CN102319440A - A kind of method for preparing of pig parvoviral recombinant vaccine - Google Patents
A kind of method for preparing of pig parvoviral recombinant vaccine Download PDFInfo
- Publication number
- CN102319440A CN102319440A CN201110239759A CN201110239759A CN102319440A CN 102319440 A CN102319440 A CN 102319440A CN 201110239759 A CN201110239759 A CN 201110239759A CN 201110239759 A CN201110239759 A CN 201110239759A CN 102319440 A CN102319440 A CN 102319440A
- Authority
- CN
- China
- Prior art keywords
- pig parvoviral
- recombinant vaccine
- preparing
- recombination yeast
- vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a kind of method for preparing of pig parvoviral recombinant vaccine.The method of the invention at first is to make up recombinant yeast expression vector pGAPZ α A-VP2; Electric shock transforms pichia pastoris phaff bacterial strain SMD1168 then; Make VP2 albumen efficient secretory expression in the YPD culture medium, form the virus-like particle that does not contain viral nucleic acid, then purifying protein; Through SDS-PAGE and WesternBlot and Electronic Speculum detection, add corresponding immunological adjuvant and promptly processed the pig parvoviral recombinant vaccine.The pig parvoviral recombinant vaccine that the method for the invention makes has solved the defective that current pig parvoviral traditional vaccine exists; Can be used for preventing and treating the relevant disease that pig parvoviral infects and causes, be applicable to that too preparation detects the envelope antigen of pig parvoviral antibody ELISA test kit.
Description
Technical field
The present invention relates to the genetic engineering field, be specifically related to a kind of method for preparing of pig parvoviral recombinant vaccine.
Background technology
Pig parvoviral (Porcine parvovirus; PPV) be a kind of self-replicating type virus; Be to cause that sow produces one of principal element of monster; Usually first farrowing sow can cause breeding difficulty after infecting PPV, mainly shows as miscarriage, infertile, product stillborn fetus and mummy tire etc., brings great economic loss to pig industry.PPV, pig circular ring virus (PCV), porcine reproductive and respiratory syndrome virus (PRRSV) are the focuses of swine diseases research always, discover that recently PPV is playing the part of important role in pig wean back multisystemic exhaustion syndrome (PMWS).
The PPV genome is a strand wire dna molecular, and size is about 5000 nucleotide, and sophisticated virion only contains the minus-strand dna genome.Discover that PPV has very high homology with the genome of other parvovirus that parvovirus belongs to.In addition, the genome structure of PPV is similar with other parvovirus, and there is hairpin structure at two ends, " Y " font hairpin structure that 3 ' end has the palindrome of one 102 bp to be folded to form; 5 ' end has the palindrome of one 127 bp, middle " U " font hairpin structure that is interrupted and be folded to form by the short palindrome of one 24 bp, and it is very important that this end structure duplicates it.Genome has 2 open reading frames (ORF), the ORF1 coding non-structural protein (promptly regulating albumen) of 5 ' end, and the ORF2 coding structure albumen of 3 ' end, structural protein are the main immunogenic antigen of PPV.NS gene code 3 kinds of non-structural protein NS 1s, NS2 and NS3 by promoter P4 transcriptional start; By promoter P40 transcriptional start translation 3 kinds of structural protein VP1, VP2 and VP3, their molecular mass is about 83,64 respectively, 60ku.
The vaccine of anti-in the market system PPV mainly contains inactivated vaccine and attenuated vaccine.Find that in clinical practice inactivated vaccine has following shortcoming: (1) needs heavy dose of inoculation or uses concentrated antigen, and duration of immunity is short, often needs to strengthen inoculation; (2) can not cause local immunity, so that a little less than the effect of cellular immunization; (3) producing complete immunity needs 2-3 week, is unfavorable for urgent prophylactic immunization and reduces the vaccine expense; (4) there is the thorough and diffusing malicious possibility of deactivation.And attenuated vaccine exists that virulence is returned by force, the danger of reorganization and latent infection, is difficult to apply in practice.So traditional vaccine exposes increasing problem in anti-system PPV, a kind of novel not only safety but also recombinant vaccine is extremely urgent reliably.
VP2 is the main component that constitutes the PPV capsid protein, also is the target protein of neutralizing antibody effect, contains the major antigen determinant of virus, also has hemagglutination activity.The polypeptide of VP2 gene code can the oneself be assembled into viroid particle (VLPs), can induce very strong immunne response.Zhao Junlong etc. discover PPV VP2 at 60-68,81-88, and 266-275, there are the dominant area of antigen site in 351-357 and 398-404 aminoacid place.The section that discovery VP2 albumen such as beam is beautiful may become the B cell epitope is positioned at N and holds 10-18,34-39,94-103,121-126,137-144,156-165 and 209-214 section.Scholars such as Soren K have analyzed the antigenic structure of PPV, and finding has 9 linear epitopes all to be arranged in VP2, have only VP2 N end epi-position can induce virucidin, and VP2 albumen can form VLPs during with the mammal cell line expression or with baculovirus expression.From the virion Electronic Speculum figure of separation and purification, can find the virion of two kinds of forms: a kind of is complete virus particle, includes PPV ssDNA; Another kind is a virus hollow capsid, interior no DNA, and VP2 content is the highest in the virus hollow capsid, and this " hollow " virion still has good immunogenicity.2007, Yi G X etc. expressed VP2 albumen with recombinant lactic acid bacteria, and it shows good immunogenicity.Based on These characteristics, VP2 becomes the focus of PPV aspect diagnosis and immunology research.
Summary of the invention
The objective of the invention is to so be the basis with the structural protein of this high expressed amount, provides the pig parvoviral recombinant vaccine according to efficiently expressing pig parvoviral primary structure albumen VP2 gene in the pichia pastoris phaff.
Above-mentioned purpose of the present invention is achieved through following technical scheme:
1. structure recombinant yeast expression vector: on GenBank, search international standard low virulent strain pig parvoviral VP2 gene; Serial number: NC-001718; Expression vector is pGAPZ α A; The host bacterium is yeast strain SMD1168 (available from an Invitrogen company), makes up pGAPZ α A-VP2 recombinant yeast expression vector.Pcr amplification goes out PPV VP2 complete genome sequence, and forward primer P1 is shown in SEQ ID NO:1, and downstream primer P2 is shown in SEQ ID NO:2, and restriction enzyme site is Xho I and Not I,
AAAAGABe the Kex2 protease cutting site.
2. make up the recombination yeast engineering bacteria: its linearisation electric shock is transformed pichia pastoris phaff, construction expression engineering bacteria.With competence
P.pastorisSMD1168 100 μ L with mix mutually through the linearizing pGAPZ α of Avr II A-VP2 10 μ g; Ice bath 5min, 300V, 200 electric shock 15ms add the sorbitol of 1ml 1M then rapidly; Yeast cells after transforming is laid on the YPDS dull and stereotyped (containing 100 mg/ml Zeocin) of prepared fresh; Flat board is inverted, is cultured to single bacterium colony in 30 ℃ and occurs, cultivate 2 ~ 3 d.Employing boils-freezes-and cooking method prepares PCR template analysis P.pastoris transformant.Through the high copy of the YPDS of variable concentrations Zeocin plate screening transformant, be used for high efficiency expressing destination protein again.
3. the non-abduction delivering of recombination yeast engineering bacteria: the single bacterium colony with the choicest of sterilization rifle screens with Zeocin resistance, in the YPD of 5mL fluid medium, carry out one-level and cultivate, 30 ℃, 200 r/min shaken overnight are to OD
600=2-6, promptly cell is in exponential phase.Get 1mL one-level culture fluid, be resuspended among the YPD of 50mL, continue shaken cultivation, add two-layer newspaper wrapping, cultivated about 72 hours with four layers of clean gauze.
4. the purification of expressing protein: cultivate about 72 hours culture low-speed centrifugal and collect supernatant, with method purifying proteins such as film systems.
5. the preparation of PPV recombinant vaccine: supernatant is expressed in appeal carry out SDS-PAGE and Western Blot analysis; Then penicillin, streptomycin are mixed with the albumen of separation and purification; The nanometer adjuvant that adds import again mixes with physiology saline or PBS; The mixture pH value is transferred to biological value, and promptly PH7.0-7.5 has promptly prepared the pig parvoviral recombinant vaccine.
Because PPV VP2 albumen is minimum to the preference property difference of codon to the preference property and the pichia pastoris phaff expression system of codon; So select pichia yeast expression system; And it is very favourable to expressing foreign protein; (1) high stable: the expression vector of this system is not that the plasmid form with self-replicating exists, but is incorporated on the yeast chromosomal, so the bacterial strain that makes up is very stable; (2) high secretion: the molecular biological characteristic research of the α-factor signal peptide in the pichia pastoris phaff expression system fully aware of, it self biological characteristics in addition, its secreting, expressing can reach 1g/L, this in known secreting, expressing system very rarely; (3) cost is low: the expression ratio of recombiant protein in pichia pastoris phaff is expressed as originally low in insecticide and mammal; Culture medium need be as bovine serum albumin expensive additive, do not need the equipment of costlinesses such as CO2 gas incubator and incubator for tissue culture yet; (4) amplify easily: the expression of recombiant protein in pichia pastoris phaff realized suitability for industrialized production in 1000 L fermentation tanks.
Compared with prior art, the present invention has following beneficial effect:
The destination protein that recombinant yeast of the present invention is expressed is very high; And destination protein is secreted in the culture medium; And the albumen of yeast oneself expression is not owing to there is signal peptide can't be secreted in the culture medium; Almost do not have foreign protein (seeing accompanying drawing 1) so express in the supernatant, and yeast strain SMD1168 belongs to the protease-deficient bacterial strain, prevented the destination protein degraded; Because expression vector pGAPZ α A contains α-factor signal peptide; Being easy to expression product is secreted in the culture medium; Thereby more easy separation purification destination protein has been avoided because the more firm difficult fragmentation of yeast cell wall is obtained and the difficult problem of purifying protein, and has been introduced Kex2 protease at PPV VP2 albumen n end; Guaranteeing that it forms natural N end, thereby guaranteed the proteic BA of VP2.
The codon of PPV VP2 and escherichia coli, yeast, people's codon-bias variation analysis is found; The difference of VP2 codon and yeast codon-bias is minimum; So select the yeast expression system optimization expression to improve expression; And the domestic VP2 of opinion expresses relevant report in yeast, and VP2 expressing quantity of the present invention obviously is superior to other expression systems up to 595.76mg/L (seeing embodiment 3).
The Yeast expression carrier pGAPZ α A that the present invention selects is a kind of non-composing type secretion expression carrier of inducing; Contain the glyceraldehyde 3-phosphate dehydro-genase strong promoter; Be superior to other promoteres; Expression is higher, does not importantly need methanol induction, has prevented the dangerous of methanol and to the toxic and side effects of yeast cells.
The present invention has carried out desk study from carbon source and nitrogenous source to fermentation condition; Discover from cost and expression two factors; Be superior to glycerol with glucose as carbon source; Be superior to tryptone and ammonium sulfate with carbamide as nitrogenous source, intermittently flow the growth that supplementary carbon source and nitrogenous source in addition more help yeast cells; And the dissolved oxygen amount in the fermentation tank plays a part very importantly to the raising of yeast growth and expression during the fermentation, particularly ferments the 3rd day, and dissolved oxygen amount requires higher, guarantees that simultaneously fermentating liquid PH value is between 5.5-6.0.
Description of drawings
Fig. 1 is the analysis of PPV VP2 protein SDS-PAGE, 1: express supernatant without concentrated pGAPZ α A-VP2; 2:pGAPZ α A empty carrier is expressed supernatant; M: dye molecular weight of albumen Marker in advance;
Fig. 2 is that PPV VP2 albumen Western Blot analyzes 1,2: express supernatant without concentrated pGAPZ α A-VP2; M: dye molecular weight of albumen Marker in advance; 3:pGAPZ α A empty carrier is expressed supernatant.
Fig. 3 is the standard protein BSA concentration curve that PPV VP2 determination of protein concentration is made among the embodiment 3.
The specific embodiment
Come further to explain the present invention below in conjunction with embodiment, but embodiment does not do any type of qualification to the present invention.
1. structure recombinant yeast expression vector: expression vector is pGAPZ α A, and the host bacterium is yeast strain SMD1168.Pcr amplification goes out PPV VP2 complete genome sequence, and forward primer P1 is shown in SEQ ID NO:1, and downstream primer P2 is shown in SEQ ID NO:2, and restriction enzyme site is Xho I and Not I,
AAAAGABe the Kex2 protease cutting site.
2. make up the recombination yeast engineering bacteria: with the above-mentioned recombinant yeast expression vector linearisation electric shock transformed yeast bacterial strain SMD1168 that builds, the linearisation enzyme is the Avr II.
3. the non-abduction delivering of recombination yeast engineering bacteria: the single bacterium colony with the choicest of sterilization rifle screens with Zeocin resistance, in the YPD of 5mL fluid medium, carry out one-level and cultivate, 30 ℃, 200 r/min shaken overnight are to OD
600=2-6, promptly cell is in exponential phase.Get 1mL one-level culture fluid, be resuspended among the YPD of 50mL, continue shaken cultivation, add two-layer newspaper wrapping, cultivated about 72 hours with four layers of clean gauze.
4. the purification of expressing protein: cultivate about 72 hours culture low-speed centrifugal and collect supernatant, with method purifying proteins such as film systems.
5. the preparation of PPV recombinant vaccine: supernatant is expressed in appeal carry out SDS-PAGE and Western Blot analysis (Fig. 1 ~ 2); Then penicillin, streptomycin are mixed with the albumen of separation and purification; Adding adjuvant again mixes with physiology saline or PBS; The mixture pH value is transferred to biological value, and promptly PH7.0-7.5 has promptly prepared the pig parvoviral recombinant vaccine.Adjuvant is selected import nanometer adjuvant for use.
Zoopery: with the basic zero difference of PPV recombinant vaccine immunity body weight, the negative piglet of the good PPV of mental status of above-mentioned preparation; The blank of establishing positive control, empty carrier contrast, normal saline contrast, adjuvant contrast simultaneously and being left intact; Booster immunization after 15 days; After the ELISA test kit detects generation antibody, use pig parvoviral virulent strain to carry out counteracting toxic substances experiment (except the F group), to detect the antibody that is produced whether protection is arranged.Test as follows:
| Test group | Inoculum | Dosage |
| The A group | The PPV |
3 parts |
| The B group | Positive control (malicious Seedling a little less than the PPV) | 3 parts |
| The C group | The empty carrier contrast | 3 parts |
| The D group | The |
3 parts |
| The E group | The |
3 parts |
| The F group | The blank that is left intact | ? |
The result: booster immunization after 15 days, detect through the ELISA test kit, A group and B group produce antibody, and antibody titer is very high, and C group, D group, E group and F group do not detect antibody.Weigh before using PPV virulent strain counteracting toxic substances, do significance of difference analysis, five groups and the comparison of F group, difference is not remarkable.All in 7 days, heating paresthesia occurs behind the counteracting toxic substances, A, B group fever time are about 2-5 days, disappear subsequently, and be no abnormal with F group contrast expression.C group, D group and E group engender slightly the symptoms such as heating, diarrhoea, arthritis and dermatitis to moderate, performance inappetence, the depressed and growth retardation of spirit, some in addition develop into cad pig, indivedual pigs die of exhaustion because of multisystem.Result of the test shows that the pig parvoviral recombinant vaccine is enough to porcine parvovirus is protected, even is better than malicious Seedling a little less than the PPV.So infer the effectively infection of prevention and control porcine parvovirus of the pig parvoviral recombinant vaccine of PPV primary structure protein Preparation thus.
PPV VP2 expression is measured: VP2 expresses the supernatant determination of protein concentration and adopts Bradford determination of protein concentration test kit, has a spot of tropina owing to express in the supernatant, so the concentration of measuring is total protein concentration, concrete steps are following:
1. complete soluble protein standard substance BSA (5mg/mL) gets 10 μ L and is diluted to 100 μ L, and making final concentration is 0.5mg/mL.With PBS dilution standard article.
2. the standard substance after will diluting are added in the standard substance hole of 96 orifice plates by 0,1,2,4,8,12,16,20 μ L, add the PBS diluent and supply 20 μ L.
3. be that the supernatant 10 μ L of 48h, 72h, 96h are added in the sample well of 96 orifice plates with VP2 expression time respectively, add PBS diluent to 20 μ L.
4. each hole adds 200 μ L G250 dyeing liquors, and room temperature was placed 3-5 minute.
5. use ELIASA to measure the absorbance of wavelength as 595nm.
6. calculate the protein concentration in the VP2 supernatant of different expression time according to standard curve.
The concentration that said method is measured is the total protein concentration in the supernatant, accounts for the percentage ratio of total protein again according to purpose band VP2 albumen in the scanning densitometer scanning SDS-PAGE glue, can calculate the expression of VP2 at different time.
Result: according to the OD of standard protein BSA under variable concentrations
595Value is the X axle with the protein concentration, and the OD value is the Y axle, and production standard protein concentration curve sees that accompanying drawing 3. reuse Microsoft Excels are according to normal concentration curve plotting Trendline, wherein degree of association R
2Up to 95.41%, the Trendline functional relation is: y=1.465x+0.6341.VP2 albumen is expressed the OD of supernatant at 48h, 72h, 96h
595Value is respectively 0.9479,1.0851,1.0310; Accounting for total protein percentage ratio through scanning densitometer scanning VP2 albumen is 96.77 ﹪; PPV VP2 be can calculate according to the Trendline functional relation again and 414.56mg/L, 595.76mg/L, 524.28mg/L are respectively at 48h, 72h, 96h expression; Confirm that thus optimum expression time is 72h, has promptly confirmed the incubation time of PPV VP2 large scale fermentation.
SEQ?ID?NO:1
CCCTCGAGAAAAGAATGAGTGAAAATGTGGAACAAC
SEQ?ID?NO:2
TTGCGGCCGCCTAGTATAATTTTCTTGGTATAAGTTGTG
Claims (3)
1. the method for preparing of pig parvoviral recombinant vaccine is characterized in that comprising the steps:
(1), makes up recombination yeast carrier pGAPZ α A-VP2 according to pig parvoviral VP2 gene order;
(2) with linearizing recombination yeast carrier pGAPZ α A-VP2 electric shock transformed yeast bacterial strain SMD1168, the recombination yeast engineering bacteria of the high copy of screening is identified;
(3) the positive recombination yeast engineering bacteria that will identify carries out fermentation culture, expresses pig parvoviral primary structure albumen VP2;
(4) structural protein of expressing are carried out purification, add adjuvant, make the pig parvoviral recombinant vaccine.
2. according to the method for preparing of the said pig parvoviral recombinant vaccine of claim 1; The recombination yeast engineering bacteria that it is characterized in that the high copy of the said screening of step (2) is with behind the linearizing recombination yeast carrier pGAPZ α A-VP2 electric shock transformed yeast bacterial strain SMD1168; Separate application is dull and stereotyped in the YPDS that contains 100 μ L, 150 μ L, 200 μ L Zeocin (100mg/ml) resistances; In 30 ℃ of constant incubators, being inverted lucifuge cultivated 2 ~ 3 days; Single bacterium colony of treating white grows, and promptly filters out the height copy recombination yeast engineering bacteria under the different Zeocin resistance concentration.
3. according to the method for preparing of the said pig parvoviral recombinant vaccine of claim 1, it is characterized in that said adjuvant is the nanometer adjuvant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110239759 CN102319440B (en) | 2011-08-19 | 2011-08-19 | Preparation method of porcine parvovirus genetic engineering vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110239759 CN102319440B (en) | 2011-08-19 | 2011-08-19 | Preparation method of porcine parvovirus genetic engineering vaccine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102319440A true CN102319440A (en) | 2012-01-18 |
| CN102319440B CN102319440B (en) | 2013-06-19 |
Family
ID=45447354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110239759 Active CN102319440B (en) | 2011-08-19 | 2011-08-19 | Preparation method of porcine parvovirus genetic engineering vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102319440B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661496A (en) * | 2017-10-25 | 2018-02-06 | 复旦大学 | A kind of pig parvoviral immune composition and preparation method and application |
| CN108096573A (en) * | 2017-10-25 | 2018-06-01 | 复旦大学 | A kind of pig parvoviral oral vaccine composition and preparation method and application |
| CN108776225A (en) * | 2018-05-23 | 2018-11-09 | 中国农业科学院兰州兽医研究所 | Pig parvoviral VLPs antibody assay kits and preparation method thereof, application |
| CN116102660A (en) * | 2022-09-19 | 2023-05-12 | 扬州优邦生物药品有限公司 | Porcine parvovirus gene engineering epitope vaccine and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016547A (en) * | 2007-01-25 | 2007-08-15 | 浙江大学 | Method of preparing ocean double RNA virus MABV recombination albumen and application thereof |
| CN101289657A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene |
-
2011
- 2011-08-19 CN CN 201110239759 patent/CN102319440B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016547A (en) * | 2007-01-25 | 2007-08-15 | 浙江大学 | Method of preparing ocean double RNA virus MABV recombination albumen and application thereof |
| CN101289657A (en) * | 2008-03-28 | 2008-10-22 | 江苏省农业科学院 | Recombination porcine parvovirus VP2 virus particles for expressing exogenous gene |
Non-Patent Citations (1)
| Title |
|---|
| 甄洪花等: "猪细小病毒结构蛋白VP2研究进展", 《动物医学进展》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661496A (en) * | 2017-10-25 | 2018-02-06 | 复旦大学 | A kind of pig parvoviral immune composition and preparation method and application |
| CN108096573A (en) * | 2017-10-25 | 2018-06-01 | 复旦大学 | A kind of pig parvoviral oral vaccine composition and preparation method and application |
| CN108776225A (en) * | 2018-05-23 | 2018-11-09 | 中国农业科学院兰州兽医研究所 | Pig parvoviral VLPs antibody assay kits and preparation method thereof, application |
| CN116102660A (en) * | 2022-09-19 | 2023-05-12 | 扬州优邦生物药品有限公司 | Porcine parvovirus gene engineering epitope vaccine and preparation method thereof |
| CN116102660B (en) * | 2022-09-19 | 2023-11-21 | 扬州优邦生物药品有限公司 | Porcine parvovirus gene engineering epitope vaccine and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102319440B (en) | 2013-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Matsuo et al. | Generation of replication-defective virus-based vaccines that confer full protection in sheep against virulent bluetongue virus challenge | |
| Izeta et al. | Replication and packaging of transmissible gastroenteritis coronavirus-derived synthetic minigenomes | |
| EP2985288B1 (en) | Porcine pseudorabies virus, vaccine composition and preparation method and use thereof | |
| CN101457215B (en) | Recombinant porcine pseudorabies virus-porcine propagate and breath complex virus-porcine circovirus genetic engineering strain and application | |
| CN102319440B (en) | Preparation method of porcine parvovirus genetic engineering vaccine | |
| US20120189655A1 (en) | Attenuated Live Vaccine for Prevention of Porcine Reproductive and Respiratory Syndrome | |
| CN101380468A (en) | Porcine reproductive and respiratory syndrome bivalence recombinant adenovirus vaccine and preparation method thereof | |
| CN102127533A (en) | Preparation method of recombinant porcine circovirus type 2 Cap antigen | |
| CN101884787A (en) | Porcine circovirus type 2 subunit vaccine and preparation method thereof | |
| US20200148725A1 (en) | Norovirus fusion proteins and vlps comprising norovirus fusion proteins | |
| Li et al. | Recombinant gp90 protein expressed in Pichia pastoris induces a protective immune response against reticuloendotheliosis virus in chickens | |
| CN103436553A (en) | Method for preparing recombinant coxsackievirus A16 type virus-like particles | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN104292339A (en) | Recombinant protein containing SARS virus RBD antigen and baculovirus displaying RBD protein | |
| CN102580076A (en) | Synthetic peptide vaccine for O-type foot and mouth disease of swine and preparation method thereof | |
| CN101624580A (en) | Recombinant baculovirus expressing manually modified and synthesized influenza A H1N1 virus HA-NA-M1 gene | |
| CN109721643A (en) | A kind of PRRSV-1 virus-like particle and preparation method thereof | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN105349578A (en) | Chicken GM-CSF protein, and preparation method and application thereof | |
| CN103059142B (en) | Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein | |
| CN101401937A (en) | Method of preparing coexpression PRRSV ORF5 and ORF6 double-gene nucleic acid vaccine | |
| CN102337248B (en) | Recombinant baby hamster kidney (BHK) cell line capable of expressing encephalitis B virus PrM/M-E protein and application thereof | |
| CN102038945A (en) | Method for industrially producing swine parvovirus vaccine by utilizing bioreactor | |
| CN104293740A (en) | Recombinant baculovirus with surface displaying SARS bivalent antigen, and preparation method and application thereof | |
| WO2023070873A1 (en) | Method for preparing sars-cov-2 virus-like particles and use of sars-cov-2 virus-like particles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211213 Address after: Room 503, building 3, No. 133, development avenue, Tongxiang Economic Development Zone, Tongxiang City, Jiaxing City, Zhejiang Province Patentee after: ZHEJIANG MAIZHI NETWORK TECHNOLOGY CO.,LTD. Address before: 510642 No. five, 483 mountain road, Guangzhou, Guangdong, Tianhe District Patentee before: SOUTH CHINA AGRICULTURAL University |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20221229 Address after: 314500 No.1 Gongnong Road, South Gate, Chongfu Town, Tongxiang City, Jiaxing City, Zhejiang Province Patentee after: Jiaxing Zhuoshi Biotechnology Co.,Ltd. Address before: Room 503, building 3, No. 133, development avenue, Tongxiang Economic Development Zone, Tongxiang City, Jiaxing City, Zhejiang Province Patentee before: ZHEJIANG MAIZHI NETWORK TECHNOLOGY CO.,LTD. |