CN102304533A

CN102304533A - Flavanone 3',5'-hydroxylase gene and protein coded by same

Info

Publication number: CN102304533A
Application number: CN201110240503A
Authority: CN
Inventors: 马璐琳; 王继华; 吴丽芳; 王祥宁; 张艺萍; 崔光芬; 贾文杰
Original assignee: Flower Research Institute of YAAS
Current assignee: Flower Research Institute of YAAS
Priority date: 2011-08-22
Filing date: 2011-08-22
Publication date: 2012-01-04

Abstract

The invention provides a flavanone 3',5'-hydroxylase gene and protein coded by the same. The flavanone 3',5'-hydroxylase gene Ac-F3'5'H is from Aconitum carmichaeli Debx, and is named as an Ac-F3'5'H gene, wherein a nucleotide sequence of the Ac-F3'5'H gene is shown as SEQ ID NO. 1, an amino acid sequence coded by the Ac-F3'5'H gene is shown as SEQ ID NO. 2, the flavanone 3',5'-hydroxylase gene Ac-F3'5'H in the Aconitum carmichaeli Debx is reported for the first time, and the expression of the flavanone 3',5'-hydroxylase gene Ac-F3'5'H can promote plants to synthesize delphinium anthocyanins, so that the colors of the plants are expressed as blue. The flavanone 3',5'-hydroxylase gene Ac-F3'5'H is inoculated into other flowers which are deficient in blue color systems, so that flower varieties with blue colors are expected to be cultivated to improve the ornamental performance of the flowers.

Description

Flavanone 3 ', 5 '-'-hydroxylase gene and coded protein thereof

Technical field

The invention discloses one from Radix Aconiti ( Aconitum carmichaeliDebx) flavanone 3 ', 5 '-'-hydroxylase gene (Ac-F3 ' 5 ' H) and coded protein thereof belong to gene engineering technology field.

Background technology

Pattern is one of the most important fancy points of ornamental plant and economic characters.Blue give the people graceful with fantasy sensation, but the world's four big fresh cutting flower all lack blue series at present, therefore cultivating blue flowers has become one of focus that pattern is studied and improved in the nearly flower breeding during the last ten years.

At present; Although the conventional breeding method can be cultivated many new assortment; But the reproduction that is difficult to break between genus, kind is isolated, and in the utilization of resource especially Resources of Wild, has bigger limitation, makes some important breeding objective such as blue pattern etc. be difficult to realize.The world's four big cut-flowers all lack blue kind; This is because they all lack ability synthesizing blue pigment---the key gene of Herba delphinii grandiflori pigment; It is flavanone 3 '; 5 '-'-hydroxylase gene (flavanone3 '; 5 '-hydroxylase; Be called for short F3 ' 5 ' H), and genetically engineered or molecular breeding just in time can remedy the technological deficiency of conventional breeding, are the necessary means that changes pattern.F3 ' 5 ' H belongs to (the cytochrome P450 of cytochrome P 450 enzymes family; CYP450); It is the key enzyme in the blue pigment glycosides building-up process; It can with flavanone 3 '-hydroxylase (flavanone3 '-hydroxylase; Be called for short F3 ' H) and flavonol synthase (flavonol synthase; Be called for short FLS) the competition substrate; Catalysis flavanone (flavanone); Eriodictyol (eriodictyol); Dihydrokaempferol (dihydrokaempferol; DHK) etc. form dihydromyricetin flavones (dihydromyricetin; DHM); Be the precursor that blue pigment forms, therefore, F3 ' 5 ' H also is called as " Blue Gene/" (Holton Et alCloning and expression of cytochrome P450 genes controlling flower colour NATURE Nature.Vol.366, No18.pp.276-279,1993).Why a lot of ornamental plants such as Chinese rose, chrysanthemum, lily etc. lack blue system, mainly are because do not contain or only contain a spot of F3 ' 5 ' H.Successively in various plants, isolate F3 ' 5 ' H gene in recent years, and its expression pattern and function have been carried out preliminary study, the seed selection work (Mori that is used to blue pattern flower variety that has wherein had Et alHeterologous expression of the flavonoid-3 ', 5 '-hydroxylase gene of Vinca majorAlters flower color in transgenic Petunia hybridaPLANT CELL REPORTS Vol.22, No. 6, pp.415-421,2004; Katsumoto Y Et alEngineering of the Rose Flavonoid Biosynthetic Pathway Successfully Generated Blue-Hued Flowers Accumulating Delphinidin PLANT AND CELL PHYSIOLOPY Vol.48; Issue of November 11; Pp.1589-1600,2010).But in the rhizome of Chinese monkshood, also do not find the report of this genoid.

Radix Aconiti is the distinctive wild blue pattern plant of China, and the bright orchid of its pattern is unusual beautiful.So flavanone 3 ', 5 '-'-hydroxylase gene that we clone can import other flowers as in the four big cut-flowers, is expected to cultivate through genetic engineering means the flower variety of the blue pattern of market popularity, improve flower ornamental property from Radix Aconiti.

Summary of the invention

The object of the present invention is to provide one from Radix Aconiti ( Aconitum carmichaeliFlavanone 3 ', 5 '-'-hydroxylase gene Debx) ( Ac-F3 ' 5 ' H) and coded protein, so that import in the kinds such as other flowers such as Chinese rose, carnation, Dianthus caryophyllus L., African chrysanthemum, lily, thereby breed blue flower variety as goal gene, improve flower ornamental property.

Flavanone 3 ', 5 '-'-hydroxylase gene provided by the invention (Ac-F3 ' 5 ' H) and coded protein thereof, from Radix Aconiti ( Aconitum carmichaeliDebx), called after Ac-F3 ' 5 ' H gene, the nucleotides sequence of this flavanone 3 ', 5 '-'-hydroxylase gene Ac-F3 ' 5 ' H is classified SEQ ID NO.1 as.This flavanone 3 ', 5 '-'-hydroxylase gene Ac-F3 ' 5 ' H encoded protein matter, called after Ac-F3 ' 5 ' H protein, its aminoacid sequence are SEQ ID NO.2.

Advantage of the present invention and effect are: owing to the invention provides flavanone 3 ', 5 '-'-hydroxylase gene Ac-F3 ' 5 ' H and coded protein thereof, and this gene from Radix Aconiti ( Aconitum carmichaeliDebx), be reported first in the Radix Aconiti, this expression of gene can be impelled phytosynthesis Herba delphinii grandiflori pigment and make the plant flowers look show as blueness.This gene can be used as goal gene and imports other and lack the flowers of Regulation and Blue Flowers colour system, like kinds such as Chinese rose, carnation, Dianthus caryophyllus L., African chrysanthemum, lilies, thereby is expected to cultivate the flower variety of blue pattern, to improve flower ornamental property.

Description of drawings

Fig. 1 doesWith in Radix Aconiti, the increase result of F3 ' 5 ' H gene of W-FH-F and W-FH-R primer, the 887bp band is the purpose band;

Fig. 2 is Radix Aconiti F3 ' 5 ' H gene RACE result: the A figure among Fig. 2 is 3 '-RACE result, and the B figure among Fig. 2 is 5 '-RACE result, and the M among the figure is Marker, and 1 is two primer amplification results, and 2 and 3 is single primer amplification result, 4 negative contrasts;

Fig. 3 is Marker in the Radix Aconiti petal, clone Ac-F3 ' 5 ' H full length gene cDNA clone result: M with W1-FH-F and W1-FH-R primer, and 1 is Ac-F3 ' 5 ' H full length gene cDNA amplification, 2 negative contrasts;

Fig. 4 is that Ac-F3 ' 5 ' H is in Radix Aconiti flower different development stage expression of results;

Fig. 5 be Ac-F3 ' 5 ' H at Radix Aconiti plant different tissues position expression of results.

Embodiment

1, utilize degenerate primer in the Radix Aconiti flower, to carry out the segmental clone of candidate gene

At radix aconiti sinensis (public material; " tissue culture method is bred the radix aconiti sinensis seedling fast " Chinese wild plant resource CHINESEWILDPLANTRESOURCES2004 of Qu Suping etc.; 23(4): the 62-63) florescence; Get its different development stage flower and put rapidly in the liquid nitrogen freezing after; Use TRIZOL(invitogen) extract total RNA respectively by the reagent specification; Get total RNA of radix aconiti sinensis flower different development stage respectively; Utilizing AMV reverse transcriptase (TaKaRa) is cDNA by the reverse transcription of reagent specification; Be template for 10 times with the cDNA dilution again; Carry out the PCR reaction with degenerate primer, degenerate primer title and sequence are distinguished as follows:

W-FH-F:?5’-C(A/T/C/G)CA(A/G)GA(T/C)ATGGT(T/C/G)TT(C/T)G-3’

W-FH-R:?5’-C(A/T/G)AT(A/T/C/G)GCCCA(A/T/G)AT(A/G)TT

(A/T/C/G)A-3’

Each 0.5 μ l of the 5 ' primer of 10 μ M and 3 ' primer; 2.5 μ l 10 * buffer; 2.5 the dNTP of μ l 2.5mM; 1.5 the mg of μ l 25mM ²⁺0.25 μ l (5U/ μ l) Taq polymerase (TaKaRa) adds water to 25 μ l, reaction conditions is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30s, 52 ℃ of 45 s, 72 ℃ of 1min, 33 circulations; 72 ℃ are extended 10min; The PCR product detects through 1% agarose gel electrophoresis, and the result can amplify bright band (as shown in Figure 1) from Radix Aconiti flower the 4th period (Radix Aconiti flower different development stage as shown in Figure 4); Amplified band reclaims through cutting glue, is connected with 18-T carrier (TaKaRa), and is transformed into TransIn the 1-T1 competent cell (Beijing Quanshijin Biotechnology Co., Ltd), the screening positive monoclonal checks order, and order-checking is accomplished by Shanghai Jie Li Bioisystech Co., Ltd; Sequencing result finds that through the BLAST comparative analysis this is flavanone 3 ', 5 '-'-hydroxylase gene cDNA fragment, and length is 887bp; Design 3 ' RACE and 5 ' RACE primer respectively according to this sequence, wherein 3 ' RACE primer title and sequence are respectively as follows:

3’innner: 5’-ATCAGGTCATTGGCAGGAAC-3’；

3’out: 5’-AAGGAACATATGGCGACGAG-3’；

5 ' RACE primer title and sequence are distinguished as follows:

5’innner: 5’-CCCAGTCTTCAATGGCCTTA-3’

5’out: 5’-AACTCGTTCGACTCCACACC-3’；

Utilize 3 ' RACE test kit, 3 '-Full RACE Core Set Ver.2.0 (TaKaRa) and 5 ' RACE test kit, 5 '-Full RACE Kit (TaKaRa) respectively; And carry out the amplification of candidate gene 3 ' end and 5 ' terminal sequence respectively according to the test kit specification sheets; The PCR product detects (as shown in Figure 2) through 1% agarose gel electrophoresis; Target stripe is cut that glue reclaims and be connected, and be transformed into 18-T carrier (TaKaRa) TransIn the 1-T1 competent cell (Beijing Quanshijin Biotechnology Co., Ltd), positive monoclonal checks order, and order-checking is accomplished by Shanghai Jie Li Bioisystech Co., Ltd.To sequencing result through the BLAST comparative analysis; And with length be that the candidate gene intermediate segment sequence of 887bp is carried out electronic splicing; The full length cDNA sequence that to obtain a length be 1720bp; Comprise 506 amino acid whose complete 0RF frames of a coding; This gene infers to be flavanone 3 ', 5 '-'-hydroxylase gene.Comprise the complete 0RF frame of 506 amino acid at interior special primer according to obtaining full length cDNA sequence design behind the electronic splicing again, the primer title is distinguished as follows with sequence:

W1-FH-F：5'-GCACCACCAATCACCATG-3'

W1-FH-R：5'-TTCCACAACAATTCTCCC-3'

The c DNA that grew for the 4th period with the Radix Aconiti flower is that template is carried out the RCR reaction: each 0.5 μ l of the 5 ' primer of 10 μ M and 3 ' primer; 2.5 μ l 10 * buffer; 2.5 the dNTP of μ l 2.5mM; 1.5 the mg of μ l 25mM ²⁺0.25 μ l (5U/ μ l) Taq polymerase (TaKaRa) adds water to 25 μ l.Reaction conditions is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30 s, 52 ℃ of 30 s, 72 ℃ of 1min, 33 circulations; 72 ℃ are extended 10min.The PCR product detects through 1% agarose gel electrophoresis, and target stripe reclaims through cutting glue, is connected with 18-T carrier (TaKaRa), and is transformed into TransIn the 1-T1 competent cell (Beijing Quanshijin Biotechnology Co., Ltd), the positive monoclonal that screens checks order, and order-checking is accomplished by Shanghai Jie Li Bioisystech Co., Ltd.This sheet segment length 1560pb comprises and the on all four ORF frame of electronic splicing sequence (ORF frame length, amino acid and base sequence are all in full accord) (as shown in Figure 3).Above test-results proves, the full length cDNA sequence that to obtain a length be 1720bp comprises 506 amino acid whose complete 0RF frames of a coding, and this gene is inferred and is flavanone 3 ', 5 '-'-hydroxylase gene, with its called after Ac-F3 ' 5 ' H.

2, the checking candidate gene is at the expression analysis of different development times of Radix Aconiti flower and plant different sites

Radix Aconiti Ac-F3 ' 5 ' H full length cDNA sequence design gene specific primer according to being obtained carries out this gene expression spectrum analysis, and gene specific primer title and sequence are distinguished as follows:

W2-FH-F:?5’-TGAGTATGCTTCGGTTCT-3’；

W2-FH-R：5’-ATGCTGGTGTTTGCTATG-3’；

With 18s rna gene (FJ748878) internal control gene in the rhizome of Chinese monkshood, internal control gene primer title and sequence are distinguished as follows:

A-18SR-F:5'-TGAGAAACGGCTACCACA-3'，A-18SR-R:5'-ACGCAATAGGACCGAAAT-3'，

Be organized as material with four different plant parts such as the root of Radix Aconiti florescence 5 different development stage flowers and Radix Aconiti, stem, leaf and flowers respectively and carry out the analysis of Ac-F3 ' 5 ' H expression of gene:

Get the flower of 5 different development stages of Radix Aconiti and four different sites tissues such as root, stem, leaf and flower of Radix Aconiti; Extract total RNA with TRIZOL (invitogen) respectively by the reagent specification sheets; Respectively get a certain amount of total RNA utilize AMV ThermoScript II (TaKaRa) by the reagent specification sheets respectively reverse transcription be cDNA, with 10 times of cDNA dilutions as the PCR reaction template.Elder generation adjusts 5 different development stage flowers of Radix Aconiti with the confidential reference items primer and four different sites such as Radix Aconiti root, stem, leaf and flower organize PCR product electrophoresis result to brightness consistent, PCR system and response procedures: each 0.5 μ l of the 5 ' primer of 10 μ M and 3 ' primer; 2.5 μ l 10 * buffer; 2.5 the dNTP of μ l 2.5mM; 1.5 the mg of μ l 25mM ²⁺0.25 μ l (5U/ μ l) Taq polymerase (TaKaRa) adds water to 25 μ l.Reaction conditions is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30 s, 55 ℃ of 45 s, 72 ℃ of 1min, 28 circulations; 72 ℃ are extended 10min.Taking the cDNA that the confidential reference items primer is adjusted to after the PCR reaction product band brightness unanimity is that template is carried out this expression of gene analysis with gene specific primer, and PCR reaction system and response procedures are: each 0.5 μ l of the 5 ' primer of 10 μ M and 3 ' primer; 2.5 μ l 10 * buffer; 2.5 the dNTP of μ l 2.5mM; 1.5 the mg of μ l 25mM ²⁺0.25 μ l (5U/ μ l) Taq polymerase (TaKaRa) adds water to 25 μ l.Reaction conditions is: 94 ℃ of preparatory sex change 3min; 94 ℃ of 30 s, 53 ℃ of 45 s, 72 ℃ of 1min, 28 circulations; 72 ℃ are extended 10min.PCR is electrophoresis detection (like Fig. 4, shown in 5) as a result.

Sequence table

< 110>Flower Research Institute(FRI) of Yunnan

< 120>Radix Aconiti flavanone 3 ', 5 '-'-hydroxylase genes and coded protein thereof

< 130>specification sheets

<140> 00

<141> 2011-07-12

<160> 14

<170> PatentIn?version?3.1

<210> 1

<211> 1720

<212> DNA

< 213>Radix Aconiti (Aconitum carmichaeli Debx)

<220>

< 221>Ac-F3 ' 5 ' H gene cDNA full length sequence

<222> (1)..(1720)

<223>

<400> 1

gaaaatgcac?caccaatcac?catgttgtct?accagagaac?ttgtcgctgc?agcgatcatt 60

tttttcattg?cccgtctctt?cgtgcgtttc?ttgtgctcat?cgaaacaagc?acgcaagctt 120

cctcccggtc?cgaaaggatg?gccagtggtg?ggcgcattac?ccctgctggg?atccatgcct 180

catgttgccc?tggccaagat?gtccaggcaa?tacggcccca?ttgtgtacct?caaattaggt 240

tcgtgtggta?tggttgtcgc?ttcaaccccc?gattcggctc?gtacgttttt?gaaaacccta 300

gacctaaact?tctccaatcg?cccgaccgat?gcaggtgcaa?ctcatatcgc?gtataactca 360

caggacatgg?tgtttgcgga?ctatgggccg?aggtggaagt?tgttgcgtaa?actgactagc 420

ttgcatatgt?taggcagtaa?ggccattgaa?gactgggcta?gagtcaggcg?ggatgaggtg 480

gggtacatgg?ttaaagccat?gtacgagtct?agctgcgtgg?gggaggtggt?tgttgtgccg 540

gatatgctgg?tgtttgctat?ggcgaatatg?cttgggcagg?taatactgag?ccgccgtgtg 600

tttgttacga?aaggtgtgga?gtcgaatgag?tttaaggaga?tggtgatcga?cctaatgaca 660

tcagcggggt?tgtttaatgt?tggtgattat?attccttcga?ttgcatggat?ggatctgcag 720

ggtattgtgc?ggggaatgaa?acgtttgcac?aggaagttcg?atgcgctttt?ggacaaaaag 780

ttgaaggaac?atatggcgac?gagggatgag?aggaaggaga?agccggactt?actcgatgtt 840

ctgatggata?acagggacaa?taagtctgag?caggagaggc?ttactgacac?caacatcaag 900

gctcttctct?tgaacttatt?ctcagctgga?acagacacat?cctcgagcac?aatcgaatgg 960

gcactgacag?agatgataaa?gaaccgaagc?atactcaagc?gcgcacacgc?cgaaatggat 1020

caggtcattg?gcaggaaccg?caggcttgaa?gagtctgaca?taccgaaact?cccctactta 1080

caagcaatat?gcaaagaaac?attcaggaaa?cacccctcaa?cgccgcttaa?ccttccaaga 1140

gtggcgatcg?aaccgtgcga?aatagacgga?tactacatcc?ccaagggcac?aagactcagt 1200

gtgaacatat?gggcgatcgg?gcgagaccca?gacgtgtggg?agaatccgct?cgagttcaac 1260

cccgacagat?tcttaatagg?gaaaatggca?aaaatcgatc?cacggggaaa?taacttcgag 1320

ctgataccat?ttggggcagg?gaggaggata?tgtgcaggga?ctaggatggg?aattgttctt 1380

gttgagtaca?tattggggac?gcttgtgcat?gcatttgaat?ggaagatgcc?tgatggagag 1440

acgctaaaca?tggacgaagc?gtttggttta?gctctacaga?agggtgtgcc?gcttgctgct 1500

gttgttaccc?ctcgcctgcc?accctctgct?tatgtagtct?gaagagttgg?gagaattgtt 1560

gtggaacata?taatagtaat?gttgaagtac?tcttaccaga?aaactaacat?gtatagactt 1620

cgctgtatgc?acattgtgtc?tccgtgtgca?tggtttgtgg?tgttaaaact?tgaaagttac 1680

tggaaataaa?gcttgtgtca?tgtttgataa?aaaaaaaaaa 1720

<210> 2

<211> 506

<212> PRT

< 213>Radix Aconiti (Aconitum carmichaeli Debx)

<220>

< 221>ORF frame aminoacid sequence

<222> (1)..(506)

<223>

<400> 2

Met?Leu?Ser?Thr?Arg?Glu?Leu?Val?Ala?Ala?Ala?Ile?Ile?Phe?Phe?Ile

1 5 10 15

Ala?Arg?Leu?Phe?Val?Arg?Phe?Leu?Cys?Ser?Ser?Lys?Gln?Ala?Arg?Lys

20 25 30

Leu?Pro?Pro?Gly?Pro?Lys?Gly?Trp?Pro?Val?Val?Gly?Ala?Leu?Pro?Leu

35 40 45

Leu?Gly?Ser?Met?Pro?His?Val?Ala?Leu?Ala?Lys?Met?Ser?Arg?Gln?Tyr

50 55 60

Gly?Pro?Ile?Val?Tyr?Leu?Lys?Leu?Gly?Ser?Cys?Gly?Met?Val?Val?Ala

65 70 75 80

Ser?Thr?Pro?Asp?Ser?Ala?Arg?Thr?Phe?Leu?Lys?Thr?Leu?Asp?Leu?Asn

85 90 95

Phe?Ser?Asn?Arg?Pro?Thr?Asp?Ala?Gly?Ala?Thr?His?Ile?Ala?Tyr?Asn

100 105 110

Ser?Gln?Asp?Met?Val?Phe?Ala?Asp?Tyr?Gly?Pro?Arg?Trp?Lys?Leu?Leu

115 120 125

Arg?Lys?Leu?Thr?Ser?Leu?His?Met?Leu?Gly?Ser?Lys?Ala?Ile?Glu?Asp

130 135 140

Trp?Ala?Arg?Val?Arg?Arg?Asp?Glu?Val?Gly?Tyr?Met?Val?Lys?Ala?Met

145 150 155 160

Tyr?Glu?Ser?Ser?Cys?Val?Gly?Glu?Val?Val?Val?Val?Pro?Asp?Met?Leu

165 170 175

Val?Phe?Ala?Met?Ala?Asn?Met?Leu?Gly?Gln?Val?Ile?Leu?Ser?Arg?Arg

180 185 190

Val?Phe?Val?Thr?Lys?Gly?Val?Glu?Ser?Asn?Glu?Phe?Lys?Glu?Met?Val

195 200 205

Ile?Asp?Leu?Met?Thr?Ser?Ala?Gly?Leu?Phe?Asn?Val?Gly?Asp?Tyr?Ile

210 215 220

Pro?Ser?Ile?Ala?Trp?Met?Asp?Leu?Gln?Gly?Ile?Val?Arg?Gly?Met?Lys

225 230 235 240

Arg?Leu?His?Arg?Lys?Phe?Asp?Ala?Leu?Leu?Asp?Lys?Lys?Leu?Lys?Glu

245 250 255

His?Met?Ala?Thr?Arg?Asp?Glu?Arg?Lys?Glu?Lys?Pro?Asp?Leu?Leu?Asp

260 265 270

Val?Leu?Met?Asp?Asn?Arg?Asp?Asn?Lys?Ser?Glu?Gln?Glu?Arg?Leu?Thr

275 280 285

Asp?Thr?Asn?Ile?Lys?Ala?Leu?Leu?Leu?Asn?Leu?Phe?Ser?Ala?Gly?Thr

290 295 300

Asp?Thr?Ser?Ser?Ser?Thr?Ile?Glu?Trp?Ala?Leu?Thr?Glu?Met?Ile?Lys

305 310 315 320

Asn?Arg?Ser?Ile?Leu?Lys?Arg?Ala?His?Ala?Glu?Met?Asp?Gln?Val?Ile

325 330 335

Gly?Arg?Asn?Arg?Arg?Leu?Glu?Glu?Ser?Asp?Ile?Pro?Lys?Leu?Pro?Tyr

340 345 350

Leu?Gln?Ala?Ile?Cys?Lys?Glu?Thr?Phe?Arg?Lys?His?Pro?Ser?Thr?Pro

355 360 365

Leu?Asn?Leu?Pro?Arg?Val?Ala?Ile?Glu?Pro?Cys?Glu?Ile?Asp?Gly?Tyr

370 375 380

Tyr?Ile?Pro?Lys?Gly?Thr?Arg?Leu?Ser?Val?Asn?Ile?Trp?Ala?Ile?Gly

385 390 395 400

Arg?Asp?Pro?Asp?Val?Trp?Glu?Asn?Pro?Leu?Glu?Phe?Asn?Pro?Asp?Arg

405 410 415

Phe?Leu?Ile?Gly?Lys?Met?Ala?Lys?Ile?Asp?Pro?Arg?Gly?Asn?Asn?Phe

420 425 430

Glu?Leu?Ile?Pro?Phe?Gly?Ala?Gly?Arg?Arg?Ile?Cys?Ala?Gly?Thr?Arg

435 440 445

Met?Gly?Ile?Val?Leu?Val?Glu?Tyr?Ile?Leu?Gly?Thr?Leu?Val?His?Ala

450 455 460

Phe?Glu?Trp?Lys?Met?Pro?Asp?Gly?Glu?Thr?Leu?Asn?Met?Asp?Glu?Ala

465 470 475 480

Phe?Gly?Leu?Ala?Leu?Gln?Lys?Gly?Val?Pro?Leu?Ala?Ala?Val?Val?Thr

485 490 495

Pro?Arg?Leu?Pro?Pro?Ser?Ala?Tyr?Val?Val

500 505

<210> 3

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W1-FH-F

<222> (1)..(18)

<223>

<400> 3

gcaccaccaatcaccatg

<210> 4

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W1-FH-R

<222> (1)..(18)

<223>

<400> 4

Ttccacaacaattctccc

<210> 5

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W-FH-F

<222> (1)..(18)

<223>

<400> 5

c(a/t/c/g)ca(a/g)ga(t/c)atggt(t/c/g)tt(c/t)g

<210> 6

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W-FH-R

<222> (1)..(18)

<223>

<400> 6

c(a/t/g)at(a/t/c/g)gccca(a/t/g)at(a/g)tt(a/t/c/g)a

<210> 7

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 3 ' innner

<222> (1)..(20)

<223>

<400> 7

atcaggtcattggcaggaac

<210> 8

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 3 ' out

<222> (1)..(20)

<223>

<400> 8

aaggaacatatggcgacgag

<210> 9

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 5 ' innner

<222> (1)..(20)

<223>

<400> 9

cccagtcttcaatggcctta

<210> 10

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 5 ' out

<222> (1)..(20)

<223>

<400> 10

aactcgttcgactccacacc

<210> 11

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W2-FH-F

<222> (1)..(18)

<223>

<400> 11

tgagtatgcttcggttct

<210> 12

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W2-FH-R

<222> (1)..(18)

<223>

<400> 12

atgctggtgtttgctatg

<210> 13

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer A-18SR-F

<222> (1)..(18)

<223>

<400> 13

tgagaaacggctaccaca

<210> 14

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer A-18SR-R

<222> (1)..(18)

<223>

<400> 14

acgcaataggaccgaaat

SEQUENCE?LISTING

< 110>Flower Research Institute(FRI) of Yunnan

< 120>flavanone 3 ', 5 '-'-hydroxylase gene and coded protein thereof

< 130>specification sheets

<140> 00

<141> 2011-07-12

<160> 14

<170> PatentIn?version?3.1

<210> 1

<211> 1720

<212> DNA

< 213>Radix Aconiti (Aconitum carmichaeli Debx)

<220>

< 221>Ac-F3 ' 5 ' H gene cDNA full length sequence

<222> (1)..(1720)

<223>

<400> 1

gaaaatgcac?caccaatcac?catgttgtct?accagagaac?ttgtcgctgc?agcgatcatt 60

tttttcattg?cccgtctctt?cgtgcgtttc?ttgtgctcat?cgaaacaagc?acgcaagctt 120

cctcccggtc?cgaaaggatg?gccagtggtg?ggcgcattac?ccctgctggg?atccatgcct 180

catgttgccc?tggccaagat?gtccaggcaa?tacggcccca?ttgtgtacct?caaattaggt 240

tcgtgtggta?tggttgtcgc?ttcaaccccc?gattcggctc?gtacgttttt?gaaaacccta 300

gacctaaact?tctccaatcg?cccgaccgat?gcaggtgcaa?ctcatatcgc?gtataactca 360

caggacatgg?tgtttgcgga?ctatgggccg?aggtggaagt?tgttgcgtaa?actgactagc 420

ttgcatatgt?taggcagtaa?ggccattgaa?gactgggcta?gagtcaggcg?ggatgaggtg 480

gggtacatgg?ttaaagccat?gtacgagtct?agctgcgtgg?gggaggtggt?tgttgtgccg 540

gatatgctgg?tgtttgctat?ggcgaatatg?cttgggcagg?taatactgag?ccgccgtgtg 600

tttgttacga?aaggtgtgga?gtcgaatgag?tttaaggaga?tggtgatcga?cctaatgaca 660

tcagcggggt?tgtttaatgt?tggtgattat?attccttcga?ttgcatggat?ggatctgcag 720

ggtattgtgc?ggggaatgaa?acgtttgcac?aggaagttcg?atgcgctttt?ggacaaaaag 780

ttgaaggaac?atatggcgac?gagggatgag?aggaaggaga?agccggactt?actcgatgtt 840

ctgatggata?acagggacaa?taagtctgag?caggagaggc?ttactgacac?caacatcaag 900

gctcttctct?tgaacttatt?ctcagctgga?acagacacat?cctcgagcac?aatcgaatgg 960

gcactgacag?agatgataaa?gaaccgaagc?atactcaagc?gcgcacacgc?cgaaatggat 1020

caggtcattg?gcaggaaccg?caggcttgaa?gagtctgaca?taccgaaact?cccctactta 1080

caagcaatat?gcaaagaaac?attcaggaaa?cacccctcaa?cgccgcttaa?ccttccaaga 1140

gtggcgatcg?aaccgtgcga?aatagacgga?tactacatcc?ccaagggcac?aagactcagt 1200

gtgaacatat?gggcgatcgg?gcgagaccca?gacgtgtggg?agaatccgct?cgagttcaac 1260

cccgacagat?tcttaatagg?gaaaatggca?aaaatcgatc?cacggggaaa?taacttcgag 1320

ctgataccat?ttggggcagg?gaggaggata?tgtgcaggga?ctaggatggg?aattgttctt 1380

gttgagtaca?tattggggac?gcttgtgcat?gcatttgaat?ggaagatgcc?tgatggagag 1440

acgctaaaca?tggacgaagc?gtttggttta?gctctacaga?agggtgtgcc?gcttgctgct 1500

gttgttaccc?ctcgcctgcc?accctctgct?tatgtagtct?gaagagttgg?gagaattgtt 1560

gtggaacata?taatagtaat?gttgaagtac?tcttaccaga?aaactaacat?gtatagactt 1620

cgctgtatgc?acattgtgtc?tccgtgtgca?tggtttgtgg?tgttaaaact?tgaaagttac 1680

tggaaataaa?gcttgtgtca?tgtttgataa?aaaaaaaaaa 1720

<210> 2

<211> 506

<212> PRT

< 213>Radix Aconiti (Aconitum carmichaeli Debx)

<220>

< 221>ORF frame aminoacid sequence

<222> (1)..(506)

<223>

<400> 2

Met?Leu?Ser?Thr?Arg?Glu?Leu?Val?Ala?Ala?Ala?Ile?Ile?Phe?Phe?Ile

1 5 10 15

Ala?Arg?Leu?Phe?Val?Arg?Phe?Leu?Cys?Ser?Ser?Lys?Gln?Ala?Arg?Lys

20 25 30

Leu?Pro?Pro?Gly?Pro?Lys?Gly?Trp?Pro?Val?Val?Gly?Ala?Leu?Pro?Leu

35 40 45

Leu?Gly?Ser?Met?Pro?His?Val?Ala?Leu?Ala?Lys?Met?Ser?Arg?Gln?Tyr

50 55 60

Gly?Pro?Ile?Val?Tyr?Leu?Lys?Leu?Gly?Ser?Cys?Gly?Met?Val?Val?Ala

65 70 75 80

Ser?Thr?Pro?Asp?Ser?Ala?Arg?Thr?Phe?Leu?Lys?Thr?Leu?Asp?Leu?Asn

85 90 95

Phe?Ser?Asn?Arg?Pro?Thr?Asp?Ala?Gly?Ala?Thr?His?Ile?Ala?Tyr?Asn

100 105 110

Ser?Gln?Asp?Met?Val?Phe?Ala?Asp?Tyr?Gly?Pro?Arg?Trp?Lys?Leu?Leu

115 120 125

Arg?Lys?Leu?Thr?Ser?Leu?His?Met?Leu?Gly?Ser?Lys?Ala?Ile?Glu?Asp

130 135 140

Trp?Ala?Arg?Val?Arg?Arg?Asp?Glu?Val?Gly?Tyr?Met?Val?Lys?Ala?Met

145 150 155 160

Tyr?Glu?Ser?Ser?Cys?Val?Gly?Glu?Val?Val?Val?Val?Pro?Asp?Met?Leu

165 170 175

Val?Phe?Ala?Met?Ala?Asn?Met?Leu?Gly?Gln?Val?Ile?Leu?Ser?Arg?Arg

180 185 190

Val?Phe?Val?Thr?Lys?Gly?Val?Glu?Ser?Asn?Glu?Phe?Lys?Glu?Met?Val

195 200 205

Ile?Asp?Leu?Met?Thr?Ser?Ala?Gly?Leu?Phe?Asn?Val?Gly?Asp?Tyr?Ile

210 215 220

Pro?Ser?Ile?Ala?Trp?Met?Asp?Leu?Gln?Gly?Ile?Val?Arg?Gly?Met?Lys

225 230 235 240

Arg?Leu?His?Arg?Lys?Phe?Asp?Ala?Leu?Leu?Asp?Lys?Lys?Leu?Lys?Glu

245 250 255

His?Met?Ala?Thr?Arg?Asp?Glu?Arg?Lys?Glu?Lys?Pro?Asp?Leu?Leu?Asp

260 265 270

Val?Leu?Met?Asp?Asn?Arg?Asp?Asn?Lys?Ser?Glu?Gln?Glu?Arg?Leu?Thr

275 280 285

Asp?Thr?Asn?Ile?Lys?Ala?Leu?Leu?Leu?Asn?Leu?Phe?Ser?Ala?Gly?Thr

290 295 300

Asp?Thr?Ser?Ser?Ser?Thr?Ile?Glu?Trp?Ala?Leu?Thr?Glu?Met?Ile?Lys

305 310 315 320

Asn?Arg?Ser?Ile?Leu?Lys?Arg?Ala?His?Ala?Glu?Met?Asp?Gln?Val?Ile

325 330 335

Gly?Arg?Asn?Arg?Arg?Leu?Glu?Glu?Ser?Asp?Ile?Pro?Lys?Leu?Pro?Tyr

340 345 350

Leu?Gln?Ala?Ile?Cys?Lys?Glu?Thr?Phe?Arg?Lys?His?Pro?Ser?Thr?Pro

355 360 365

Leu?Asn?Leu?Pro?Arg?Val?Ala?Ile?Glu?Pro?Cys?Glu?Ile?Asp?Gly?Tyr

370 375 380

Tyr?Ile?Pro?Lys?Gly?Thr?Arg?Leu?Ser?Val?Asn?Ile?Trp?Ala?Ile?Gly

385 390 395 400

Arg?Asp?Pro?Asp?Val?Trp?Glu?Asn?Pro?Leu?Glu?Phe?Asn?Pro?Asp?Arg

405 410 415

Phe?Leu?Ile?Gly?Lys?Met?Ala?Lys?Ile?Asp?Pro?Arg?Gly?Asn?Asn?Phe

420 425 430

Glu?Leu?Ile?Pro?Phe?Gly?Ala?Gly?Arg?Arg?Ile?Cys?Ala?Gly?Thr?Arg

435 440 445

Met?Gly?Ile?Val?Leu?Val?Glu?Tyr?Ile?Leu?Gly?Thr?Leu?Val?His?Ala

450 455 460

Phe?Glu?Trp?Lys?Met?Pro?Asp?Gly?Glu?Thr?Leu?Asn?Met?Asp?Glu?Ala

465 470 475 480

Phe?Gly?Leu?Ala?Leu?Gln?Lys?Gly?Val?Pro?Leu?Ala?Ala?Val?Val?Thr

485 490 495

Pro?Arg?Leu?Pro?Pro?Ser?Ala?Tyr?Val?Val

500 505

<210> 3

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W1-FH-F

<222> (1)..(18)

<223>

<400> 3

gcaccaccaatcaccatg

<210> 4

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W1-FH-R

<222> (1)..(18)

<223>

<400> 4

ttccacaacaattctccc

<210> 5

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W-FH-F

<222> (1)..(18)

<223>

<400> 5

c(a/t/c/g)ca(a/g)ga(t/c)atggt(t/c/g)tt(c/t)g

<210> 6

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W-FH-R

<222> (1)..(18)

<223>

<400> 6

c(a/t/g)at(a/t/c/g)gccca(a/t/g)at(a/g)tt(a/t/c/g)a

<210> 7

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 3 ' innner

<222> (1)..(20)

<223>

<400> 7

atcaggtcattggcaggaac

<210> 8

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 3 ' out

<222> (1)..(20)

<223>

<400> 8

aaggaacatatggcgacgag

<210> 9

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 5 ' innner

<222> (1)..(20)

<223>

<400> 9

cccagtcttcaatggcctta

<210> 10

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>primer 5 ' out

<222> (1)..(20)

<223>

<400> 10

aactcgttcgactccacacc

<210> 11

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W2-FH-F

<222> (1)..(18)

<223>

<400> 11

tgagtatgcttcggttct

<210> 12

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer W2-FH-R

<222> (1)..(18)

<223>

<400> 12

atgctggtgtttgctatg

<210> 13

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer A-18SR-F

<222> (1)..(18)

<223>

<400> 13

tgagaaacggctaccaca

<210> 14

<211> 18

<212> DNA

< 213>synthetic

<220>

< 221>primer A-18SR-R

<222> (1)..(18)

<223>

<400> 14

acgcaataggaccgaaat

Claims

1. flavanone 3 ', 5 '-'-hydroxylase gene Ac-F3 ' 5 ' H ,Come from Radix Aconiti ( Aconitum carmichaeliDebx), called after Ac-F3 ' 5 ' H gene, Ac-F3 ' 5 ' nucleotides sequence of H gene classifies SEQ ID NO.1 as.

2. flavanone 3 ', 5 '-'-hydroxylase gene Ac-F3 ' 5 ' H encoded protein matter according to claim 1, called after Ac-F3 ' 5 ' H protein, Ac-F3 ' 5 ' the proteinic aminoacid sequence of H is SEQ ID NO.2.