,121-126,137-144,156-165 and 209-214 section.The scholars such as Soren K have analyzed the antigenic structure of PPV, and finding has 9 linear epitopes all to be arranged in VP2, only have VP2 N end epi-position can induce virucidin, and during with the mammal cell line expression or with baculovirus expression, VP2 albumen can form VLPs.Can find the virion of two kinds of forms from the virion Electronic Speculum figure of separation and purification: a kind of is complete virus particle, includes PPV ssDNA; Another kind is virus hollow capsid, and interior without DNA, in virus hollow capsid, VP2 content is the highest, and this " hollow " virion still has good immunogenicity.2007, Yi G X etc. expressed VP2 albumen with recombinant lactic acid bacteria, and it shows good immunogenicity.Based on These characteristics, VP2 becomes the focus of PPV aspect diagnosis and immunology research.
Summary of the invention
The object of the invention is to according to high efficient expression pig parvoviral major structural protein VP2 gene in pichia pastoris phaff, so take the structural protein of this high expressed amount as the basis, provide porcine parvovirus genetic engineering vaccine.
Above-mentioned purpose of the present invention is achieved by the following technical programs:
1. structure recombinant yeast expression vector: search international standard low virulent strain pig parvoviral VP2 gene on GenBank, serial number: NC-001718, expression vector is pGAPZ α A, Host Strains is that yeast strain SMD1168(is available from Invitrogen company), build pGAPZ α A-VP2 recombinant yeast expression vector.Pcr amplification goes out PPV VP2 complete genome sequence, and forward primer P1 is as shown in SEQ ID NO:1, and downstream primer P2 is as shown in SEQ ID NO:2, and restriction enzyme site is Xho I and Not I,
AAAAGABe the Kex2 protease cutting site.
2. build the recombination yeast engineering bacteria: its linearisation electric shock is transformed pichia pastoris phaff, construction expression engineering bacteria.With competence
P.pastorisSMD1168 100 μ L with mix mutually through the linearizing pGAPZ α of Avr II A-VP2 10 μ g, ice bath 5min, 300V, 200 electric shock 15ms, then add rapidly the sorbitol of 1ml 1M, yeast cells after transforming is laid on the YPDS dull and stereotyped (containing 100 mg/ml Zeocin) of fresh preparation, flat board is inverted, is cultured to single bacterium colony in 30 ℃ and occurs, cultivate 2 ~ 3 d.Employing boils-freezes-and cooking method prepares PCR template analysis P.pastoris transformant.Through the high copy of the YPDS of variable concentrations Zeocin plate screening transformant, be used for high efficiency expressing destination protein again.
3. the non-abduction delivering of recombination yeast engineering bacteria: the single bacterium colony with Zeocin resistance with the choicest of sterilization rifle screens, carry out one-level and cultivate in the YPD of 5mL fluid medium, 30 ℃, 200 r/min shaken overnight are to OD
600=2-6, namely cell is in exponential phase.Get 1mL one-level culture fluid, be resuspended in the YPD of 50mL, continue shaken cultivation, add two-layer newspaper wrapping with four layers of clean gauze, cultivated approximately 72 hours.
4. the purification of expressing protein: the culture low-speed centrifugal of cultivating approximately 72 hours is collected supernatant, with method purifying proteins such as film systems.
5. the preparation of PPV recombinant vaccine: supernatant is expressed in appeal carry out SDS-PAGE and Western Blot analysis, then penicillin, streptomycin are mixed with the albumen of separation and purification, add again the nanometer adjuvant of import to mix with physiology saline or PBS, the mixture pH value is transferred to biological value, be PH7.0-7.5, namely prepared porcine parvovirus genetic engineering vaccine.
Because PPV VP2 albumen is minimum to the Preference difference of codon to Preference and the pichia pastoris phaff expression system of codon, therefore selection pichia yeast expression system, and it is very favourable to expressing foreign protein, (1) high stable: the expression vector of this system is not that the plasmid form with self-replicating exists, but be incorporated on yeast chromosomal, therefore the bacterial strain that builds is very stable; (2) hypersecretion: the molecular biological characteristic research of the α-factor signal peptide in the pichia pastoris phaff expression system fully aware of, it self biological characteristics in addition, its secreting, expressing can reach 1g/L, and this is very rare in known secreting, expressing system; (3) cost is low: the expression ratio of recombiant protein in pichia pastoris phaff expressed cost in insecticide and mammal low, culture medium does not need additive expensive as bovine serum albumin, does not need the expensive equipment such as CO2 gas incubator and incubator for tissue culture yet; (4) easily amplify: the expression of recombiant protein in pichia pastoris phaff realized suitability for industrialized production in 1000 L fermentation tanks.
Compared with prior art, the present invention has following beneficial effect:
The destination protein that recombinant yeast of the present invention is expressed is very high, and destination protein is secreted in culture medium, and the albumen of yeast oneself expression is owing to not having signal peptide can't be secreted in culture medium, therefore in the expression supernatant almost without foreign protein (seeing accompanying drawing 1), and yeast strain SMD1168 belongs to the protease-deficient bacterial strain, has prevented the destination protein degraded; Because expression vector pGAPZ α A contains α-factor signal peptide, being easy to expression product is secreted in culture medium, thereby easier separation and purification destination protein, avoided because the also difficult problem of purifying protein is obtained in the more firm difficult fragmentation of yeast cell wall, and introduce Kex2 protease at PPV VP2 albumen n end, guaranteeing that it forms natural N end, thereby guaranteed the biologic activity of VP2 albumen.
The codon of PPV VP2 and escherichia coli, yeast, people's codon-bias variation analysis is found, the difference of VP2 codon and preference of the yeast codon is minimum, therefore select the yeast expression system optimization expression to improve expression, and the domestic VP2 of having no expresses relevant report in yeast, VP2 expressing quantity of the present invention is seen embodiment 3 up to 595.76mg/L(), obviously be better than other expression systems.
The Yeast expression carrier pGAPZ α A that the present invention selects is a kind of non-composing type secretion expression carrier of inducing, contain the glyceraldehyde 3-phosphate dehydro-genase strong promoter, be better than other promoteres, expression is higher, importantly do not need methanol induction, prevented the dangerous of methanol and to the toxic and side effects of yeast cells.
The present invention has carried out desk study from Carbon and nitrogen sources to fermentation condition, find from cost and expression two factor researchs, be better than glycerol with glucose as carbon source, be better than tryptone and ammonium sulfate with carbamide as nitrogenous source, intermittently flow the growth that supplementary carbon source and nitrogenous source in addition more are conducive to yeast cells; And the dissolved oxygen amount in fermentation tank plays a part very importantly to the raising of yeast growth and expression during the fermentation, particularly ferments the 3rd day, and dissolved oxygen amount requires higher, guarantees that simultaneously fermentating liquid PH value is between 5.5-6.0.
Description of drawings
Fig. 1 is the analysis of PPV VP2 protein SDS-PAGE, 1: express supernatant without concentrated pGAPZ α A-VP2; 2:pGAPZ α A empty carrier is expressed supernatant; M: dye in advance molecular weight of albumen Marker;
Fig. 2 is that PPV VP2 albumen Western Blot analyzes, 1,2: express supernatant without concentrated pGAPZ α A-VP2; M: dye in advance molecular weight of albumen Marker; 3:pGAPZ α A empty carrier is expressed supernatant.
Fig. 3 is the standard protein BSA concentration curve that in embodiment 3, PPV VP2 determination of protein concentration is made.
The specific embodiment
Further explain the present invention below in conjunction with embodiment, but embodiment does not do any type of restriction to the present invention.
1. structure recombinant yeast expression vector: expression vector is pGAPZ α A, and Host Strains is yeast strain SMD1168.Pcr amplification goes out PPV VP2 complete genome sequence, and forward primer P1 is as shown in SEQ ID NO:1, and downstream primer P2 is as shown in SEQ ID NO:2, and restriction enzyme site is Xho I and Not I,
AAAAGABe the Kex2 protease cutting site.
2. build the recombination yeast engineering bacteria: with the above-mentioned recombinant yeast expression vector linearisation electric shock transformed yeast bacterial strain SMD1168 that builds, the linearisation enzyme is the Avr II.
3. the non-abduction delivering of recombination yeast engineering bacteria: the single bacterium colony with Zeocin resistance with the choicest of sterilization rifle screens, carry out one-level and cultivate in the YPD of 5mL fluid medium, 30 ℃, 200 r/min shaken overnight are to OD
600=2-6, namely cell is in exponential phase.Get 1mL one-level culture fluid, be resuspended in the YPD of 50mL, continue shaken cultivation, add two-layer newspaper wrapping with four layers of clean gauze, cultivated approximately 72 hours.
4. the purification of expressing protein: the culture low-speed centrifugal of cultivating approximately 72 hours is collected supernatant, with method purifying proteins such as film systems.
5. the preparation of PPV recombinant vaccine: supernatant is expressed in appeal carry out SDS-PAGE and Western Blot analysis (Fig. 1 ~ 2), then penicillin, streptomycin are mixed with the albumen of separation and purification, add again adjuvant to mix with physiology saline or PBS, the mixture pH value is transferred to biological value, be PH7.0-7.5, namely prepared porcine parvovirus genetic engineering vaccine.Adjuvant is selected import nanometer adjuvant.
Zoopery: with the basic zero difference of PPV recombinant vaccine immunity body weight of above-mentioned preparation, the piglet of the good PPV feminine gender of mental status; the blank of establishing simultaneously positive control, empty carrier contrast, normal saline contrast, adjuvant contrast and being left intact; booster immunization after 15 days; after the ELISA test kit detects generation antibody; use pig parvoviral virulent strain to carry out counteracting toxic substances experiment (except the F group), to detect the antibody that is produced, whether protection is arranged.Test as follows:
| Test group | Inoculum | Dosage |
| The A group | The PPV |
3 parts |
| The B group | Positive control (the weak malicious seedling of PPV) | 3 parts |
| The C group | The |
3 parts |
| The D group | The |
3 parts |
| The E group | The |
3 parts |
| The F group | The blank be left intact | ? |
Result: booster immunization after 15 days, detect through the ELISA test kit, A group and B group produce antibody, and antibody titer is very high, and C group, D group, E group and F group do not detect antibody.Weigh before using PPV virulent strain counteracting toxic substances, do significance of difference analysis, five groups are compared with the F group, and difference is not remarkable.All heating paresthesia occurred in 7 days after counteracting toxic substances, A, B group fever time is about 2-5 days, disappears subsequently, organizes contrast expression without extremely with F.C group, D group and E group engender the slight symptoms such as heating, diarrhoea, arthritis and dermatitis to moderate, performance inappetence, the depressed and growth retardation of spirit, and some even develops into cad pig, and indivedual pigs die of exhaustion because of multisystem.Result of the test shows, porcine parvovirus genetic engineering vaccine is enough to porcine parvovirus is protected, and even is better than the weak malicious Seedling of PPV.Therefore infer thus the effectively infection of prevention and control porcine parvovirus of porcine parvovirus genetic engineering vaccine of PPV major structural protein preparation.
PPV VP2 expression is measured: VP2 expresses the supernatant determination of protein concentration and adopts Bradford determination of protein concentration test kit, has a small amount of tropina owing to expressing in supernatant, therefore the concentration of measuring is total protein concentration, concrete steps are as follows:
1. complete soluble protein standard substance BSA(5mg/mL), get 10 μ L and be diluted to 100 μ L, making final concentration is 0.5mg/mL.With PBS dilution standard product.
2. the standard substance after diluting are added in the standard substance hole of 96 orifice plates by 0,1,2,4,8,12,16,20 μ L, add the PBS diluent and supply 20 μ L.
3. the supernatant 10 μ L that with VP2 expression time are respectively 48h, 72h, 96h are added in the sample well of 96 orifice plates, add PBS diluent to 20 μ L.
4. each hole adds 200 μ L G250 dyeing liquors, and room temperature was placed 3-5 minute.
5. measuring wavelength with microplate reader is the absorbance of 595nm.
6. calculate protein concentration in VP2 supernatant of different expression time according to standard curve.
The concentration that said method is measured is the total protein concentration in supernatant, then accounts for the percentage ratio of total protein according to purpose band VP2 albumen in scanning densitometer scanning SDS-PAGE glue, can calculate VP2 at the expression of different time.
Result: according to the OD of standard protein BSA under variable concentrations
595Value, take protein concentration as X-axis, the OD value is Y-axis, production standard protein concentration curve sees that accompanying drawing 3. uses Microsoft Excel according to normal concentration curve plotting Trendline, wherein degree of association R again
2Up to 95.41%, the Trendline functional relation is: y=1.465x+0.6341.VP2 albumen is expressed the OD of supernatant at 48h, 72h, 96h
595Value is respectively 0.9479,1.0851,1.0310, accounting for total protein percentage ratio through scanning densitometer scanning VP2 albumen is 96.77 ﹪, PPV VP2 be can calculate according to the Trendline functional relation again and 414.56mg/L, 595.76mg/L, 524.28mg/L are respectively at 48h, 72h, 96h expression, determine that thus optimum expression time is 72h, has namely determined the incubation time of PPV VP2 large scale fermentation.
SEQ?ID?NO:1
CCCTCGAGAAAAGAATGAGTGAAAATGTGGAACAAC
SEQ?ID?NO:2
TTGCGGCCGCCTAGTATAATTTTCTTGGTATAAGTTGTG
Claims (1)
1. the preparation method of porcine parvovirus genetic engineering vaccine, is characterized in that comprising the steps:
(1) according to pig parvoviral VP2 gene order, build recombination yeast carrier pGAPZ α A-VP2;
(2) with linearizing recombination yeast carrier pGAPZ α A-VP2 electric shock transformed yeast bacterial strain SMD1168, the recombination yeast engineering bacteria of the high copy of screening is identified;
(3) the positive recombination yeast engineering bacteria that will identify carries out fermentation culture, expresses pig parvoviral major structural protein VP2;
(4) structural protein of expressing are carried out purification, add adjuvant, make porcine parvovirus genetic engineering vaccine;
Wherein, the recombination yeast engineering bacteria of the high copy of the described screening of step (2) is with after linearizing recombination yeast carrier pGAPZ α A-VP2 electric shock transformed yeast bacterial strain SMD1168, coats respectively that to contain 100 μ L, 150 μ L, 200 μ L concentration be that the YPDS of Zeocin resistance of 100mg/ml is dull and stereotyped; Be inverted lucifuge and cultivated 2 ~ 3 days in 30 ℃ of constant incubators, treat that single bacterium colony of white grows, namely filter out the height copy recombination yeast engineering bacteria under different Zeocin resistance concentration;
Described adjuvant is the nanometer adjuvant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110239759 CN102319440B (en) | 2011-08-19 | 2011-08-19 | Preparation method of porcine parvovirus genetic engineering vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110239759 CN102319440B (en) | 2011-08-19 | 2011-08-19 | Preparation method of porcine parvovirus genetic engineering vaccine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102319440A CN102319440A (en) | 2012-01-18 |
| CN102319440B true CN102319440B (en) | 2013-06-19 |
Family
ID=45447354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110239759 Active CN102319440B (en) | 2011-08-19 | 2011-08-19 | Preparation method of porcine parvovirus genetic engineering vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102319440B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661496A (en) * | 2017-10-25 | 2018-02-06 | 复旦大学 | A kind of pig parvoviral immune composition and preparation method and application |
| CN108096573A (en) * | 2017-10-25 | 2018-06-01 | 复旦大学 | A kind of pig parvoviral oral vaccine composition and preparation method and application |
| CN108776225A (en) * | 2018-05-23 | 2018-11-09 | 中国农业科学院兰州兽医研究所 | Pig parvoviral VLPs antibody assay kits and preparation method thereof, application |
| CN116102660B (en) * | 2022-09-19 | 2023-11-21 | 扬州优邦生物药品有限公司 | Porcine parvovirus gene engineering epitope vaccine and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016547A (en) * | 2007-01-25 | 2007-08-15 | 浙江大学 | Method of preparing ocean double RNA virus MABV recombination albumen and application thereof |
| CN101289657A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene |
-
2011
- 2011-08-19 CN CN 201110239759 patent/CN102319440B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016547A (en) * | 2007-01-25 | 2007-08-15 | 浙江大学 | Method of preparing ocean double RNA virus MABV recombination albumen and application thereof |
| CN101289657A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene |
Non-Patent Citations (2)
| Title |
|---|
| 猪细小病毒结构蛋白VP2研究进展;甄洪花等;《动物医学进展》;20091231;第30卷(第8期);正文第86页左栏第34-39行 * |
| 甄洪花等.猪细小病毒结构蛋白VP2研究进展.《动物医学进展》.2009,第30卷(第8期),正文第86页左栏第34-39行. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102319440A (en) | 2012-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Matsuo et al. | Generation of replication-defective virus-based vaccines that confer full protection in sheep against virulent bluetongue virus challenge | |
| CN101457215B (en) | Recombinant porcine pseudorabies virus-porcine propagate and breath complex virus-porcine circovirus genetic engineering strain and application | |
| CN103436553B (en) | A kind of method preparing restructuring coxsackie virus A 16-type virus-like particle | |
| CN102319440B (en) | Preparation method of porcine parvovirus genetic engineering vaccine | |
| CN101884787A (en) | Porcine circovirus type 2 subunit vaccine and preparation method thereof | |
| CN101380468A (en) | Porcine reproductive and respiratory syndrome bivalence recombinant adenovirus vaccine and preparation method thereof | |
| CN102127533A (en) | Preparation method of recombinant porcine circovirus type 2 Cap antigen | |
| US11608361B2 (en) | Norovirus fusion proteins and VLPS comprising norovirus fusion proteins | |
| CN104248762A (en) | Porcine epidemic diarrhea vaccine composition, and preparation method and application thereof | |
| CN102488895A (en) | Porcine circovirus, porcine parvovirus and porcine reproductive and respiratory syndrome virus triple virus-like particle vaccine and its preparation method | |
| Li et al. | Recombinant gp90 protein expressed in Pichia pastoris induces a protective immune response against reticuloendotheliosis virus in chickens | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN103525855A (en) | Method for preparing recombinant enterovirus 71 type virus-like particle | |
| CN104292339A (en) | Recombinant protein containing SARS virus RBD antigen and baculovirus displaying RBD protein | |
| CN102580076A (en) | Synthetic peptide vaccine for O-type foot and mouth disease of swine and preparation method thereof | |
| CN102727884A (en) | Combined live vaccine against porcine reproductive and respiratory syndrome and pseudorabies, and preparation method thereof | |
| CN101624580A (en) | Recombinant baculovirus expressing manually modified and synthesized influenza A H1N1 virus HA-NA-M1 gene | |
| CN109721643A (en) | A kind of PRRSV-1 virus-like particle and preparation method thereof | |
| CN103059142B (en) | Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN103641913B (en) | A kind of Hansenula yeast HCP preparation method for antibody, antibody and its application is made | |
| CN105349578A (en) | Chicken GM-CSF protein, and preparation method and application thereof | |
| CN102337248B (en) | Recombinant baby hamster kidney (BHK) cell line capable of expressing encephalitis B virus PrM/M-E protein and application thereof | |
| CN103103205B (en) | Gene for encoding recombinant porcine circovirus type 2 (PCV2) Cap protein and application of gene | |
| CN102038945A (en) | Method for industrially producing swine parvovirus vaccine by utilizing bioreactor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211213 Address after: Room 503, building 3, No. 133, development avenue, Tongxiang Economic Development Zone, Tongxiang City, Jiaxing City, Zhejiang Province Patentee after: ZHEJIANG MAIZHI NETWORK TECHNOLOGY CO.,LTD. Address before: 510642 No. five, 483 mountain road, Guangzhou, Guangdong, Tianhe District Patentee before: SOUTH CHINA AGRICULTURAL University |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20221229 Address after: 314500 No.1 Gongnong Road, South Gate, Chongfu Town, Tongxiang City, Jiaxing City, Zhejiang Province Patentee after: Jiaxing Zhuoshi Biotechnology Co.,Ltd. Address before: Room 503, building 3, No. 133, development avenue, Tongxiang Economic Development Zone, Tongxiang City, Jiaxing City, Zhejiang Province Patentee before: ZHEJIANG MAIZHI NETWORK TECHNOLOGY CO.,LTD. |
|
| TR01 | Transfer of patent right |