CN102286502A - Method for preparing recombinant carboxypeptidase B - Google Patents
Method for preparing recombinant carboxypeptidase B Download PDFInfo
- Publication number
- CN102286502A CN102286502A CN2011102131850A CN201110213185A CN102286502A CN 102286502 A CN102286502 A CN 102286502A CN 2011102131850 A CN2011102131850 A CN 2011102131850A CN 201110213185 A CN201110213185 A CN 201110213185A CN 102286502 A CN102286502 A CN 102286502A
- Authority
- CN
- China
- Prior art keywords
- cpb
- preparation
- proenzyme
- mentioned
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a method for preparing recombinant carboxypeptidase B (CPB) in pichia pastoris. When the method is used, the expression is high, the expressed product, namely CPB precursor, is not required to be denatured and renatured, active CPB can be obtained directly after propeptide is removed by enzyme digestion, and the subsequent purification step is simple and convenient. The prepared recombinant carboxypeptidase B can be used in the industrial production of recombinant human insulin.
Description
Technical field
The present invention relates to a kind of preparation method of protaminase, specifically, relate to a kind of method that in yeast, prepares recombinant carboxyl B.
Background technology
(carboxy peptidase B is called for short CPB to protaminase, EC3.4.17.2) is a kind of zinciferous pancreas exopeptidase, the basic aminoacids of its energy specificity hydrolysis peptide chain C-terminal, for example arginine, Methionin or ornithine.Protaminase contains 307 amino-acid residues, and molecular weight is 35KDa.
CPB is widely used in protein and peptide class C-terminal amino acid sequencing at present, or is used for the modification of the C-terminal alkaline amino acid residue of protein or polypeptide.Medically also be used to diagnose pancreatitis.In the genetically engineered field, CPB has also obtained application more and more widely, and special CPB is one of indispensable two enzymes in recombinant human insulin's production process, and the height of its specific activity and stability are important parameters that influences proinsulin activation yield.
The method of the active CPB of preparation mainly contains two classes at present: a class is to extract from the pancreas of animal and activate to obtain CPB, but this method can not be removed other proteolytic enzyme at present fully, and may make among the prepared CPB and contain infected material, have the biologically active components of infringement HUMAN HEALTH potential as virus, Protein virus or other, therefore use limited; Another kind of is that the method by gene recombination prepares CPB in intestinal bacteria, this method obtains the not active CPB proenzyme of tool through expression earlier, make CPB proenzyme inclusion body through complicated sex change, renaturation process then, remove the preceding peptide moiety of proenzyme again through enzyme earnestly, just can obtain activated enzyme, and in described sex change, renaturation process, renaturation yield can not reach 100%, therefore this method wastes time and energy, and productive rate is not high, and the output of general every liter of fermented liquid is not higher than 10mg.
In Chinese patent 200410098027.5, disclose a kind of in the yeast eukaryotic expression system recombinant expressed CPB proenzyme, then through purifying, enzyme are cut, concentrated, step such as repurity prepares CPB method.Because the preceding peptide moiety of CPB proenzyme is at the N of CPB end, this method is added histidine-tagged (His tag) by the N-terminal at the CPB proenzyme, form " histidine-tagged-propetide-CPB ", carrying out enzyme then in the affinity chromatography process cuts, thereby realize that CPB separates with propetide, avoided propetide to be incorporated on the CPB in non-covalent mode.But this method processing step is very complicated: be that this method will be carried out purifying earlier after recombinant expressed on the one hand, carry out enzyme again and cut, also will carry out secondarily purified after enzyme is cut; Be to use this method to carry out enzyme when cutting on the other hand, CPB flows out with penetrating liquid (Flow Through), and the liquid volume of collecting is very big, just can carry out follow-up secondarily purified after needing to concentrate.
Therefore, need a kind of new method for preparing active CPB now badly, can either recombinant expressed high-levelly CPB, can carry out subsequent treatment process (purifying, concentrated, ultrafiltration etc.) again very simply and easily.
Summary of the invention
The objective of the invention is to solve existing the problems referred to above, a kind of method for preparing protaminase (CPB) is provided, this method expression amount is very high, and expression product CPB proenzyme need not through sex change and renaturation, after direct enzyme cutting is removed propetide, can obtain activated CPB, and follow-up purification step is also simple and convenient.
Therefore, in order to realize purpose of the present invention, the invention provides the preparation method of a kind of protaminase (CPB), this method comprises:
1. one section nucleotide sequence is provided, described nucleotide sequence is made up of the gene order of coding CPB proenzyme and the codon of encoding histidine label (His tag), and the codon of described encoding histidine label is at 3 ' end of the gene order of described coding CPB proenzyme;
2. above-mentioned nucleotide sequence is cloned in the Yeast expression carrier;
3. above-mentioned carrier is converted into yeast host;
4. induce above-mentioned yeast host to express the C end and have histidine-tagged CPB proenzyme;
5. enzyme is cut above-mentioned CPB proenzyme, generates the C end and has histidine-tagged CPB;
6. the above-mentioned CPB of purifying.
Preferably, the gene order of the described coding CPB proenzyme in the step 1 can be determined according to used yeast host's codon preference, to increase host's expression efficiency.This method is a technology known in those skilled in the art, and the method for concrete definite gene order can be referring to for example " University of the Inner Mongol's journal ", " big occasion yeast codon uses contrast ", 2006, Vol37, No1:34-39.
At the terminal codon that adds the encoding histidine label of gene order, also be the technology that is used for protein purification known in those skilled in the art, preferably, described histidine-tagged be a kind of aminoacid sequence that contains 6 successive Histidines.
Described Yeast expression carrier in the step 2 can for any one can with the carrier of yeast chromosomal generation homologous recombination, preferably, described Yeast expression carrier is the carrier that is adopted in the invitrogen company " pichia spp operational manual ", for example pPIC9K, pPIC3.5K, pAO815, pPICZaA, pPICZaB, pPICZaC etc.
Described yeast host in the step 3 can directly be expressed the correct target protein of conformation as a kind of eukaryotic expression system, need not follow-up sex change and renaturation process (referring to for example " biotechnology circular ", " methanol yeast system ", 2000,1:38-41).Therefore without any restriction, preferred yeast strain can be debaryomyces hansenii, pichia spp, candiyeast, torulopsis glabrata etc. to method of the present invention to the kind of yeast host, and preferred yeast strain is a pichia spp.
The method of inducing the yeast host expressing protein in the step 4 also is a technology known in the field, for example referring to " biotechnology circular ", " influencing the factor of exogenous protein expression in the methanol yeast ", 2000,4:34-38.Preferably, in the abduction delivering process, use methyl alcohol as sole carbon source and inductor, and make the final concentration of methyl alcohol reach 0.7%, can in the expression amount that increases bacterial strain, bacterial strain not produced any toxic action.In addition, the interpolation final concentration is 0.5% casein hydrolysate in substratum, also helps proteic expression.
Purifying in the step 6 has histidine-tagged proteinic technology and method is known in those skilled in the art, and concrete grammar can be referring to " Qiagen:Protein expression and purification Protocol ".Purification process of the present invention preferably adopts Ni
2+-NTA (Ni
2+-nitrilotriacetic acid(NTA)) matrix is carried out, and is that the imidazoles solution of 20mM to 250mM comes the wash-out target protein by gradient.
Described enzyme in the step 5 cut with step 6 in described purge process can carry out in proper order, also can be simultaneously at Ni
2+Carry out in-NTA the matrix.
The method that the present invention prepares protaminase (CPB) has the following advantages:
1. carry out recombinant expressedly in the yeast eukaryotic expression system, expression product CPB proenzyme need not can obtain activated CPB through sex change and renaturation after direct enzyme cutting is removed propetide.
2. increase the codon of histidine-tagged (His tag) at 3 ' end of CPB prochymosin gene sequence, express generation C end and have histidine-tagged CPB proenzyme, make follow-up enzyme cut with the affinity purification process in, purified product (CPB) is retained in the elutriant, the purified product volume is little, does not need follow-up enrichment step.
3. only need a purification step can obtain pure product.
4. as according to yeast preference codon provide coding CPB the gene order of proenzyme, can also further improve expression amount.
5. as in the abduction delivering process, making the final concentration of methyl alcohol reach 0.7%, also can further increase the expression amount of bacterial strain.
Description of drawings
The SDS-PAGE electrophoresis detection figure of Fig. 1: recombinant C PB.
Embodiment
Material:
Bacterial strain and plasmid: clone bacterial classification Escherichia coli (DH5a) is a genetically engineered common tool bacterial classification; Pichia pastoris phaff (Pichia pastoris) GS115, plasmid pPIC9K purchase the company in invitrogen.
Enzyme and reagent:
Relate to the used enzyme of molecular biology operation among the embodiment and all purchase in Beijing through company of HTC of section, respective phases of operation is carried out according to relevant product description fully.
PCR purification kit, sepharose reclaim the test kit of using among the embodiment such as test kit, plasmid extraction test kit, PCR product purification test kit (Quan Shijin), cerevisiae dna extraction test kit and all purchase in sky, Beijing root company (TianGen), and respective phases of operation is carried out according to relevant product description fully.
The examining order synthetic and DNA synthetic, primer of related nucleotide sequence is finished by Beijing Nuo Sai genome company among the embodiment.
Hippuryl-L-arginine is purchased the company in sigma.
Substratum:
LB substratum, ammonia benzyl resistance LB substratum, YPD substratum, MD solid medium, MD liquid nutrient medium, YPD G-418 solid medium, BMGY substratum, BMMY substratum are genetically engineered field substratum commonly used, and the prescription of each substratum can be referring to the 64th page the-the 70th page of the pichia spp operational manual (Multi-Copy Pichia Expression Kit) of molecular cloning third edition volume two appendix 2 and invitrogen company.
Method:
Polymerase chain reaction, the PCR product purification, the enzyme of gene and plasmid is cut, reclaims, is connected and transforms, and the screening of intestinal bacteria transformant, identify these genetically engineered routine operation methods, can be referring to Sambrook J, Fristsh EF, Maniatis T.MolecularCloning; A Laboiatory Manual 2nd ed.NY:Cold Spring Harbor Laboratory Piess, 1989, pp.16-340.The linearizing of recombinant yeast expression vector plasmid, yeast conversion, the screening of transformant, abduction delivering and express and identify can be referring to the 32nd page the-the 63rd page of the pichia spp operational manuals (Multi-Copy Pichia Expression Kit) of invitrogen company.
The structure of embodiment 1 recombinant C PB zymogen expression carrier
1. provide coding CPB proenzyme-histidine-tagged nucleotide sequence: according to the gene order of pichia spp codon preference chemical synthesis coding CPB proenzyme, and at 3 ' the terminal codon that increases by 6 Histidines of coding of this gene order, final nucleotides sequence is classified the nucleotide sequence shown in the SEQ ID NO:1 as.
With above-mentioned synthetic nucleotide sequence as template, with the design two primers be the upstream and downstream primer, carry out pcr amplification, wherein,
Primer sequence is:
Upstream primer:
GGCGAATTCCATCACCACCATCATCACACTACTGGTCATTCTTACGAGAA
Downstream primer:
ATATAGCGGCCGCTTACAATGACCCAAAACGTAGTTA
The PCR system is:
Template (5ng/ul) 0.5ul,
Upstream primer Y-pro-cpb-F (10uM) 0.5uL,
Downstream primer Y-cpb-3HisR (10uM) 0.5uL,
dNTPs(10mM) 2.5uL，
5 times of pfu damping fluid 5uL,
Archaeal dna polymerase pfu (1U/uL) 0.5uL,
Sterilized water 15.5uL,
Cumulative volume: 25uL.
Amplification condition is:
95℃2min；
95 ℃ of 20sec, 55 ℃ of 20sec, 35 circulations of 72 ℃ of 40s;
72℃10min。
3. above-mentioned PCR product is carried out purifying with the PCR purification kit.
4. use restriction enzyme EcoRI and NotI that above-mentioned PCR purified product is carried out double digestion, and reclaim test kit with sepharose and cut the glue recovery.
5. use restriction enzyme EcoRI and NotI that plasmid pPIC9K is carried out double digestion, and reclaim test kit with sepharose and cut the glue recovery.
6. use the fragment of recovery in T4 ligase enzyme Connection Step (4) and the step (5), the enzyme of the nucleotide sequence of the CPB proenzyme of wherein encoding-histidine-tagged is cut product and plasmid pPIC9K enzyme, and to cut the concentration ratio of product be 1: 2-3.
7. above-mentioned connection product is imported among the Escherichia coli (DH5a) by the method that electricity transforms, and coat the LB substratum, 200rpm in shaking table cultivated 1 hour, and got bacterium liquid then and be laid on the ammonia benzyl resistance LB substratum 37 ℃ of overnight incubation for 37 ℃.
8. select 10 transformants that grow, insert in the ammonia benzyl resistance LB substratum overnight incubation respectively.From these 10 overnight culture, extracted plasmid again in second day with the plasmid extraction test kit.10 plasmids that extract are delivered to Beijing Nuo Sai genome company carry out sequencing,, select the CPB proenzyme-histidine-tagged plasmid that is loaded with correct gene to identify positive colony.
9. cut the plasmid of selecting in the step (8) with SacI and SalI enzyme respectively, make plasmid linearization, use PCR product purification test kit (Quan Shijin) plasmid purification then, obtain recombinant C PB zymogen expression carrier.
The structure of embodiment 2 recombinant C PB proenzyme Yeast engineering bacterias
According to the pichia spp operational manual of invitrogen company, the recombinant C PB zymogen expression carrier electricity after the above-mentioned linearizing is converted in the GS115 pichia spp competent cell.GS115 pichia spp after will transforming is then coated on the MD solid medium, hatches 3-4 days for 29 ℃.
Picking transformant from the above-mentioned MD solid medium is transferred to 0.25mg/ml YPD G-418 successively, 0.75mg/ml YPD G-418, and on the 3mg/ml YPD G-418 solid medium, 29 ℃ of cultivations are to screen the transformant of high copy.After treating that high copy transformant is grown, picking list colony inoculation is in 5ml MD liquid nutrient medium, and 29 ℃, 200rpm cultivates, and makes the expression engineering bacteria GS115-proCPB-3his of a large amount of recombinant C PB proenzymes.
The abduction delivering of embodiment 3 recombinant C PB zymogen expression engineering bacterias
Above-mentioned engineering bacteria is inoculated in the 10ml YPD liquid nutrient medium according to 2% inoculum size, and 28 ℃, 200rpm cultivates, treat that bacteria growing gets up after, it is inoculated in the 1L BMGY liquid nutrient medium according to 1% inoculum size, 28 ℃, 200rpm cultivates, and treats OD
600nmBe at about 8 o'clock, centrifugal, abandon supernatant, with the resuspended thalline of 1L BMMY liquid nutrient medium, being loaded on 2L shakes in the bottle, every 500ml bacterium liquid is adorned one bottle, and bottleneck seals with gauze, 28 ℃, 200rpm, add methyl alcohol to 0.7% (V/V) and cultivate, and replenished methyl alcohol to 0.7% (V/V) once more in per 24 hours, induced until the 6th day to finish.Recombinant C PB proenzyme by secreting, expressing to liquid nutrient medium.
The enzyme of embodiment 4 recombinant C PB zymogen expression products is cut
Engineering bacteria substratum behind the abduction delivering is centrifugal, with supernatant liquor 0.45um membrane filtration,, add trypsinase then with the ratio of filtrate according to 100: 1 (mass concentration ratio), enzyme is cut 2.5h-3h under the room temperature, obtains recombinant C PB.
Purifying and the evaluation of embodiment 5 recombinant C PB
Above-mentioned enzyme is cut product carry out purifying with NTA-Ni prepacked column (purchasing) in Central Plains, Beijing company, at first use the 20mM imidazoles to carry out wash-out to remove propetide and foreign protein, 250mM imidazoles wash-out target protein (CPB) is collected component peaks then, obtains containing the CPB solution of imidazoles.
The above-mentioned CPB solution that contains imidazoles is removed imidazoles with desalting column (purchasing in Central Plains, Beijing company), elutriant is for containing 24.75mM Tris and 100mM NaCl, pH is 7.65 solution, collect component peaks, obtain pure product recombinant C PB solution, lyophilize, final every liter of fermented liquid can obtain about 40mg recombinant C PB.
Use the purity of SDS-PAGE electrophoresis detection recombinant C PB, the results are shown in Figure 1, visible gained recombinant C PB purity is very high; Through amino acid sequence analysis, resulting structures is consistent with expection with gained recombinant C PB for other.
The enzyme assay of embodiment 6 recombinant C PB
Material:
Recombinant C PB solution comprises: the recombinant C PB that 4mg/ml prepares according to embodiment 1-5 step, and 24.75mM Tris, 100mM NaCl, and adjusting pH value is 7.65.
Substrate solution comprises: 0.3354mg/ml hippuryl-L-arginine, and 24.75mM Tris, 100mMNaCl, and adjusting pH value is 7.65.
Instrument: 754 type ultraviolet-visible pectrophotometers.
Detection method:
Spectrophotometric detection wavelength is decided to be 254nm, make blank with above-mentioned substrate solution, the 2.9ml substrate solution is placed cuvette, 50 times of diluents that add the above-mentioned recombinant C PB solution of 0.1ml again, stir evenly, put into spectrophotometer immediately and detect, every absorption value (A of 30 seconds records
254), write down altogether 5 minutes.Calculate the activity of CPB then according to following formula:
Enzymic activity (U/mg)=(3 * recombinant C PB solution dilution multiple * Δ A
254/ minute)/(0.0349 * recombinant C PB original liquid concentration)
Above-mentioned detection is parallel to be carried out 3 times.
Detected result:
The result of 3 detections of recombinant C PB enzymic activity is respectively: 63.1U/mg, 67U/mg, 66U/mg; Average recombinant C PB enzymic activity is 65.37 ± 2.03U/mg.
The detection of the enzyme activity stability of embodiment 7 recombinant C PB
Will according to the recombinant C PB of embodiment 1-5 step preparation in 4 ℃ be stored in damping fluid (0.25M Tris, 0.1M NaCl, pH=7.65) in, after the 0th day, 30 days, 50 days, 60 days, press respectively
The method of embodiment 6 detects the CPB vigor, and the result is respectively:
The enzyme activity of recombinant C PB was 68U/mg at the 0th day;
The enzyme activity of recombinant C PB was 67U/mg at the 30th day;
The enzyme activity of recombinant C PB was 66.5U/mg at the 50th day;
The enzyme activity of recombinant C PB was 65U/mg at the 60th day;
The enzyme activity of the recombinant C PB enzyme of above presentation of results the present invention preparation can keep stable in 60 days.
Claims (10)
1. the preparation method of a protaminase (CPB) may further comprise the steps:
(1). one section nucleotide sequence is provided, described nucleotide sequence is made up of the gene order of coding CPB proenzyme and the codon of encoding histidine label (His tag), and the codon of described encoding histidine label is at 3 ' end of the gene order of described coding CPB proenzyme;
(2). above-mentioned nucleotide sequence is cloned in the Yeast expression carrier;
(3). above-mentioned carrier is converted into yeast host;
(4). induce above-mentioned yeast host to express the C end and have histidine-tagged CPB proenzyme;
(5). enzyme is cut above-mentioned CPB proenzyme, generates the C end and has histidine-tagged CPB;
(6). the above-mentioned CPB of purifying.
2. preparation method according to claim 1, wherein the gene order of the CPB of coding described in the step 1 proenzyme is to determine according to the codon preference of used yeast host in the step 3.
3. preparation method according to claim 1, wherein histidine-tagged described in the step 1 is the aminoacid sequence that contains 6 successive Histidines.
4. preparation method according to claim 1, wherein nucleotides sequence described in the step 1 is classified the nucleotide sequence shown in the SEQ ID NO:1 as.
5. preparation method according to claim 1, wherein Yeast expression carrier described in the step 2 is selected from pPIC9K, pPIC3.5K or pAO815.
6. preparation method according to claim 1, wherein yeast host described in the step 3 is selected from debaryomyces hansenii, pichia spp, candiyeast or torulopsis glabrata.
7. preparation method according to claim 1, wherein abduction delivering described in the step 4 uses methyl alcohol as sole carbon source and inductor, and makes the final concentration of methyl alcohol reach 0.7%.
8. preparation method according to claim 1, wherein purifying described in the step 6 adopts Ni
2+-NTA matrix is carried out, and adopts imidazoles solution to carry out wash-out.
9. preparation method according to claim 1, wherein step 5 and step 6 order is carried out.
10. preparation method according to claim 1, wherein step 5 and step 6 are simultaneously at Ni
2+Carry out in-NTA the matrix.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102131850A CN102286502A (en) | 2011-07-28 | 2011-07-28 | Method for preparing recombinant carboxypeptidase B |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102131850A CN102286502A (en) | 2011-07-28 | 2011-07-28 | Method for preparing recombinant carboxypeptidase B |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102286502A true CN102286502A (en) | 2011-12-21 |
Family
ID=45333259
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011102131850A Pending CN102286502A (en) | 2011-07-28 | 2011-07-28 | Method for preparing recombinant carboxypeptidase B |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102286502A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109666664A (en) * | 2019-01-15 | 2019-04-23 | 中国农业大学 | A kind of preparation method and applications of the Carboxypeptidase A with degradation ochratoxin A function |
| CN117363641A (en) * | 2023-10-11 | 2024-01-09 | 广东省卓肽医药有限公司 | Fusion expression method of recombinant double-basic endopeptidase and carboxypeptidase B |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1624122A (en) * | 2003-12-05 | 2005-06-08 | 霍夫曼—拉罗奇有限公司 | Recombinantly expressed carboxypeptidase b and purification thereof |
| CN101063145A (en) * | 2007-04-20 | 2007-10-31 | 厦门大学 | Expression carrier for black porgy antibiotic peptide Hepcidin and expression product and constructing preparation method |
-
2011
- 2011-07-28 CN CN2011102131850A patent/CN102286502A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1624122A (en) * | 2003-12-05 | 2005-06-08 | 霍夫曼—拉罗奇有限公司 | Recombinantly expressed carboxypeptidase b and purification thereof |
| CN101063145A (en) * | 2007-04-20 | 2007-10-31 | 厦门大学 | Expression carrier for black porgy antibiotic peptide Hepcidin and expression product and constructing preparation method |
Non-Patent Citations (7)
| Title |
|---|
| 《Genbank》 20101105 Fernandez.D等 CarboxypeptidaseB precursor(sus scrofa) 登录号：NP_999334 , * |
| BAO LIGE等: "Cationic peanut peroxidase:expression and characterization in transgenic tobacco and purication of the histidine-tagged protein", 《PLANT SCIENCE》 * |
| DAVID S.WAUGH等: "Making the most of affinity tags", 《TRENDS IN BIOTECHNOLOGY》 * |
| FERNANDEZ.D等: "CarboxypeptidaseB precursor(sus scrofa) 登录号：NP_999334", 《GENBANK》 * |
| JOSE ARNAU等: "Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins", 《PROTEIN EXPRESSION & PURIFICATON》 * |
| LAVAZEC等: "cpbAg1 encodes an active carboxypeptidase B expressed in the midgut of anopheles gambiae", 《INSECT MOLECULAR BIOLGOY》 * |
| 王德解 等: "鼠羧肽酶原B在毕赤酵母中的表达、纯化与鉴定", 《生物工程学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109666664A (en) * | 2019-01-15 | 2019-04-23 | 中国农业大学 | A kind of preparation method and applications of the Carboxypeptidase A with degradation ochratoxin A function |
| CN117363641A (en) * | 2023-10-11 | 2024-01-09 | 广东省卓肽医药有限公司 | Fusion expression method of recombinant double-basic endopeptidase and carboxypeptidase B |
| CN117363641B (en) * | 2023-10-11 | 2024-06-25 | 广东省卓肽医药有限公司 | Fusion expression method of recombinant double-basic endopeptidase and carboxypeptidase B |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105358694B (en) | Yeast promoter from pichia pastoris yeast | |
| CN102839165A (en) | Gene mutation type recombined protease K and industrialized production method thereof | |
| CN102277338A (en) | Diketoreductase mutant and application thereof | |
| CN104726478A (en) | Recombinant Escherichia coli for expressing arginine deiminase gene and application of recombinant Escherichia coli | |
| CN106939315B (en) | Preparation method and application of oxalate decarboxylase | |
| CN104404064A (en) | Tyrosinase coding gene melC derived from streptomyces kathirae SC-1 and proteins of tyrosinase coding genes melC | |
| CN107384899A (en) | The acid protease g412 and its gene of a kind of originated from fungus and application | |
| CN112980815B (en) | alpha-L-fucosidase OUCJdch-16 and application thereof | |
| CN103966191B (en) | The tryptic preparation method of a kind of recombinant bovine source property | |
| CN113801239B (en) | Polypeptide tag, highly soluble recombinant nitrilase and application thereof in synthesis of medicinal chemicals | |
| CN102286502A (en) | Method for preparing recombinant carboxypeptidase B | |
| CN102899339B (en) | Alkalescence xylanase xynHBs nucleotide optimization sequence and high-efficiency expression method | |
| CN102628058B (en) | Preparation of recombinant human nerve growth factor ( rhNGF ) protein and renaturation solution | |
| CN109182286B (en) | Improved cyano reductase and application thereof in synthesis of 3-chloropyrazine-2 methylamine | |
| CN113736766B (en) | Collagen hydrolase and its coding gene, preparation method and use | |
| CN101948837A (en) | Method for producing human insulin growth factor-1 in recombinant Escherichia coli | |
| CN107746432A (en) | A kind of modified proteins of A β 42 and its expression and purification method | |
| CN102660568B (en) | A method for preparing recombinant thymulin alpha 1 | |
| RU2453604C1 (en) | Hybrid protein (versions), bacterial strain escherichia coli - hybrid protein producer (versions) and method for producing methionine-free human interferon alpha-2 | |
| CN106755016B (en) | A kind of Karl Jaspers carboxypeptidase y gene and its application | |
| CN100339475C (en) | Colibacillns strain for recombination producing lectin of snowdrop and method thereof | |
| CN116731126B (en) | Intein ChiATP, intein ChiATP-dipeptide-2 fusion protein and dipeptide-2 expression method | |
| CN103409444B (en) | CDNA (Complementary Deoxyribose Nucleic Acid) nucleotide of monascus ruber GAD (Glutamic Acid Decarboxylase) gene and synthetic method thereof and corresponding protein | |
| CN1869236A (en) | Production method of recombination ox intestine kinase | |
| CN111434693B (en) | Antioxidant fusion protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB02 | Change of applicant information |
Address after: 101102 Beijing City, Tongzhou District Zhongguancun Tongzhou Science Park Bridge Science and technology industrial base of Jing Sheng No. 8 North Street Applicant after: Gan & Lee Pharmaceutical Co., Ltd. Address before: 101102 Beijing City, Tongzhou District Zhongguancun Tongzhou Science Park Bridge Science and technology industrial base of Jing Sheng No. 8 North Street Applicant before: Ganlee Pharmaceutical Co.,Ltd. |
|
| CB03 | Change of inventor or designer information |
Inventor after: Peng Yi Inventor after: Zhang Qi Inventor after: Zhang Tingting Inventor after: Wang Damei Inventor after: Zhang Suhua Inventor after: Cai Lianzhi Inventor before: Peng Yi Inventor before: Zhang Qi Inventor before: Zhang Tingting Inventor before: Wang Damei |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: PENG YI ZHANG QI ZHANG TINGTING WANG DAMEI TO: PENG YI ZHANG QI ZHANG TINGTING WANG DAMEI ZHANG SUHUA CAI LIANZHI |
|
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20111221 |