CN102286088B - DREB (Dehydration Responsive Element Binding) transcription factor of plant as well as encoding gene and application thereof - Google Patents

Abstract

The invention relates to a DREB (Dehydration Responsive Element Binding) transcription factor of a plant, which is a protein with one of the following amino acid residue sequences: (a) SEQIDNO:1 in a sequence table; and (b) an amino acid residue sequence with a transcriptional activation function, which is used for substituting and/or deleting and/or adding one or several amino acid residues of the amino acid residue sequence of SEQIDNO:1 in the sequence table and regulating and controlling plant stress resistance. By using the protein and the encoding gene thereof in the invention, the tolerance of the plant to an adverse environment can be enhanced, and particularly, the resistance to drought stress and salt stress can be enhanced.

Description

DREB transcription factor of plant and encoding gene and application

Technical field

The present invention relates to plant transcription factor and encoding gene thereof and application, particularly relate to DREB transcription factor and an encoding gene thereof that derives from halophytes Bi Shi Salicornia Bigelovii Torr., with and application in cultivating the transgenic plant that salt tolerance improves.Belong to molecular biology and biological technical field.

Technical background

The soil salinization is one of abiotic stress factor had a strong impact on agriculture production and ecotope.Therefore, thus raising salt tolerance of crop cultivation New salt-tolerant cultivar, taking full advantage of and boosting agricultural yield significant saltings.Arid response element binding protein (DREB) class transcription factor belongs to the class members of element responsive to ethylene in conjunction with albumen (AP2/EREBP) family, special being present in plant, the cis-acting elements that contains DRE/CRT in its energy specific combination promotor the expression that activates its downstream gene.The DRE/CRT cis-acting elements is prevalent in the promotor of stress response genes involved, therefore the DREB transcription factor can regulate and control many expression and functions enforcements of coercing genes involved by participation, the abiotic stress such as arid, high salt and low temperature are produced to response, thereby to import or improve a transcription factor be to improve the more efficiently method of salt tolerance of crop and approach.

The Bi Shi Salicornia Bigelovii Torr. ( salicornia bigelovii Torr.) be one of higher plant of salt tolerant in the world, its tender point can be used as vegetables, and its seed can extract oil.As typical halophytes, Bi Shi Salicornia Bigelovii Torr. saline-alkaline tolerance surpasses 20%～40% of sea water salinity, and the salt tolerant limit reaches 5%NaCl concentration, and the NaC1 salinity of its most suitable growth environment is up to 200 mmol/L(Glenn et al., 1998).Research to the Bi Shi Salicornia Bigelovii Torr. shows, it does not possess the specialization structures such as salt-secreting gland, does not significantly accumulate Organic osmotica yet, is therefore the fabulous gene pool of research plant salt tolerance mechanism.Clone the DREB homologous gene and study its function from euhalophyte Bi Shi Salicornia Bigelovii Torr., new materials and methods will be provided for the genetic improvement of salt stress-resistant.The separation of Bi Shi Salicornia Bigelovii Torr. DREB transcription factor gene and the work of identifying are to utilize genetic engineering technique that the foreign gene obtained is imported to plant, thereby the transgenic plant that obtain the salt resistant gene overexpression lay the foundation, these plants are applied in the extreme environment of high salinity, can improve soil, improve environment, enlarge tree and grass coverage, have that important theoretical investigation is worth and application prospect widely.

Summary of the invention

The object of the present invention is to provide DREB class transcription factor and an encoding gene thereof that derives from the Bi Shi Salicornia Bigelovii Torr..

A DREB class transcription factor provided by the invention, name is called salicornia bigelovii Torr.dRE biding protein (is called for short sbDREB), derive from the Bi Shi Salicornia Bigelovii Torr. ( salicornia bigelovii Torr.), be the protein with one of following amino acid residue sequences:

A) the SEQ ID N in the sequence table _o : 1;

B) by SEQ ID N in sequence table _o : 1 amino acid residue sequence is through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and the amino acid residue sequence with regulating plant resistance of transcriptional activation function.

Wherein, the SEQ ID N in sequence table _o : 1 is comprised of 284 amino-acid residues, from the 100th of aminoterminal (N end) to the 158th amino acids residue, is conservative AP2/EREBP structural domain.

The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation refer to replacement and/or disappearance and/or the interpolation of no more than ten amino-acid residues.

In the DREB transcription factor of Bi Shi Salicornia Bigelovii Torr.: described protein there is sequence table in SEQ ID N _o : 1 amino acid residue sequence.

The encoding gene of the DREB transcription factor of a kind of above-mentioned Bi Shi Salicornia Bigelovii Torr. is characterized in that:

A) SEQ ID N in the sequence table _o : 2 DNA sequence dna;

B) SEQ ID N in the code sequence list _o : the polynucleotide sequence of 1 protein sequence;

C) under the rigorous condition of height can with SEQ ID N in sequence table _o : the nucleotide sequence of the 2 DNA sequence dna hybridization that limit.

The rigorous condition of described height is at 0.1 * SSPE(or 0.1 * SSC), in the solution of 0.1%SDS, hybridize under 65 ℃ of conditions and wash film.

SEQ ID N in list _o : 2 are comprised of 1206 deoxynucleotides, and its encoding sequence is for holding the 192nd to 1043 deoxynucleotides from 5 ', and coding has SEQ ID N in sequence table _o : the protein of 1 amino acid residue sequence.

The expression vector that contains gene of the present invention, clone and Host Strains all belong to protection scope of the present invention.Amplification sbDREBthe primer pair of arbitrary fragment is also within protection scope of the present invention.

Another object of the present invention is to provide a kind of by the DREB class transcription factor in the present invention sbDREBapplication in the regulating plant salt tolerance.

The application of regulating plant salt tolerance provided by the present invention is by the gene of described coding Suaeda salsa DREB class transcription factor sbDREBimport plant tissue or cell, plant salt endurance obtains regulation and control.

The gene of described coding Bi Shi Salicornia Bigelovii Torr. DREB class transcription factor sbDREBcan be by containing sbDREBplant expression vector import explant; Can be any one double base agrobacterium vector or can be used for the carrier etc. of plant micropellet bombardment for the carrier that sets out that builds described plant expression vector, as pBI121, pCAMBIA2301, pCAMBIA1301, pAHC25 or other derivative plant expression vectors; Use of the present invention sbDREBwhile building plant expression vector, can add any composing type, organizing specific type, induction type or enhancement type promotor before its transcription initiation Nucleotide; For the ease of transgenic plant cells or plant are identified and are screened, can be processed used carrier, there is the antibiotic marker (kantlex, Totomycin etc.) of resistance or anti-chemical reagent marker gene (as antiweed bar gene etc.) and the coding that can express as added and can produce (gus gene, GFP genes etc.) such as the enzyme of colour-change or albumen in plant.

Carry sbDREBplant expression vector can by using, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity be led, conventional biological method transformed plant cells or the tissue such as agriculture bacillus mediated, and the vegetable cell of conversion or tissue cultivating are become to plant.The above-mentioned method by the transgenic regulation plant salt endurance is all applicable to all plants, both applicable to monocotyledons (wheat, paddy rice, corn etc.), also can be suitable for dicotyledons (tobacco, cotton etc.).

Provided by the invention sbDREBgene is from the Bi Shi Salicornia Bigelovii Torr., and the real-time quantitative PCR detected result shows under salt and drought stress, sbDREBexpression amount in Bi Shi Salicornia Bigelovii Torr. blade obviously improves, show its be subject to high salt and the arid induced strong, it is relevant with salt tolerant, the drought resistance of Bi Shi Salicornia Bigelovii Torr..Transgene tobacco experimental results show that the overexpression of this gene has improved the salt tolerance of tobacco.Therefore, sbsDREBcan be used as goal gene and import plant (comprising unifacial leaf and dicotyledons), improve plant salt endurance, there is higher actual application value.

The accompanying drawing explanation

The multiple comparison result that Fig. 1 is SbDREB and other plant DREB AP2/EREBP structural domain aminoacid sequence;

The systematic evolution tree that Fig. 2 is SbDREB;

Fig. 3 is Different stress pair sbDREBthe real-time quantitative PCR detected result of mrna expression impact;

Fig. 4 is mpCAMBIA2301 carrier physical map;

Fig. 5 is mpCAMBIA2301::SbDREB plant expression vector physical map;

The PCR checking photo that Fig. 6 is the mpCAMBIA2301::SbDREB transgene tobacco;

The RT-PCR checking photo that Fig. 7 is the mpCAMBIA2301::SbDREB transgene tobacco;

The salt tolerant experimental result that Fig. 8 is the mpCAMBIA2301::SbDREB transgene tobacco.

concrete invention embodiment:

Method in following embodiment if no special instructions, is ordinary method.

embodiment 1: the Bi Shi Salicornia Bigelovii Torr. sbDREBthe clone

The method clone Bi Shi Salicornia Bigelovii Torr. DREB class transcription factor encoding gene of utilizing information biology and conventional polymerase chain reaction (PCR) to combine sbDREBdNA sequence dna, concrete grammar is:

(1) sbDREBthe amplification of gene fragment

Select the blade of Bi Shi Salicornia Bigelovii Torr. as experiment material, extract test kit (Takara) by Plant Genome and extract Bi Shi Salicornia Bigelovii Torr. genomic dna.According to aminoacid sequence WGKWVAEI and the YKPLHSSV of DREB class transcription factor conserved regions, design pair of degenerate primers (primer is synthetic by Shanghai bio-engineering corporation):

Forward primer: SEQ ID N _o : 3:

5’-TGGGGG(T)AAG(A)TGGGTC(T)GCC(A/T)GAA(G)ATC(T)CG-3’，

Reverse primer: SEQ ID N _o : 4

5’-ACG(A/T)GAG(A/T)GAG(A)TGG(A/T/C)AGA(T)GGC(T)TTG(A)TA-3’。

Adopt the LA-Taq enzyme of Takara, the genome of Bi Shi Salicornia Bigelovii Torr. of take carries out conventional polymerase chain reaction (PCR) as template.

25 μ l PCR reaction systems: 2.5 μ l are containing MgCl ₂10 * PCR damping fluid, get the primer SEQ ID N of 10 μ M _o : 3 and SEQ ID N _o : 4 each 1.0 μ l, the dNTP(deoxynucleoside acid mixture of 1.0 μ l 10mM), 1.0 μ l DNA samples, 0.25 μ lLA-Taq enzyme (precious biotechnology (Dalian) company limited), 18.5 μ l distilled waters.The PCR reaction conditions: 95 ℃ of denaturations 5 minutes, 95 ℃ of sex change 30 seconds, 55 ℃ of renaturation 45 seconds, 72 ℃ are extended 1 minute, and after 35 circulations, 72 ℃ are extended 10 minutes.The scheme that the approximately 200bp DNA fragmentation that amplification is obtained reclaims test kit (Hangzhou like pursue progress Bioisystech Co., Ltd) and provides by test kit with gel reclaims this fragment, with pGEM – T vector system (Promega company, the U.S.) press this fragment of test kit explanation clone, order-checking (Shanghai bio-engineering corporation).Sequential analysis shows the conserved regions fragment height homology of aminoacid sequence and the DREB proteinoid of this sequence encoding, therefore determines and has obtained sbDREBgene fragment.

(2) sbDREBthe clone of gene cDNA total length

The salt of learning from else's experience induces rear Bi Shi Salicornia Bigelovii Torr. blade as experiment material, adopts SV Total RNA lysis test kit (Promega company, the U.S.) to extract total RNA.According to what obtained sbDREBgene fragment, we have designed 5 ' the end primer of two Auele Specific Primers (synthetic by Shanghai bio-engineering corporation) as 3 ' RACE:

SbD3’GSP1 ：SEQ ID N _O ：5：

5’- CTCGTCTATGGCTCGGAACATTCC - 3’

SbD3’GSP2 ：SEQ ID N _O ：6：

5’-GATCTCATGTCACCACCCAATTTG- 3’，

3 ' end primer is provided by 3 ' RACE test kit (invitrogen company (U.S.)).Get the total RNA of 1 μ g and carry out 3 ' RACE, 3 ' the RACE test kit specification sheets that the RACE program provides according to invitrogen company carries out.

With SEQ ID N _o : 5 and 3 ' end primer carries out first round pcr amplification, and gained PCR product is got 1 ul as template after diluting 100 times, with SEQ ID N _o : 6 and 3 ' end primer carries out second and takes turns pcr amplification, obtains the 3 ' end of the cDNA of this gene.The first round and second takes turns the PCR reaction conditions and is: after 95 ℃ of denaturation 3 min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 1 min, totally 35 circulations; Then 72 ℃ are extended 10 min.

According to what obtained sbDREBgene fragment, we have designed two 3 ' terminal specific primers (synthetic by Shanghai bio-engineering corporation) of 5 ' RACE, are respectively:

SbD5’GSP1：SEQ ID N _O ：7：

5’-AGAGACCAAATTGGGTGGTGACAT- 3’

SbD5’GSP2：SEQ ID N _O ：8：

5’-GACGAGTTCGATTCTTAGGCAATC- 3’，

5 ' the end universal primer AAP that test kit provides:

5’-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG- 3’

5 ' the sites Adaptor Primer AUAP that test kit provides:

5’-GGCCACGCG TCGACTAGTAC- 3’

Get the total RNA of 1 μ g and carry out 5 ' RACE, 5 ' the RACE test kit specification sheets that the RACE program provides according to invitrogen company (U.S.) carries out.

SEQ ID N _o : 75 ' the end universal primer AAP that provide with test kit: carry out first round pcr amplification, gained PCR product is got 1 ul as template after diluting 100 times, with SEQ ID N _o : 85 ' the sites Adaptor Primer AUAP primers that provide with test kit carry out second and take turns pcr amplification, obtain 5 ' end of this gene cDNA.Two-wheeled PCR reaction conditions is: after 95 ℃ of denaturation 3 min, and 94 ℃ of 45s, 58 ℃ of 45s, 72 ℃ of 1 min10s, totally 35 circulations; Then 72 ℃ are extended 10 min.

Gained 5 '-RACE product, after cloning and sequencing, is spliced (adopting the DNAMAN biological software to carry out sequence assembly) with 3 '-RACE product sequencing result, obtain sbDREBfull length cDNA sequence.The cDNA obtained by the method reverse transcription of test kit through reverse transcription test kit (precious biotechnology (Dalian) company limited) with the total RNA of 1 μ g Bi Shi Salicornia Bigelovii Torr. blade is template, according to sbDREBfull length cDNA sequence design pair of primers following (primer is synthetic by Shanghai bio-engineering corporation):

SbDREB-F: SEQ ID N _O ：9：

5’- CTCCTGGGCGGGGCCACCGCCCTC -3 ’，

SbDREB-R: SEQ ID N _O ：10：

5’- GACACAATATATAGTAATATTAAC -3 ’

By SEQ ID N _o : 9 and SEQ ID N _o : 10 clone sbDREBthe cDNA total length.

25 μ l PCR reaction systems contain MgCl containing 2.5 μ l ₂10 * PCR damping fluid, get the primer SEQ ID N of 10 μ M _o : 9 and SEQ ID N _o : the dNTP(deoxynucleoside acid mixture of 10 each 1.0 μ l, 1.0 μ l 10mM), 1.0 μ l cDNA templates and 18.5 μ l distilled waters, and 0.25 μ lLA-Taq enzyme (precious biotechnology (Dalian) company limited).The PCR reaction conditions is: after 95 ℃ of denaturation 3 min, and 94 ℃ of 1 min, 58 ℃ of 45s, 72 ℃ of 1 min 20s, totally 35 circulations; Then 72 ℃ are extended 10 min.The scheme that the approximately 1200bp DNA fragmentation that amplification is obtained reclaims test kit (Hangzhou like pursue progress Bioisystech Co., Ltd) and provides by test kit with gel reclaims this fragment, with pGEM – T vector system (Promega company, the U.S.) press this fragment of test kit explanation clone, order-checking (Shanghai bio-engineering corporation).Sequencing result shows that this sequence is exactly aim sequence, by this unnamed gene is salicornia bigelovii Torr.dRE biding protein (is called for short sbDREB), its proteins encoded called after SbDREB.

embodiment 2: sbDREBthe sequence information analysis and the homology evolutionary analysis of SbDREB

Of the present invention sbDREBfull length gene cDNA is 1206bp, comprises initiator codon and poly A tract.Open reading frame is partly 852bp, is positioned at the 192-1043bp place.The DNASTAR software analysis shows ssDREB284 amino acid of encoding altogether, this molecular weight of albumen (MW) is 31.9Kda, theoretical iso-electric point (pI) is 7.71.This Argine Monohydrochloride residue sequence is searched in international gene pool (GenBank), found sbDREBcoded albumen contains an AP2/EREBP structural domain very conservative in DREB subtribe transcription factor, from the 100th of aminoterminal (N end) to the 158th amino acids residue (SEQ ID N _o : holding the 489-665 bit base from 5 ' in 2 is its encoding sequence), totally 59 amino acid, wherein the 14 is that amino acid is α-amino-isovaleric acid (V), with the DREB class transcription factor of having reported, is consistent.The sequence analysis analysis of sequence can provide for the research of gene function some useful informations.For the kinship of clear and definite SbDREB and the DREB class transcription factor reported and its classification position in whole AP2/EREBP family, now SbDREB AP2/EREBP DNA is carried out to the evolutionary tree compare of analysis in conjunction with the aminoacid sequence in territory and other members in this family, concrete grammar is: SbDREB is carried out to the sequence alignment analysis with DNAMAN software with logging in GenBank and have the DNA of the class of the DREB from the other plant transcription factor of bibliographical information to be combined the aminoacid sequence in territory, find AP2 structural domain and apple MdAP2 transcription factor (the GenBank accession number: ADE41121) of SbDREB, caragana microphylla CkDREB2 transcription factor (GenBank accession number: ADD69957), cotton GhDREB2 transcription factor (GenBank accession number: AAT39542), soybean GmDREB2 transcription factor (GenBank accession number: AAQ57226), Maize Transcription Factor ZmDBF1(GenBank accession number: AAM80486.1), ZmDREB1(GenBank accession number: ACG35323) with the ZmDREB2(GenBank accession number: ACO72993)) AP2 zone has high homology, homology is respectively: 96 ﹪, 93 ﹪, 94 ﹪, 93 ﹪, 88 ﹪, 88 ﹪, 90%, AP2 conserved regions sequence amino acid identity high (seeing accompanying drawing 1).The amino acid residue sequence of these albumen all contains a conservative AP2/EREBP structural domain, and in this structural domain the 14th and the amino acid of 19 are respectively α-amino-isovaleric acid and leucine.The specificity that the amino acid that research shows these two positions is combined with DNA for DREB subtribe and ERF subtribe member plays critical effect.In Arabidopis thaliana, the α-amino-isovaleric acid of the 14th is all guarded all DREB subtribe members, and larger the amino acid whose mutability of 19, is mainly L-glutamic acid, in addition, also finds that there is leucine and α-amino-isovaleric acid etc.Consistent with amino acid whose conservative property, Sakuma etc. study by the method for rite-directed mutagenesis the avidity that the amino acid simple point mutation of finding the 19th affects DREB transcription factor and DRE element hardly, the simple point mutation of 14 α-amino-isovaleric acids has significantly reduced this avidity, show that the α-amino-isovaleric acid of 14 has determined specificity (the Sakuma Y of DREB subtribe transcription factor and DRE combination of elements, Liu Q, Dubouzet J G, et al. DNA-binding specificity of the ERF/AP2 domain of arabidopsisdREBs, transcription factors involved in dehydration and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 2002,290:998-1009).BDREB class transcription factor be in plant can with DRE combination of elements and then the degeneration-resistant transcription factor of reacting of coercing of regulating plant.DREB class transcription factor belongs to a subtribe (DREB subtribe) in the AP2/ERF transcription factor family, Sakuma(2002) further this subtribe is divided into to 6 groups (A1 to A6).At present DREB subtribe member's research mainly concentrated on to A-1 and A-2 group, what other group memberships were studied is less.But according to data in Arabidopis thaliana, other group memberships in whole DREB subtribe in occupation of 75% quantity.With DNAstar Software on Drawing SbDREB and the systematic evolution tree that represents the DREB albumen of each subtribe, result shows that SbDREB belongs to the A-6 subgroup of DREB subtribe, and other members of the A-6 of DREB family reported group also have corn zmDREB1 gene, cotton ghDBP2 genes, soybean gmDREB2 genes, aloe aIDREB2 genes and caragana microphylla ckDBFgene, organize other members' function and infer that SbDREB may be subject to the environment-stress such as high salt, arid to induce (seeing accompanying drawing 2) according to the A-6 of DREB family reported.

embodiment 3: environment stress pair sbDREBthe impact of genetic expression

In order to study sbDREBthe response of environment-stress to external world, detect by the method for real-time quantitative PCR sbDREBthe expression pattern of gene under various environment-stress treatment condition, and take following measures to guarantee the pollution of a small amount of genomic dna that may exist in the reliability of detected result: a, the total RNA with amplification rank DNase I digestion extraction, for detecting genomic dna, whether eliminate totally, can take out a part and carry out conventional PCR reaction with total RNA sample of DNase I digestion, when finding that amplified band useless produces, then carry out reverse transcription step; B, due to sbDREBgene does not have intron, and it may be arranged in the Bi Shi Salicornia Bigelovii Torr. with the member of family, so amplified production is not placed on the coding region of its cDNA as far as possible, the zone of the very conservative AP2/ERF structural domain of coding particularly, for whether the band of further checking real-time quantitative PCR amplification is exactly sbDREB, the PCR product is cut to the glue recovery and is checked order.According to what obtain sbDREBthe primer of a pair of real-time quantitative PCR of gene 5 ' non-translational region sequences Design (primer is synthetic by Shanghai bio-engineering corporation):

The Sb-QF(upstream primer): SEQ ID N _o : 11:

5’-TGCACAAAACCTTCCAAATTCTTC-3’；

The Sb-QR(downstream primer): SEQ ID N _o : 12:

5’-TTCCCCCAATGTCTCTGCCTTACT-3’。PCR product length is 144bp.

Take the exciting albumen of actin(of Bi Shi Salicornia Bigelovii Torr.) cDNA is internal reference, the real-time quantitative PCR primer be (primer is synthesized by Shanghai bio-engineering corporation):

The Actin-F(upstream primer): SEQ ID N _o : 13:

5’-TTTGAGCAGGAATCAGAAACCGCC-3’；

The Actin-R(downstream primer): SEQ ID N _o : 14:

5’-AGGACCTCTGGGCAACGGAATCTC-3’。PCR product length is 116bp.

Concrete grammar is: get 3 months large Bi Shi Salicornia Bigelovii Torr. seedling and carry out respectively followingly coercing out: after NaCl(takes out seedling from soil in 1/2MS solution preculture after 7 days, put into containing the 2/1MS solution of 250mMNaCl processed), arid (after seedling is taken out from soil in 2/1MS solution preculture put into after 7 days containing the 1/2MS solution of 20%PEG6000 processed), the 1/2MS solution that after low temperature (4 ℃) and ABA(take out seedling from soil, preculture is put into after 7 days containing 100 μ m/L ABA in 1/2MS solution is processed), the Bi Shi Salicornia Bigelovii Torr. seedling of not doing any processing of take is contrast, then by method same as described above, detect sbDREBexpression, take equally the exciting albumen of actin(of Bi Shi Salicornia Bigelovii Torr.) cDNA is internal reference.Experimental procedure is specific as follows: adopt SV Total RNA lysis test kit (Promega company, the U.S.) extract through Stress treatment and the total RNA of Bi Shi Salicornia Bigelovii Torr. fleshy stem contrasted, first get the total RNA of 1 μ g and add amplification rank DNase I(Sigma, USA) room temperature is placed the pollution that removes genomic dna in 30 minutes, then add and stop damping fluid (50mM EDTA), 70 ℃ of 10 minutes sex change DNase I of heating and RNA; Then adopt the reverse transcription test kit of precious biotechnology (Dalian) company limited to carry out reverse transcription according to the test kit specification sheets, each sample is got the total RNA of 2 μ g, and under 42 ℃, reaction is 1 hour, 70 ℃ of heating, after 10 minutes, takes out, be placed on ice, so that ThermoScript II makes to live; Finally get 1 μ l upset record product and carry out the real-time quantitative PCR amplification.Use the SYBR Premix Ex Taq of TaKaRa company ^tMtest kit, according to operation instructions, in quantitative real time PCR Instrument Light Cycler 2.0(Roche company) on carry out quantitative fluorescent PCR.Adopt 2 in Light Cycler 2.0 ^{-Δ Δ cp}method is carried out gene relative expression component analysis, detects in fleshy stem sbDREBthe expression of gene, using that the expression of gene is as standard in the contrast fleshy stem, and numerical value is made as 1, and all the other samples be the relative expression's value with respect to standard 1, and each sample arranges 3 repetitions, is two kinds of PCR and reacts, 20 μ L reaction systems.Be specially the PCR reaction system of (1) goal gene: comprise 1 μ l cDNA, 2 * PCR mix damping fluid, 10 μ l, SEQ ID N _o : 11 with SEQ ID N _o : 12 primers (5 μ M/ μ l) are 1 μ l respectively, 7 μ l H ₂o supplies; (2) the PCR reaction system of reference gene: comprise 1 μ l cDNA, 2 * PCR mix damping fluid, 10 μ l, SEQ ID N _o : 13 with SEQ ID N _o : 14 primers (5 μ M/ μ l) are 1 μ l respectively, 7 μ l H ₂o supplies.The PCR response procedures is: 95 ℃ of denaturation 30 s; 95 ℃ of 5 s, 57 ℃ of 10s, 72 ℃ of 20 s, after 40 circulations, do the solubility curve analysis.

Detected result shows, sbDREBgene can be by arid, high salt abduction delivering. sbDREBgene arid, under high-salt stress all the prolongation expression amount along with the time of coercing raise gradually, Stress treatment in the time of 8 hours expression amount reach the highest, then reduction gradually. sbDREBgene gene expression abundance under high salt is processed improves rapidly, and the expression under processing than arid peaks ahead of time. sbDREBgene gene expression abundance of 8 hours under high salt is processed is approximately 25 times of contrast, and under arid, the gene expression abundance of 8 hours is 9.5 times of contrast.With the A-6 subgroup zmDBF1gene is the same, and ABA can induce sbDREBthe expression of gene, ABA processes 0.5 to 2 hour, sbDREBthe expression amount of gene slightly raises, and, after processing 4 hours, its gene expression abundance raises rapidly, and expression amount is 16 times of contrast, then reduces gradually.4 ℃ of subzero treatment 0.5 hour, sbDREBgene expression amount is substantially constant, however subzero treatment 2 hours, sbDREBthe expression amount of gene reduces rapidly, and along with the further prolongation expression amount of the time of coercing remains unchanged substantially, in subzero treatment in the time of 24 hours, expression amount is only the 12%(accompanying drawing 3 of contrast).These results show that this gene is subject to inducing of high salt, arid and A BA, and are not subject to low temperature induction.

embodiment 4: sbDREBthe structure of gene plant expression vector and the experiment of the resistance of transgene tobacco

(1) structure of expression vector

With sbDREBthe cDNA full length sequence is template, is containing the primer of restriction enzyme site (Shanghai bio-engineering corporation is synthetic)

Strans-F：SEQ ID N _O ：15：

5 '-GCC tCTAGAaTGGCTGCTGCAATAGATACATATAG-3 ', (band underscore base was the restriction restriction endonuclease xbathe I recognition site)

Strans-R：SEQ ID N _O ：16：

5 '-GCC cCCGGGtTAAAGAGAATCCCAGTCAATTTC-3 ', (band underscore base was the restriction restriction endonuclease smathe I recognition site)

At SEQ ID N _o : 15 and SEQ ID N _o : under 16 guiding, pcr amplification 5 ' end adds xbai recognition site, 3 ' end add smathe I recognition site sbDREBthe coding region full length sequence.Reaction is carried out 1.2% agarose gel electrophoresis detection to pcr amplification product after finishing, and reclaims the also purpose fragment of the about 850bp of purifying, by its use xbai and smaafter the I enzyme is cut, with the carrier mpCAMBIA2301(Fig. 4 through the same enzyme double digestion) use T ₄16 ℃ of connections of DNA ligase are spent the night, and (the 20ul reaction system is containing 1 * T ₄the DNA ligase damping fluid, mpCAMBIA2301 fragment 0.03pmol, sbDREBfragment 0.3pmol, 350u T ₄dNA ligase), connect product and transform bacillus coli DH 5 alpha competent cell (method for transformation reference " molecular cloning experiment guide " second edition, the P55-56 page, Science Press, 1992), obtain the flat board of e.colidh5αcell suspension coating containing the 80mg/L kantlex after conversion, the positive colony of antagonism kantlex is increased and is extracted plasmid, take enzyme to cut the exactness be connected with the method validation checked order and obtain plant expression vector mpCAMBIA2301::SbDREB, mpCAMBIA2301::SbDREB plasmid figure as shown in Figure 5.With the freeze thawing conversion method, this carrier is transformed to agrobacterium tumefaciens EH105, obtain the agrobacterium strains that contains mpCAMBIA2301::SbDREB, called after TmpCAMBIA2301::SbDREB; Plasmid mpCAMBIA2301 is transformed to agrobacterium tumefaciens EH105, obtain the agrobacterium strains TmpCAMBIA2301 that contains the mpCAMBIA2301 empty carrier.

(2) agriculture bacillus mediated Transformation of tobacco and Screening and Identification

The single Agrobacterium bacterium colony of picking from culture plate, overnight incubation in the 2ml YEB substratum that contains 50mg/L kantlex, 30mg/L Streptomycin sulphate; Amount with 1% is inoculated in (50mg/L kantlex, 30mg/L Streptomycin sulphate) overnight incubation in 100ml YEB substratum, the centrifugal collection thalline of 6000rpm, and with infecting the substratum Eddy diffusion, bacterial concentration is adjusted to OD ₆₀₀approximately 0.5 as infecting bacterium liquid.Adopt leaf-disc transformation, by sterile razor blade, aseptic tobacco test-tube plantlet blade is cut into to the leaf dish of 4～6mm, leaf dish explant is respectively at OD ₆₀₀approximately 0.5 TmpCAMBIA2301::SbDREB and TmpCAMBIA2301(turn empty carrier contrast) Agrobacterium infects in solution and infects 10min, blot surface liquid with aseptic filter paper after taking-up, put into and contain co-culture media (the MS minimum medium adds 6-benzyl aminopurine 1.0mg/L, naphthylacetic acid 0.1 mg/L, sucrose 30g/L, pH 5.8) filter paper under dark condition, cultivate altogether 2 days for 25 ℃.The cephamycin solution washing that leaf dish use through cultivating altogether 2 days contains 500mg/L 3 times, blot surface liquid with aseptic filter paper and proceed in the screening division culture medium, 25 ℃ of illumination cultivation.The screening of transformant is carried out in screening division culture medium (the MS minimum medium adds 6-benzyl aminopurine 1.0mg/L, naphthylacetic acid 0.1 mg/L, kantlex 80mg/L, cephamycin 400mg/L, sucrose 30g/L, and pH 5.8).When blade edge grows the regeneration bud of growing thickly to 2-3cm, with scalper, regeneration bud is cut, and proceed to the middle cultivation of root media (the MS minimum medium adds kantlex 50mg/L, sucrose 20g/L, and pH 5.8) 25 days.The plant of transformant regeneration has kalamycin resistance, is normal green plant, altogether 17 strain transfer-gen plants and 10 strains turn the empty carrier plant.

Extract test kit (Takara) with genome and extract TmpCAMBIA2301::SbDREB and TmpCAMBIA2301 tobacco gene group DNA, the genomic dna that the 100ng of take extracts carries out the PCR reaction as template.Identify that with PCR be 25 μ l reaction systems, containing 2.5 μ l, contain MgCl ₂10 * PCR damping fluid, the primer SEQ ID N in example 4 _o : 15 and SEQ ID N _o : 16(concentration 10 μ M) the dNTP(deoxynucleoside acid mixture of each 1.0 μ l, 1.0 μ l 10mM), 1.0 μ l genomic dna templates and 18.5 μ l distilled waters, and 0.25 μ l rTaq enzyme (precious biotechnology (Dalian) company limited).Amplification reaction condition is: 94 ℃ of denaturations 5 minutes; 95 ℃ 30 seconds, 55 ℃ 50 seconds, 72 ℃ 1 minute 10 seconds, 35 circulations, 72 ℃ are extended 10 minutes.Amplified production is carried out to gel electrophoresis, result as shown in Figure 6, in the 15 strain tobaccos of identifying, there are the 14 strain positives to turn TmpCAMBIA2301::SbDREB tobacco amplified production, at the 850bp place estimated, band clearly arranged, and have 1 strain false positive turn the TmpCAMBIA2301::SbDREB tobacco and turn TmpCAMBIA2301 tobacco (empty carrier contrast) without PCR product band.In order further to identify transfer-gen plant, adopt SV Total RNA lysis test kit (Promega company, the U.S.) extract turning TmpCAMBIA2301::SbDREB and turning TmpCAMBIA2301 tobacco (empty carrier contrast) the total RNA of blade by the genome test positive, the cDNA obtained by the method reverse transcription of test kit through reverse transcription test kit (precious biotechnology (Dalian) company limited) with the total RNA of 1 μ g blade is template, and the PCR primer is SEQ ID N _o : 15 and SEQ ID N _o : 16,25 μ l PCR reaction systems contain MgCl containing 2.5 μ l ₂10 * PCR damping fluid, primer SEQ ID N _o : 15 and SEQ ID N _o : 16(concentration 10 μ M) the dNTP(deoxynucleoside acid mixture of each 1.0 μ l, 1.0 μ l 10mM), 1.0 μ l cDNA templates and 18.5 μ l distilled waters, and 0.25 μ l rTaq enzyme (precious biotechnology (Dalian) company limited).Amplification reaction condition is: 94 ℃ of denaturations 5 minutes; 95 ℃ 30 seconds, 55 ℃ 50 seconds, 72 ℃ 1 minute 10 seconds, 35 circulations, 72 ℃ are extended 10 minutes.Amplified production is carried out to gel electrophoresis, qualification result as shown in Figure 7, in 15 strains of identifying turn TmpCAMBIA2301::SbDREB tobacco positive plant, there is the RT-PCR amplified production of 13 strains, at the 850bp place, band is clearly arranged, illustrate that this gene has carried out transcriptional expression in tobacco, and have 2 strains to turn the TmpCAMBIA2301::SbDREB tobacco and the RT-PCR that turns TmpCAMBIA2301 tobacco (empty carrier contrast) without PCR product band, illustrate that this gene does not carry out transcriptional expression in tobacco.

(3) gene function analysis

By size grow consistent turn the positive tobacco seedling of dreb gene with proceed to the mpCAMBIA2301 empty plasmid contrast the taking-up of tobacco seedling band root, in the MS liquid nutrient medium, renewal cultivation is after 3 days, transfer them in the MS substratum that contains 300mM NaCl, in the illumination box of 28 ℃, cultivate, process after 4 days, can observe contrast tobacco plant blade wilts serious than transgene tobacco, the transgene tobacco blade still keeps certain turgescence, and the lobus cardiacus of contrast tobacco leaf has just started to wilt, the phenomenon (see figure 8) such as leaf margin is curling, blade is sagging.As can be seen here, sbDREBoverexpression in tobacco can improve the resistance of Transgenic Tobacco plant to salt stress.

Above each embodiment is not to concrete restriction of the present invention; those of ordinary skill in the art is in conjunction with the conventional techniques means of this area; by amino acid residue sequence protein disclosed by the invention and encoding gene thereof, monocotyledons or dicotyledons are carried out to the stress resistance of plant regulation and control, all fall into protection scope of the present invention.

nucleotide or aminoacid sequence table

<110 > Jiangsu Province Agriculture Science Institute

<120 > plant DREB transcription factor and encoding gene and application

<160>16

<170> PatentIn version 3.3

<210>1

<211>284

<212>PRT

<213>the Bi Shi Salicornia Bigelovii Torr. ( salicornia bigelovii Torr.)

<400>1

MAAAIDTYSS SNNNPLVLDP LSEELKRAFE PFIPASPPTN PPLYHSSNNN LYMFSQGFDQ 60

NMGIAQNLPN SSMVSTLCLK KNHRFLSPKL AVMKQNKPTK LYRGVRQRHW GKWVAEIRLP 120

KNRTRLWLGT FQTAEEAALA YDKAAYKLRG HFARLNFPHM KHNGSHVTTQ FGLYKPLHSS 180

VDAKLEAICQ SLDIPQEQGK TEYPCFSSVC DSDSYPVLDT VSPTTEEVLI RKPKVPTVAD 240

DSPTASCSPE SGLKLLDFTK SCWNESDISS LDKLPSLEID WDSL 284

<210>2

<211>1206

<212>cDNA

<213>the Bi Shi Salicornia Bigelovii Torr. ( salicornia bigelovii Torr.)

<400>2

CTCCTGGGCG GGGCCACCGC CCTCCCACCT TCCTGGGGGC CTCCCTCGCC ACCCCGCTCC 60

GCCCGACAAT ACCAATTTCC TTCCTGCCCC TCATCAACGT TTAACTTGAA CTGATCCTCT 120

TGCTTCATCC CACCTCTTGC TTCTTACAAT ACATATTTCA GCTTATTACC AGGAATAATT 180

ATCAGAAACT TATGGCTGCT GCAATAGATA CATATAGTAG CTCCAACAAC AATCCCCTTG 240

TTTTAGATCC TCTAAGTGAG GAGCTAAAGA GAGCATTTGA ACCTTTCATC CCTGCTTCAC 300

CACCCACAAA CCCACCTTTA TACCACTCTT CAAATAACAA TCTTTACATG TTTTCTCAAG 360

GGTTTGATCA AAACATGGGT ATTGCACAAA ACCTTCCAAA TTCTTCAATG GTTTCTACTC 420

TATGTTTAAA GAAAAACCAT CGTTTCCTTT CCCCTAAACT AGCAGTAATG AAACAAAACA 480

AACCCACAAA ATTATATAGA GGAGTAAGGC AGAGACATTG GGGGAAATGG GTGGCTGAGA 540

TTAGATTGCC TAAGAATCGA ACTCGTCTAT GGCTCGGAAC ATTCCAAACT GCTGAAGAAG 600

CTGCCTTAGC CTATGACAAA GCAGCATATA AACTTCGAGG ACACTTTGCT CGTCTCAATT 660

TCCCACATAT GAAGCATAAT GGATCTCATG TCACCACCCA ATTTGGTCTC TACAAGCCTC 720

TTCATTCTTC TGTGGATGCT AAACTTGAAG CCATTTGCCA AAGCTTGGAC ATTCCTCAAG 780

AACAGGGGAA AACAGAGTAC CCCTGTTTCT CCTCTGTTTG TGATTCTGAT TCATATCCTG 840

TTTTGGATAC AGTTTCACCA ACTACTGAGG AGGTTTTAAT TCGTAAACCC AAGGTTCCCA 900

CCGTTGCAGA CGACTCACCG ACTGCTTCGT GTTCACCGGA ATCTGGACTT AAGTTGTTGG 960

ATTTCACTAA ATCTTGTTGG AATGAATCTG ATATTTCCTC CTTGGATAAG CTCCCTTCCC 1020

TTGAAATTGA CTGGGATTCT CTTTAAATCT TGTAGTTAGT TGGTTTTGGG GTTTCATTTC 1080

CTTTGGCTTA GTTCTTGTTT GGGTTTCCTT GTCCCTGCAA ATTGGTATTT TTGACATCTG 1140

CAACGACGGG GTGTATATTA GGATGCATAT CCTTGTTAAT ATTACTATAT ATTGTGTCAA 1200

AAAAAA 1206

<210> 3

<211> 26

<212> DNA

<213 > artificial sequence

<400>3

TGGGGKAART GGGTYGCHGA RATYCG 26

<210> 4

<211> 23

<212> DNA

<213 > artificial sequence

<400>4

ACDGADGART GNAGWGGYTT RTA 23

<210> 5

<211> 24

<212> DNA

<213 > artificial sequence

<400>5

CTCGTCTATG GCTCGGAACA TTCC 24

<210> 6

<211> 24

<212> DNA

<213 > artificial sequence

<400>6

GATCTCATGT CACCACCCAA TTTG 24

<210> 7

<211> 24

<212> DNA

<213 > artificial sequence

<400>7

AGAGACCAAA TTGGGTGGTG ACAT 24

<210> 8

<211> 24

<212> DNA

<213 > artificial sequence

<400>8

GACGAGTTCG ATTCTTAGGC AATC 24

<210> 9

<211> 24

<212> DNA

<213 > artificial sequence

<400>9

CTCCTGGGCG GGGCCACCGC CCTC 24

<210> 10

<211> 24

<212> DNA

<213 > artificial sequence

<400>10

GACACAATAT ATAGTAATAT TAAC 24

<210> 11

<211> 24

<212> DNA

<213 > artificial sequence

<400>11

TGCACAAAAC CTTCCAAATT CTTC 24

<210> 12

<211> 24

<212> DNA

<213 > artificial sequence

<400>12

TTCCCCCAAT GTCTCTGCCT TACT 24

<210> 13

<211> 24

<212> DNA

<213 > artificial sequence

<400>13

TTTGAGCAGG AATCAGAAAC CGCC 24

<210> 14

<211> 24

<212> DNA

<213 > artificial sequence

<400>14

AGGACCTCTG GGCAACGGAA TCTC 24

<210> 15

<211>35

<212> DNA

<213 > artificial sequence

<400>15

GCCTCTAGAA TGGCTGCTGC AATAGATACA TATAG 35

<210> 16

<211> 33

<212> DNA

<213 > artificial sequence

<400>16

GCCCCCGGGT TAAAGAGAAT CCCAGTCAAT TTC 33

Claims (8)

1. plant DREB transcription factor, its aminoacid sequence is as SEQ ID N in sequence table _o : shown in 1.

2. the encoding gene of DREB transcription factor as claimed in claim 1, is characterized in that: SEQ ID N in the code sequence list _o : the polynucleotide sequence of the aminoacid sequence shown in 1.

3. the encoding gene of DREB transcription factor as claimed in claim 2, is characterized in that: SEQ ID N in sequence table _o : the DNA sequence dna shown in 2.

4. the expression vector that contains the described encoding gene of claim 2.

5. the expression vector that contains the described encoding gene of claim 3.

6. the Host Strains that contains the described encoding gene of claim 2.

7. the Host Strains that contains the described encoding gene of claim 3.

8. the application of DREB transcription factor as claimed in claim 1 is characterized in that: gene transfered plant tissue or the cell of this DREB transcription factor of encoding, improve the salt tolerance of plant, and described plant is dicotyledons.

Images