CN102296106A - Primer and kit for detecting vibrio cholerae O139 group - Google Patents
Primer and kit for detecting vibrio cholerae O139 group Download PDFInfo
- Publication number
- CN102296106A CN102296106A CN2010102124655A CN201010212465A CN102296106A CN 102296106 A CN102296106 A CN 102296106A CN 2010102124655 A CN2010102124655 A CN 2010102124655A CN 201010212465 A CN201010212465 A CN 201010212465A CN 102296106 A CN102296106 A CN 102296106A
- Authority
- CN
- China
- Prior art keywords
- group
- primer
- vibrio cholerae
- pcr
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer and kit for detecting a vibrio cholerae O139 group. The primer consists of nucleotide sequences shown in SEQ ID NO:1-2, and the kit contains the primer. By using the primer and the kit provided by the invention, the vibrio cholerae O139 group can be rapidly, sensitively and conveniently detected through a simpler operation program, with the advantages of simpleness and convenience for operation, rapidness and low cost.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of primer and test kit that is used to detect vibrio cholerae O 139 group.
Background technology
Vibrio cholerae (Vibrio cholerae) belongs to Vibrio, it is the pathogenic bacteria of cholera, cholera is a kind of severe intestinal transmissible disease, it is a kind of food origin disease that the time of spreading is long, range of influence is wide, its typical clinical shows as that diarrhoea, vomiting and the body fluid that causes are thus lost, dewaters, whole body circulatory failure, electrolyte disturbance, hang down potassium syndromes, abdominal cramps even death, be defined as one of transmissible disease of necessary international quarantine by the World Health Organization, " People's Republic of China's law on the prevention and control of infectious diseases " classifies it as should implement " mandatory administration " category A infectious disease.
Cholera enterotoxin (Cholera enterotoxin CT) is the major cause that causes the cholera disease, the regulatory gene that produces enterotoxin genes be positioned at the cholera pathogenicity island (vibrio pathogenicity island, VPI).From cholera eruption and prevalence strain separated, major part has heat-stable thalline (O) antigen and heat labile flagellum (H) antigen.According to O antigen difference, nearly 200 O serotypes vibrio cholerae have been told at present.Before 1992, only two of the O1 group cholera vibrio biotypes (classical biotype and El Tor biotype) have caused seven cholera worlds and have been very popular.In October, 1992, taken place first to break out greatly in India and Bangladesh by the cholera that non-O1 group cholera vibrio causes, be accredited as by the O139 type and cause that its symptom is very similar to the cholera disease that O1 type cholera causes.The cholera that the O139 bacterial strain causes has become the geographic prevailing disease of Bangladesh, may also be the main cause that causes the 8th cholera eruption and prevalence.The O139 group cholera vibrio infects more serious than O1 group, shows as serious dehydration and high mortality, and adult's case proportion higher (accounting for 70%).
" People's Republic of China's law on the prevention and control of infectious diseases " that on February 21st, 1989 China announces, the transmissible disease of regulation management are divided into first, second, the third three classes, and cholera is one of transmissible disease of two kinds of Class As management.In 2002 the 25th of China national quality supervision and test quarantines general bureau and 26 commands clearly the regulation vibrio cholerae be essential items for inspection.The rapid and precise detection of vibrio cholerae helps its natural popular monitoring and prevention, and strick precaution has certain application value to the bio-terrorism active.
At present to the detection of this bacterium, normally on alkaline agar through selective enrichment, identify by a series of biochemical method the back, wastes time and energy, and generally takes 4-6 consuming time days at least.And vibrio cholerae is under some condition that is not suitable for growing, can form a kind of survival but can not cultivation conditions (viable but not culturable state, VBNCS), adopt traditional immunological method and biological method all can not comprehensively detect and identify vibrio cholerae.But utilize the method for detection of nucleic acids, even under the situation of not carrying out selective enrichment cultivation and purifying, also can detect evaluation.Therefore, have more advantage based on the detection method of nucleic acid than the method for traditional enrichment culture.
The Taqman fluorescence PCR method is a kind of of nucleic acid detection method, be in amplification reaction system, to add a specific fluorescent probe again in a pair of Auele Specific Primer of adding, use the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.It also has the following advantages: (1) high specificity: " double insurance " of primer and probe, avoid the false positive that detects.(2) highly sensitive: analyze the logarithmic phase of PCR product, self-reacting device is collected fluorescent signal, has avoided many interference from human factor.(3) avoid polluting: totally-enclosed reaction, need not the PCR aftertreatment, avoid polluting, guaranteed result's reliability.(4) realize quantitatively: the utilization standard substance obtain typical curve, carry out accurately quantitatively in conjunction with the Ct value.(5) efficient low-consume: can realize the many inspections of a pipe.(6) easy and simple to handle: online real-time monitoring amplification needn't contact objectionable impurities, operational safety.(7) quick: reaction times＜1.5 hour.Just because of fluorescent PCR has these advantages, be widely used in fields such as microorganism detection, disease surveillance and Clinical Laboratory at present, improved detection efficiency greatly, shortened sense cycle, reduced the detection cost, improved economic and social benefit.
Summary of the invention
The object of the present invention is to provide a kind of primer that is used to detect vibrio cholerae O 139 group, to detect vibrio cholerae O 139 group quickly and easily, this primer is made up of the nucleotide sequence shown in the SEQ ID NO:1-2.
Primer of the present invention can be used to prepare gene chip and/or the test kit that is used to detect vibrio cholerae O 139 group.Wherein said gene chip is preferably microarray chip.
The present invention also provides a kind of gene chip that is used to detect vibrio cholerae O 139 group, and it comprises above-mentioned primer.Wherein said gene chip is preferably microarray chip.
The present invention also provides a kind of test kit that is used to detect vibrio cholerae O 139 group, and it comprises above-mentioned primer.
Test kit of the present invention also comprises probe, and its nucleotide sequence is shown in SEQ ID NO:3.
Test kit of the present invention can also comprise standard substance, positive control, negative control, damping fluid (comprising buffer and dNTP) and archaeal dna polymerase.
The method of using test kit detection vibrio cholerae O 139 group of the present invention is as follows:
(1) DNA of bacteria in the extraction sample to be checked is as template;
(2) in the fluorescent PCR thin-walled tube, add the mixture of damping fluid, primer and probe respectively, add then over against according to, negative contrast or the masterplate DNA that from test sample, extracts, and use ddH
2O supplies certain volume, mixing;
(3) mixture with mixing in the PCR thin-walled tube increases on quantitative real time PCR Instrument;
(4) analysis of fluorescence quantitative result and carry out the result and judge.
But the test kit that a kind of industrialization that detects vibrio cholerae O 139 group of the present invention's preparation is produced, the combination of components that fluorescence PCR detecting method need be used together, during use, extract sample gene group to be checked, simultaneously through comparatively simple operation program just can carry out fast, the consumption and the concentration of each component is the test gained in sensitive, the easy detection, test kit, it is easy and simple to handle to detect vibrio cholerae O 139 group with this test kit, and fast, cost is low.
For above and other objects of the present invention, feature and advantage can be become apparent, preferred embodiment cited below particularly, and conjunction with figs. are described in detail below.
Description of drawings
Fig. 1 identifies the electrophorogram of the positive colony that contains the wbfQ gene for bacterium colony PCR;
Fig. 2 is each dilution amplification curve of vibrio cholerae O 139 group standard substance;
The typical curve that Fig. 3 works out for the vibrio cholerae O 139 group standard substance;
Fig. 4 is the amplification curve of vibrio cholerae O 139 group;
Fig. 5 is the amplification curve of vibrio cholerae He other vibrios of not somatotype.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the scope of the present invention that limits.In addition, should understand after having read the content that the present invention tells about, those skilled in the art can make various changes or modification to the present invention, and these equivalent form of values belong to the application's claims institute restricted portion equally.
Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.
The test method of unreceipted actual conditions in the following example is usually according to normal condition, as: " molecular cloning operational guidance " (third edition) (J. Sa nurse Brooker or the like work) or according to the condition of reagent manufacturers instruction.Used inorganic chemistry and organic solvent all meet the molecular biology test requirement.Primer and probe are synthetic by the precious biotech firm in Dalian, and pGEM-T Easy Vector and T4 ligase are all available from Promega, and the Taq archaeal dna polymerase is given birth to worker's biotechnology company available from Shanghai, and the fluorescent PCR instrument is 7300 of American AB I.
(the sequential reception number: Y07786) of the O antigen gene bunch sequence of the cholera vibrio O 139 of announcing according to GeneBank, analyze by functional analysis and protein water transport structure each gene of this O antigen sequence, selecting the wbfQ gene of cholera vibrio O 139 is target gene, design special primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Designed primer and probe all can detect all known vibrio cholerae O 139 group bacterium through the Blast retrieval, do not produce positive findings with other vibrio cholerae serotypes and other bacteriums.Optimum primer, probe sequence make up as follows:
(1) upstream primer of vibrio cholerae O 139 group, its sequence are VCO139_F:5-GCAGCAAAATTTGTTAGAGACATCT-3 (SEQ ID NO:1)
(2) downstream primer of vibrio cholerae O 139 group, its sequence are VCO139_R:5-TGTCTGCGCGTGTATATTGG-3 (SEQ ID NO:2)
(3) the TaqMan probe of vibrio cholerae O 139 group, its sequence are O139-P:5-ACCTAAATCCCACAATGAACTACCTTGGCT-3 (SEQ ID NO:3)
Nucleotide sequence (the SEQ ID NO:4 of the wbfQ gene of the following Y07786 vibrio cholerae O 139 group of announcing for GeneBank, beginning runic in the following sequence is 701bp to the sequence between the last runic) and the mark the design primer and the design district of probe sequence, wherein the underscore sign is real-time PCR upstream and downstream design of primers district, and italic is TaqMan probe design district.
ATGCTTTGGTTACCAGGCA
TCGCCGGGTGAATTTGGTAC
ATTTTTTGTTCTATGGTTTGGTCTTTATTTTGATAGAATAAACGTTTTTATTGATGAGGCATCAA
CTTACGCAATCATCAATTTTGCACTATCAGTTTTTTTGATTTCAGTTTCACGTCGTAAATTTGCA
ATATGTTTCTTTGCGTTTTCTTTTTTTGCAAGCATGGCAAAGGTTTTTGTTATTTTATTGCCATT
GTTTTTGTTTTTTAATCTATTGAATTTTAAATTCAATAGATTAATTAAGTTGTTTATTCTGTTTGT
TTTTGTTTTTATAATAAGCTATCCCTTCTTAATAAATATTTTGGTTGATTTGTTTTTTAATGGTCA
AATTATATTGGATTTAAGCGATTCTT
TGTCTGCGCGTGTATATTGGACATGGATGATT
AGATGTCTCTAACAAATTTTGCTGCTTTTGATGGCTATGTTT
CTAAATTGGCTTTTTTTATGGGTGGGTTGTTTTCTTTGTTATTTGTGAGGCAGAAAATATTCGCT
TTATCTTTGCTTTTTACACTTATAGCATCTTTTCAGTATGGCTCTGTCTTTTTTATGGGGTGGCTA
TATTATATTTTACTAGTAAGTTTTAATAATATTACACATTTAAATAGAGGT
TAG
The preparation and the demarcation of embodiment 2 vibrio cholerae O 139 group standard substance
(1) pcr amplification purpose band
The sequence amplification that will include real-time PCR primer and probe with PCR method come out (primer sequence is shown in SEQ ID NO:1-2), the PCR response procedures is as follows: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ were extended 1 minute, and carried out 30 circulations; Last 72 ℃ are continued to extend 5 minutes, obtain the PCR product, and the agarose gel electrophoresis with 0.8% detects the size and the specificity thereof of PCR product; Product length is about 701bp.The PCR product is cut glue and is reclaimed, and gives birth to the UNIQ-10 pillar DNA glue recovery test kit recovery purified pcr product of worker's biotechnology company with Shanghai.
(2) connect
With 3 * 10 of PCR purified product and Promega company
-3The pGEM-T-Easy carrier connect 24 hours in 4 ℃, cumulative volume is 10 μ l, and the 10 * damping fluid of 1 μ l and the T of 0.5U are wherein arranged
4Dna ligase obtains connecting product.
(3) electricity transforms
Preparation method with the electric transformed competence colibacillus cell of Bio-Rad company prepares the competence e.colidh5, the connection product of getting 2-3 μ l above-mentioned (2) is with after 60 μ l competence bacillus coli DH 5 alphas mix, forward in the electric shock cup of 0.2cm of Bio-Rad company and shock by electricity, voltage is 2.5kv, time is 5.0 milliseconds-6.0 milliseconds, the SOC substratum that adds 1mL after the electric shock immediately in cup makes the bacterium recovery, then bacterium is coated in 37 ℃ of incubated overnight on the LB solid medium that contains penbritin, X-Gal and IPTG, obtains blue white bacterium colony next day.
(4) bacterium colony PCR identifies
The promptly white clone of 4 white colonies of picking carries out bacterium colony PCR evaluation at random.The PCR reaction system is identical with conventional PCR in the same present embodiment of reaction conditions (1).After reaction finishes, get 3 μ l pcr amplification products and carry out the detection of 0.8% agarose gel electrophoresis.Detected result is seen (swimming lane M:DL2000 Marker, swimming lane 1-4 are respectively the white colony 1-4 of picking at random) shown in Figure 1, and 4 clones identify the purpose band that 701bp is arranged through PCR as a result, all is correct clone.
(5) plasmid extracts
Get and identify correct positive colony bacterium colony 1 (called after H1982) in above-mentioned (4), it is inoculated in incubated overnight in the LB liquid nutrient medium that contains the ammonia benzyl, adopts SDS alkaline lysis method of extracting plasmid in " molecular cloning experiment guide " (third edition) (work such as J. Sa nurse Brooker).This plasmid called after PLW1537.
(6) order-checking
With general SP6 and T7 primer the PLW1537 plasmid that extracts is checked order, the result shows that the entrained amplified fragments sequence of PLW1537 has the nucleotide sequence of above-mentioned 701bp, show that the wbfQ gene of the amplified fragments of the 701bp that PLW1537 is entrained and vibrio cholerae O 139 group sequence to be amplified is in full accord, the plasmid sequence of structure is entirely true.
(7) concentration determination of PLW1537
Get the stoste of 1 μ l PLW1537 and measure OD with NanoDrop OD instrument
260Value, the concentration of the PLW1537 stoste that the result records is 55.4ng/ μ l, 1 μ l PLW1537 stoste contains 1.5 * 10
10Individual copy.
10 times of gradient dilutions of PLW1537 stoste are obtained 1.5 * 10
7, 1.5 * 10
6, 1.5 * 10
5, 1.5 * 10
4, 1.5 * 10
3Individual copy real-time PCR detects, and 25 μ l reaction systems see the following form 1:
Table 1 Real-time PCR reaction system
Reaction tubes is put into real-time PCR instrument (ABI7300), and the parameter of setting is as follows:
95 ℃ 2 minutes
95 ℃ 15 seconds
Got back to second step, totally 40 circulations in 1 minute for 60 ℃.
Detect fluorescence in the time of 60 ℃, the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, answers reference reagent box working instructions.
Each dilution PLW1537 all can produce the fluorescence quotation marks as a result, and the Ct value is respectively 15.95,18.71,21.90,25.25,28.66, and amplification curve is seen Fig. 2, and quantitative data sees Table 2, and the slope of standard curve that is obtained by amplification curve is-3.385433, R
2Be that 0.999675 typical curve is seen Fig. 3 (Y=-3.385433X+43.040211).
The quantitative data of the different extent of dilution PLW1537 of table 2 quantitative fluorescent PCR
The detection of embodiment 4. vibrio cholerae samples
At first this breadboard 1 strain O139 group bacterial strain is carried out Real-time PCR and detect, outside the removing template, reaction system, condition and step are all with embodiment 3, amplification curve is seen Fig. 4, quantitative data sees Table 3, and its Ct value is 16.97, and amplification initial concentration copy number is 4010000.
The quantitative data of the real-time PCR of table 3 vibrio cholerae O 139 group and other vibrios
Then to the isolating cholera vibrio O 139 of Shanghai CDC detect strain 10 strains, laboratory not vibrio cholerae 9 strains of somatotype and other vibrios of 10 strains carry out real-time PCR and detect, with accuracy and the specificity of verifying this method, bacterial strain uses therefor sees Table 3; Method removing template outer (template and each bacterial type coupling), reaction system, condition and step are all with embodiment 3.Amplification curve is seen Fig. 5, and quantitative data sees Table 3.
Claims (8)
1. a primer that is used to detect vibrio cholerae O 139 group is characterized in that, is made up of the nucleotide sequence shown in the SEQ IDNO:1-2.
2. the described primer of claim 1 is used for detecting the application of the test kit and/or the gene chip of vibrio cholerae O 139 group in preparation.
3. application according to claim 2 is characterized in that described gene chip is a microarray chip.
4. a test kit that is used to detect vibrio cholerae O 139 group is characterized in that, comprises the described primer of claim 1.
5. test kit according to claim 4 is characterized in that, also comprises probe, and the nucleotide sequence of this probe is shown in SEQ ID NO:3.
6. according to claim 4 or 5 described test kits, it is characterized in that, also comprise standard substance, positive control, negative control, damping fluid and archaeal dna polymerase.
7. a gene chip that is used to detect vibrio cholerae O 139 group is characterized in that, comprises the described primer of claim 1.
8. gene chip according to claim 7 is characterized in that, described gene chip is a microarray chip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102124655A CN102296106A (en) | 2010-06-28 | 2010-06-28 | Primer and kit for detecting vibrio cholerae O139 group |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102124655A CN102296106A (en) | 2010-06-28 | 2010-06-28 | Primer and kit for detecting vibrio cholerae O139 group |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102296106A true CN102296106A (en) | 2011-12-28 |
Family
ID=45356781
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102124655A Pending CN102296106A (en) | 2010-06-28 | 2010-06-28 | Primer and kit for detecting vibrio cholerae O139 group |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102296106A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2808577C1 (en) * | 2023-03-22 | 2023-11-29 | Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | METHOD FOR DETECTING VIABLE VIBRIO CHOLERAE 01 SEROGROUP OF BIOVARS CLASSICAL AND El Tor IN THE ENVIRONMENT USING BACTERIOPHAGE M3 USING QUANTITATIVE PCR METHOD |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1834260A (en) * | 2005-12-15 | 2006-09-20 | 深圳太太基因工程有限公司 | Primer and probe sequence for detecting nucleotide fragment of 0139 group choleraic vibrio |
| CN101418339A (en) * | 2008-11-24 | 2009-04-29 | 浙江省疾病预防控制中心 | Fluorescent detection kit of cholera vibrio O139 and detection method |
-
2010
- 2010-06-28 CN CN2010102124655A patent/CN102296106A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1834260A (en) * | 2005-12-15 | 2006-09-20 | 深圳太太基因工程有限公司 | Primer and probe sequence for detecting nucleotide fragment of 0139 group choleraic vibrio |
| CN101418339A (en) * | 2008-11-24 | 2009-04-29 | 浙江省疾病预防控制中心 | Fluorescent detection kit of cholera vibrio O139 and detection method |
Non-Patent Citations (1)
| Title |
|---|
| 覃倚莹等: "Taq-Man实时荧光定量PCR同时检测O1和O139群霍乱弧菌", 《卫生研究》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2808577C1 (en) * | 2023-03-22 | 2023-11-29 | Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | METHOD FOR DETECTING VIABLE VIBRIO CHOLERAE 01 SEROGROUP OF BIOVARS CLASSICAL AND El Tor IN THE ENVIRONMENT USING BACTERIOPHAGE M3 USING QUANTITATIVE PCR METHOD |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN111074000B (en) | Triple fluorescence quantitative PCR detection material and kit for distinguishing ASFV wild strain from double gene deletion strain | |
| CN103468811B (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN106967816A (en) | Detect the RPA specific primers of vibrio parahaemolytious and kit and application in food | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN109735638B (en) | Multiple PCR detection primers, kit, method and application for identifying Listeria monocytogenes ST121 with persistency | |
| CN109680079A (en) | Detect RPA primer, probe, kit and the method for vibrio parahemolyticus | |
| CN110923343A (en) | Isothermal amplification primer group and kit for rapidly detecting salmonella pullorum | |
| CN102925548B (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| CN106498054A (en) | The GeXP analysis methods of vibrio cholera and vibrio parahaemolyticus in a kind of synchronous detecting food | |
| CN104694620A (en) | LAMP (loop-mediated isothermal amplification) and primer set adopted molecular detection method of a variety of microorganisms | |
| Guenther et al. | Detection of Trichinella spiralis, T. britovi and T. pseudospiralis in muscle tissue with real-time PCR | |
| CN101974644A (en) | Staphylococcus aureus enterotoxin gene PCR (Polymerase Chain Reaction) parting detection kit and method | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN111057775B (en) | Specific novel molecular target for identifying salmonella and rapid detection method thereof | |
| CN108004334B (en) | Quadruple fluorescent PCR primer group, probe group, kit and method for detecting four pathogenic bacteria in drinking water | |
| CN102676653A (en) | Non-diagnostic method for detection of O1 group and O139 group of vibrio cholerae through double TaqMan probe fluorescence RT-PCR (Reverse Transcription-Polymerase Chain Reaction) | |
| CN105603091A (en) | Vibrio cholerae multiplex fluorescence PCR detection kit as well as preparation and application thereof | |
| CN102533967B (en) | Reagent kit and method for detecting multiple real-time fluorescent quantitative polymerase chain reaction (PCR) of vibrio cholerae toxin genes | |
| CN102296107A (en) | Primers and kit for detecting vibrio cholerae Serogroup O1 | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection | |
| CN107299154A (en) | A kind of sheep Theileria luwenshuni and Anaplasma phagocytophilum double PCR primer special and dual PCR detection method | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN100395350C (en) | Prime and probe sequence for detecting nucleotide fregment of comma bacillus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111228 |