CN102277380B

CN102277380B - A dhfr complementarily expressed cotransfection eukaryotic expression vector and preparation method and application thereof

Info

Publication number: CN102277380B
Application number: CN 201010194400
Authority: CN
Inventors: 王晶翼; 史文龙; 王庆民; 孙丽霞; 阎岩; 张莹宽; 陆贵全
Original assignee: Qilu Pharmaceutical Co Ltd
Current assignee: Qilu Pharmaceutical Co Ltd
Priority date: 2010-06-08
Filing date: 2010-06-08
Publication date: 2013-03-27
Anticipated expiration: 2030-06-08
Also published as: CN102277380A

Abstract

The invention relates to an efficient eukaryotic expression vector capable of effectively expressing an antibody and other target proteins and a preparation method and an application thereof, belonging to the technical field of biotechnology. The vector is formed by inserting a nuclear matrix adhering zone, a marmot hepatitis virus post-transcriptional control sequence, a ribosome entry site sequence, a dhfr1-105aa gene segment or a dhfr106-187aa gene segment on a pCI-neo plasmid. According to the invention, the defects that time and energy are wasted when the traditional mammalian cells are expressed and screened and target protein expression level is low are overcome, and a vector transfection CHO (Chinese Hamster Ovary) cell applying the vector can obtain a monoclonal cell strain capable of stably and efficiently expressing antibodies or fusion proteins in a short time, thus the vector provided by the invention has good application value for efficient expression and industrialization of recombinant protein.

Description

Complementary cotransfection carrier for expression of eukaryon of expressing of a kind of dhfr and preparation method thereof and application

Technical field

The present invention relates to a kind of carrier for expression of eukaryon, but be specifically related to the highly effective eukaryon expression carrier and preparation method thereof and application of a kind of high expression level antibody and other target proteins, belong to technical field of biotechnology.

Background technology

The exploitation of the eukaryotic cell expression system take Mammals as representative is the development trend of bio-pharmaceuticals industry at present.With respect to intestinal bacteria (prokaryotic cell prokaryocyte) expression system, adopt mammalian cell expression can guarantee correct pairing and the protein folding of recombinant protein disulfide linkage, can guarantee the glycosylation of protein again, keep very high consistence thereby make by the recombinant protein of mammalian cell expression and native protein at structure and function.In developed country's pharmaceutical market, the bio-pharmaceutical by the mammalian cell culture expression has reached about 60% of different kind organism Total number of drugs, and the market share is near 70%.Mammal cell with high efficient is expressed and the large scale culturing technology has become one of most important gordian technique of current field of biological pharmacy.

The high expression level of gene depends on many factors in mammalian cell, comprises transcribing, translate controlling elements, RNA metabolism, gene copy number, mRNA stability, the location of gene on host cell chromosome etc.At present the antibody construction of eukaryotic expression vector is mainly based on two kinds of strategies: the one, light chain and heavy chain are cloned into respectively on two carrier for expression of eukaryon, cotransfection in mammalian cell, thereby give expression to complete antibody; The 2nd, heavy chain and light chain are connected respectively to after the promotor of a carrier for expression of eukaryon with bidirectional promoter, or succession is connected on the promotor of same carrier for expression of eukaryon, and then is transfected in the mammalian cell and expresses.In eukaryotic expression system, the selection of Vector construction and host cell is vital for the height that determines expression amount.Based on the understanding to the eukaryotic expression regulation and control, a good carrier for expression of eukaryon will possess following feature at least: 1. have the strong promoter of one or more composing types or induction type, such as cmv5, EF1 α etc.; 2. optionally mRNA translation and translation post-treatment signal of eukaryotic cell comprises Kozak sequence, translation stop codon, mRNA cutting and tailing signal, mRNA shear signal etc.; 3. has transcription terminator; 4. have prokaryotic promoter and screening sign (such as microbiotic etc.) so that carrier increases in bacterium; 5. must possess eukaryotic expression screening sign, these signs comprise screening sign such as G418, the Zeocin etc. of stable transfected cells strain, also have gene amplification sign such as DHFR (Tetrahydrofolate dehydrogenase), GS (NADPH-linked glutamate synthase), both principles are similar, all both can be used as the screening sign of transfection positive cell, but amplifying target genes again.

Because commercial carrier for expression of eukaryon fails to effectively integrate controlling element, is difficult to obtain the cell strain of high expression level.Therefore, it is necessary adding the gene element help to improve expression amount in expression vector.In the expressing cho cell system, the acquisition of the cell strain of high level expression recombinant protein is usually relatively more difficult.Topmost factor is that to express in the low and cell cultivation process of the cells ratio of foreign protein the external source mrna instability fixed.In addition, the cell strain that obtains high expression level often needs to carry out a large amount of cell screening work, and wherein monoclonal screening and methotrexate (MTX) pressurization screening process need to expend a large amount of time.

For these shortcomings of mammalian cell expression, choice for use Regulation of Gene expression element can improve the antibody expression amount and can finish in a short time expression evaluation to recombinant cell strain, but obtains the cell strain of high level expression target protein.

The subject matter that foreign protein genes is incorporated on the cell chromosome is that the gene integration site is different, and protein expression difference is very large.In fact, the expression of foreign protein mostly is suppressed, and this mainly is because the impact of chromosome structure around it.The structure height of eukaryotic chromosome is orderly, genome can be divided into different zones and bring into play separately independently functional transcription.These zones contact closely with nuclear skeleton, are the DNA binding sites, are called matrix attachment region territory (MAR).The MAR sequence is rich in AT base (content approximately 70%), with the most sequence similarities of topoisomerase II.In many expression systems, MAR sequence and eukaryotic promoter are connected together, can improve gene expression dose and reduce position effect.Increased people β-globinMAR, human interferon beta-SAR, people CSP-BSAR, DHFR intron SAR, people HPRT MAR, lysozyme of chicken MAR and the chicken embryo α-globin MAR such as Jong-Mook Kim, and these MAR are building up to respectively on the plasmid, carry out the expression of foreign protein.The result shows that people β-globin MAR is best for the impact effect of foreign protein: the cells ratio that will express foreign protein has improved 2.5 times, approximately the positive cell of 75% mono-clonal; Improve copy number of foreign gene, thereby improve 7.5 times of expression levels; Remove mono-clonal screening step, by the two-wheeled MTX of collective of population of cells pressurization (50nM, 1 μ M), can obtain the cell colony of stably express target protein, greatly shorten experimental period.Therefore can obtain at short notice the cell strain of high-expression target proteins with this expression system.

The DHFR gene that is generally used for gene amplification can be divided into 2 part: F[1,2 on structure] and F[3], difference encoding D HFR1-105aa and DHFR106-187aa.The two-part N end of DHFR connects leucine zipper structure (GCN4 Leucine Zipper) by 10 amino acid whose Linker of (GlyGlyGlyGlySer) 2, can make up complementary expression vector.Namely carrier only contains the part (DHFR1-105 aa or DHFR106-187 aa) of DHFR, forms complementation with corresponding another carrier.When cellular gene expression, the DHFR fragment is by the help of leucine zipper structure, and recombine becomes complete DHFR molecule, brings into play its biological effect, sees accompanying drawing 1.

Therefore, respectively heavy chain gene is connected IRES (ribosome entry site(RES) sequence) and the 1-105aa of DHFR during carrier construction with light chain gene and is connected encoding gene with 106-187aa and is connected, (LZ) encoding gene of leucine zipper is all arranged before the 1-105aa of DHFR and the encoding gene of 106-187aa.Antibody gene is in cell inner expression, and the LZ-DHFR1-105 and the LZ-DHFR106-187 that are connected in behind the antibody gene are also expressed under the effect of IRES, and DHFR forms complete sterie configuration with the performance effect under the effect of LZ.There are some researches show, balance between heavy chain of antibody and the light chain expression product has material impact to the expression of complete antibody, therefore, express in this way, after the MTX screening, can obtain the cell strain of high expression level, because if heavy chain or light chain expression are uneven, arbitrary part of DHFR can not be brought into play biological effect, only has two portions to combine completely biological effect of competence exertion.

The impact that the expression level of foreign protein is regulated by the genetic transcription front and back.Usually, carrier construction is regulated the common startup of using strong promoter and enhanser to improve gene, is transcribed efficient before genetic transcription, the adjusting after transcribing generally includes and adds intron etc. in Kozak sequence, mRNA cutting and tailing signal, mRNA shear signal and the expression cassette.The exemplary of transcribing rear adjusting is to add intron in expression cassette, and many studies have shown that adds the expression that introns help gene, and some introns have to be regulated sequence and can strengthen and transcribe and the termination procedure of 3 ' end.The reason of the raising genetic expression that the intron shearing table reveals may be the nuclear stability that promoted mRNA, the correct accurate location of processing and kytoplasm.Genetic transcription is need be transported to endochylema behind the mRNA further to process and protein translation, and this moment, stability and the effective location of mRNA or RNA-protein complex were very crucial.This process is mainly regulated and control by the controlling element of 3 ' non-translational region, 5 ' non-translational region and coding region.

WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element, woodchuck hepatitis virus post-transcriptional control sequence) comprise cis acting sequence, the 3 ' non-translational region that WPRE is inserted into gene can significantly improve the expression of this gene.WPRE can improve mRNA stability, helps the formation of RNA-albumen composition, and the new synthetic transcript of protection is not degraded, and is played a role to the transhipment of kytoplasm and position fixing process by karyon at mRNA.Especially effective for the gene that does not contain intron or the expression of the mRNA of shearing.The transgenosis that this expresses for reverse transcription or the protein expression that does not contain intron have important using value.

Summary of the invention

In order to make up more efficiently, filter out the engineering cell strain of high level expression target protein, the invention provides the complementary cotransfection highly effective eukaryon expression carrier of expressing of a kind of dhfr.

The complementary cotransfection carrier for expression of eukaryon of expressing of a kind of dhfr, it is characterized in that, in the pCI-neo plasmid, inserted respectively the matrix attachment region territory, woodchuck hepatitis virus post-transcriptional control sequence, ribosome entry site(RES) sequence, dhfr1-105aa gene fragment or dhfr106-187aa gene fragment.

Preferably, between adjacent two the restriction enzyme site SacII of pCI-neo plasmid and BglII, inserted the matrix attachment region territory; Inserted woodchuck hepatitis virus post-transcriptional control sequence between adjacent two the restriction enzyme site SalI of pCI-neo plasmid and NotI, nucleotide sequence is shown in SEQ ID NO.2; Inserted the ribosome entry site(RES) sequence between adjacent two the restriction enzyme site MluI of pCI-neo plasmid and XbaI, nucleotide sequence is shown in SEQ ID NO.6; Between adjacent two the restriction enzyme site XbaI of pCI-neo plasmid and SalI, dhfr1-105aa gene fragment or dhfr106-187aa gene fragment have been inserted, the nucleotide sequence of dhfr1-105aa gene fragment is shown in SEQ ID NO.3, and the nucleotide sequence of dhfr106-187aa gene fragment is shown in SEQ ID NO.4.

Preferably, 5 ' of above-mentioned dhfr1-105aa gene fragment and dhfr106-187aa gene fragment end is connected with the leucine zipper structure coding gene sequence; The nucleotide sequence of described coding leucine zipper structure is shown in SEQ ID NO.5.

Preferably, described matrix attachment region territory behaviour β-globin matrix attachment region territory, nucleotide sequence is shown in SEQ IDNO.1.

The preparation method of the complementary cotransfection carrier for expression of eukaryon of expressing of above-mentioned dhfr, step is as follows:

(1) with restriction enzyme SacII and BglII double digestion pCI-neo plasmid, inserts through the matrix attachment region territory of restriction enzyme SacII and BglII double digestion (MAR), make up plasmid pCIneo-M;

(2) the plasmid pCIneo-M that makes with restriction enzyme SalI and NotI double digestion step (1), insertion makes up plasmid pC Ineo-MW through the woodchuck hepatitis virus post-transcriptional control sequence (WPRE) of restriction enzyme SalI and NotI double digestion;

(3) the plasmid pCIneo-MW that makes with restriction enzyme MluI and XbaI double digestion step (2) inserts the ribosome entry site(RES) sequence (IRES) through restriction enzyme MluI and XbaI double digestion, makes up plasmid pCIneo-MWI;

(4) with restriction enzyme BglII and SalI double digestion dhfr1-105aa gene fragment or dhfr106-187aa gene fragment, with restriction enzyme BamHI and SalI double digestion leucine zipper structure coding gene sequence, make up LZ-dhfr (1-105aa) or LZ-dhfr (106-187aa);

(5) the plasmid pCIneo-MWI that makes with restriction enzyme XbaI and SalI double digestion step (3), insertion makes up cotransfection carrier for expression of eukaryon pCIneo-MWLD1 or cotransfection carrier for expression of eukaryon pCIneo-MWLD2 through the LZ-dhfr1-105aa gene fragment that makes up through step (4) of restriction enzyme XbaI and SalI double digestion or through the LZ-dhfr106-187aa gene fragment that makes up through step (4) of restriction enzyme XbaI and SalI double digestion.

The complementary cotransfection carrier for expression of eukaryon application in the high level expression target protein in eukaryotic cell expressed of above-mentioned dhfr.

Described target protein is one of immunoglobulin (Ig), domain-immunoglobulin fusion proteins, somatomedin, soluble receptors or blood Rh factor.

Above-mentioned application, step is as follows:

(1) gene fragment of usefulness restriction enzyme NheI and MluI double digestion coding target protein heavy chain, be inserted in the cotransfection carrier for expression of eukaryon pCIneo-MWLD1 of restriction enzyme NheI and MluI double digestion, get recombinant plasmid pCIneo-MHWLD1, gene fragment with restriction enzyme NheI and MluI double digestion coding target protein light chain, be inserted in the cotransfection carrier for expression of eukaryon pCIneo-MWLD2 of restriction enzyme NheI and MluI double digestion, get recombinant plasmid pCIneo-MLWLD2;

(2) the recombinant plasmid pCIneo-MHWLD1 and the recombinant plasmid pCIneo-MLWLD2 that step (1) are made up cultivate screening by the liposome mediated-method transfection CHO cell, detect expressing quantity with the ELISA method, take turns MTX through one and pressurize, screening obtains stablizing the cell strain of high-expression target proteins;

The cell strain of the high-expression target proteins stablized that (3) step (2) is made adopts the stirring type bioreactor feeding culture that suspends.

Preferably, the culture condition of suspension feeding culture is in the step (3): pH6.9～7.1,35 ℃～37 ℃ of temperature, dissolved oxygen 20%～60%, air air flow 0.01～0.2vvm, oxygen ventilation amount 0.01～0.2vvm, CO ₂Air flow 0.01～0.2vvm, osmotic pressure 290～500mOSM, lactic acid is 15～30% of total culture volume less than 5g/L, ammonia less than 10mmol/L, flow feeding culture volume.After testing, final target protein is expressed and can be reached 1.5-2g/L.

This area ordinary method is adopted in the liposome mediated-method transfection, and actual conditions is set can be referring to the Chinese hamster ovary celI product description; Flow feeding substratum those skilled in the art can set according to prior art and concrete working condition, also can select CellBoost4 (Hyclone company).

The present invention has overcome mammalian cell expression in the past, screening is wasted time and energy and the target protein expression level is low shortcoming, use carrier transfection CHO cell of the present invention, can obtain at short notice to stablize the monoclonal cell strain of high expression level antibody or fusion rotein, high expression level and the industrialization of recombinant protein had good using value.

Description of drawings

The complementary figure that expresses of Fig. 1 dhfr segmentation.

Fig. 2 (a) pCIneo-MWLD1 carrier figure schematic diagram.

Fig. 2 (b) pCIneo-MWLD2 carrier figure schematic diagram.

The HPLC detected result figure of Fig. 3 antibody expression expression amount.

The HPLC detected result figure of Fig. 4 fusion protein expression.

The HPLC detected result figure of antibody expression amount behind Fig. 5 purifying.

The HPLC detected result figure of Fig. 6 purifying rear fusion protein expression amount.

Embodiment

The present invention will be further described below in conjunction with embodiment, but institute of the present invention protection domain is not limited to this.

Coli strain among the embodiment, the Chinese hamster ovary celI strain is that the international standard strain is available from Invitrogen company, the PCR primer is synthetic to be finished by rich inferior biological company limited with sequencing, the T4 ligase enzyme, archaeal dna polymerase, restriction enzyme SacII, BglII, SalI, NotI, MluI, XbaI, BamHI, NheI, MluI is Promaga company product, plasmid extraction kit is the vast Imtech in Beijing product, it is GE company product that dna fragmentation reclaims test kit, carrier pCI-neo is available from Promega company, MARs, Leucine-Zipper, WPRE is synthetic by Bo Ya company, methotrexate (MTX) and pancreatin are given birth to worker Bioisystech Co., Ltd available from Shanghai, LIPOFECTAMINE 2000 transfection reagent boxes are available from Invitrogen company, the EXCELL-302 substratum is available from Sigma company, the DMEM substratum is available from Gibco company, dFBS dialysis foetal calf serum is available from Gibco company, and the flow feeding substratum is that Hyclone company produces Cell Boost4.The using method of various enzymes can be referring to the product description of this product among the embodiment, and the experimental technique of employing all adopts this area ordinary method if no special instructions.

Embodiment 1

The pCIneo-MWLD1 Vector construction

The preparation method of the complementary cotransfection carrier for expression of eukaryon of expressing of dhfr, step is as follows:

(1) with restriction enzyme SacII and BglII double digestion pCI-neo plasmid, insert people β through restriction enzyme SacII and BglII double digestion-globin matrix attachment region territory with the T4 ligase enzyme, make up plasmid pCIneo-M;

(2) the plasmid pCIneo-M that makes with restriction enzyme SalI and NotI double digestion step (1), with the woodchuck hepatitis virus post-transcriptional control sequence (WPRE) of T4 ligase enzyme insertion through restriction enzyme SalI and NotI double digestion, make up plasmid pCIneo-MW;

(3) the plasmid pCIneo-MW that makes with restriction enzyme MluI and XbaI double digestion step (2), with the ribosome entry site(RES) sequence (IRES) of T4 ligase enzyme insertion through restriction enzyme MluI and XbaI double digestion, make up plasmid pCIneo-MWI;

(4) pass through PCR method amplification dhfr1-105aa gene fragment take dhfr gene fragment (sequence is shown in SEQ ID NO.11) as template, the restriction enzyme site at the dhfr1-105aa gene fragment two ends that obtain is that (5 ' end primer is shown in SEQID NO.7 for BglII and SalI, 3 ' end primer is shown in SEQ ID NO.8, the PCR reaction conditions is: 94 ℃ of 60s, 56 ℃ of 30s, 72 ℃ of 60s, 30 circulations), with restriction enzyme BglII and SalI double digestion dhfr1-105aa gene fragment, with restriction enzyme BamHI and SalI double digestion leucine zipper structure coding gene sequence, connect by isocaudarner, make up LZ-dhfr (1-105aa) gene fragment;

(5) the plasmid pCIneo-MWI that makes with restriction enzyme XbaI and SalI double digestion step (3), with LZ-dhfr (1-105aa) gene fragment through step (4) structure of T4 ligase enzyme insertion through restriction enzyme XbaI and SalI double digestion, make up cotransfection carrier for expression of eukaryon pCIneo-MWLD1.

The cotransfection carrier for expression of eukaryon pCIneo-MWLD1 that obtains through aforesaid method has inserted people β-globin matrix attachment region territory between adjacent two the restriction enzyme site SacII of pCI-neo plasmid and BglII, nucleotide sequence is shown in SEQIDNO.1; Inserted woodchuck hepatitis virus post-transcriptional control sequence between adjacent two the restriction enzyme site SalI of pCI-neo plasmid and NotI, nucleotide sequence is shown in SEQ ID NO.2; Inserted the ribosome entry site(RES) sequence between adjacent two the restriction enzyme site MluI of pCI-neo plasmid and XbaI, nucleotide sequence is shown in SEQ ID NO.6; Inserted the dhfr1-105aa gene fragment between adjacent two the restriction enzyme site XbaI of pCI-neo plasmid and SalI, the nucleotide sequence of dhfr1-105aa gene fragment is shown in SEQ ID NO.3; 5 ' end of dhfr1-105aa gene fragment is connected with the leucine zipper structure coding gene sequence, and nucleotide sequence is shown in SEQ ID NO.5.

The pCIneo-MWLD2 Vector construction

(4) pass through PCR method amplification dhfr106-187aa gene fragment take dhfr gene fragment (sequence is shown in SEQID NO.11) as template, the restriction enzyme site at the dhfr106-187aa gene fragment two ends that obtain is that (5 ' end primer is shown in SEQ ID NO.9 for BglII and SalI, 3 ' end primer is shown in SEQ ID NO.10, the PCR reaction conditions is: 94 ℃ of 60s, 56 ℃ of 30s, 72 ℃ of 60s, 30 circulations), with restriction enzyme BglII and SalII double digestion dhfr106-187aa gene fragment, with restriction enzyme BamHI and SalII double digestion leucine zipper structure coding gene sequence, make up LZ-dhfr (106-187aa); Restriction enzyme BglII and BamHI are isocaudarner, and isocaudarner refers to cut different dna fragmentations but produces a class restriction enzyme of identical sticky end, and it can be joined to one another by the complementary action between its sticky end;

(5) the plasmid pCIneo-MWI that makes with restriction enzyme XbaI and SalI double digestion step (3), with the LZ-dhfr106-187aa gene fragment through step (4) structure of T4 ligase enzyme insertion through restriction enzyme XbaI and SalI double digestion, make up cotransfection carrier for expression of eukaryon pPCIneo-MWLD1 or cotransfection carrier for expression of eukaryon pCIneo-MWLD2.

The cotransfection carrier for expression of eukaryon pCIneo-MWLD2 that obtains through aforesaid method has inserted people β-globin matrix attachment region territory between adjacent two the restriction enzyme site SacII of pCI-neo plasmid and BglII, nucleotide sequence is shown in SEQ IDNO.1; Inserted woodchuck hepatitis virus post-transcriptional control sequence between adjacent two the restriction enzyme site SalI of pCI-neo plasmid and NotI, nucleotide sequence is shown in SEQ ID NO.2; Inserted the ribosome entry site(RES) sequence between adjacent two the restriction enzyme site MluI of pCI-neo plasmid and XbaI, nucleotide sequence is shown in SEQ ID NO.6; Between adjacent two the restriction enzyme site XbaI of pCI-neo plasmid and SalI, inserted the dhfr106-187aa gene fragment, the nucleotide sequence of dhfr106-187aa gene fragment is shown in SEQ ID NO.4, and 5 ' end of above-mentioned dhfr106-187aa gene fragment is connected with the leucine zipper structure coding gene sequence; Nucleotide sequence is shown in SEQ ID NO.5.

Embodiment 2

Express the complementary Vector construction of monoclonal antibody

With restriction enzyme NheI and MluI the encode gene fragment (SEQ ID NO.13) of monoclonal antibody light chain of the gene fragment (SEQ IDNO.12) of monoclonal antibody heavy chain of anti-EGFR2 and EGFR2 of double digestion respectively, be inserted into respectively in the cotransfection carrier for expression of eukaryon pCIneo-MWLD1 and pCIneo-MWLD2 of restriction enzyme NheI and MluI double digestion, make up recombinant plasmid pCIneo-MHWLD1 and the pCIneo-MLWLD2 of two complementations.

The complementary Vector construction of domain-immunoglobulin fusion proteins

Gene fragment (SEQIDNO.14) with restriction enzyme NheI and MluI difference double digestion coding TNFR:Fc fusion rotein, be inserted into respectively in the cotransfection carrier for expression of eukaryon pCIneo-MWLD1 and pCIneo-MWLD2 of restriction enzyme NheI and MluI double digestion, make up recombinant plasmid pCIneo-MTWLD1 and the pCIneo-MTWLD2 of two complementations.

Embodiment 3

(1), complementary eukaryotic expression plasmid pCI neo-MHWLD1 and the pCIneo-MLWLD2 screening engineering cell strain of expressing of cotransfection

1, cell cultures, transfection

Transfection the day before yesterday, with trysinization Chinese hamster ovary celI and counting, Chinese hamster ovary celI bed board 6 orifice plates, make its transfection day density reach 90% degree of converging.The Chinese hamster ovary celI bed board is containing serum, does not contain in the antibiotic DMEM substratum.For every hole Chinese hamster ovary celI, use the OPTI-MEM I substratum of 250 μ l to dilute pCIneo-MHWLD1 and the pCIneo-MLWLD2 plasmid that makes up among the 5 μ g embodiment 2; For every hole Chinese hamster ovary celI, use 250 μ l OPTI-MEM I substratum to dilute 10 μ l LIPOFECTAMINE, 2000 reagent.The LIPOFECTAMINE 2000 of dilution mixes with pCIneo-MHWLD1 and the pCIneo-MLWLD2 plasmid of dilution in 30 minutes, mixed solution room temperature insulation 20 minutes.Mixture is joined in every hole wave and culture plate, gently mixing.At 37 ℃, 5% CO ₂Cultivate in the incubator and change the DMEM substratum after 4-5 hour, be incubated 24 hours.

2, mono-clonal and subclone screening

Sampling in 24 hours detects expression after the transfection, select expression amount high, the good transfection hole of cell state merges after with trysinization, is inoculated in 10 96 orifice plates, the every hole of 96 orifice plates adds 200ul methotrexate (MTX) and carries out taking turns the pressurization screening, and the final concentration of MTX is 50uM.Leave standstill to cultivate and two to three weeks treated that clonal cell line grew.Change the liquid suction after the clonal cell line of survival is grown and beat, ELISA detects 24 hours expression amounts of each clonal cell line and carries out 96 hole scalpings.Select the high clonal cell line of expression amount and move into 24 holes amplifications and go down to posterity, ELISA detects 24 hours expression amounts of each clonal cell line and carries out 24 hole scalpings.When selecting the quantitative high-expression clone cell strain amplification in 24 holes liquid nitrogen cryopreservation conservation, carry out subclone (1cells/ hole).

The clonal cell line of the high expression level counting of taking a sample after trysinization adopts the DMEM substratum to carry out subclone, 4 96 orifice plates of every kind of cell strain clone, 60 holes of inoculation on every 96 orifice plates, 1 cell in every hole; Behind the counting, the first step is diluted 100 times with the DMEM substratum; Second step is diluted to 5cells/ml with the DMEM substratum, each hole inoculation 200ul enchylema behind the mixing; Hole all around adds sterilized water.Measure expression amount: when the full hole of the tiling of the cell in the hole, change to the 200ulDMEM substratum, sampling and measuring expression amount behind the 24h.Change 24 orifice plates over to and carry out follow-up quantitative evaluation if the expression amount of measuring then keeps greater than 3ug/ml.Quantitative assay expression amount: after the clone in 24 orifice plates is paved with at the bottom of the hole, with 1 * 10 ⁵The cells/ml mensuration expression amount that quantitatively goes down to posterity according to quantitative result, is therefrom selected the high-expression clone cell strain and is changed 6 orifice plates over to and increase.According to cell strain detection by quantitative result and growing state, select suitable clonal cell line to carry out the suspension culture domestication.

See Table 1 through each stage the selection result of expression monoclonal antibody subclone of taking turns the MTX pressurization:

Table 1 one is taken turns the rear subclone stage the selection result of expressing monoclonal antibody of MTX pressurization

3, serum-free suspends and tames

Amplification high-expression clone cell strain is to the T175 square vase, culture system is that 25% (92%DMEM+8%dFBS) substratum+75%EXCELL-302 substratum (volume percent) mixes, after the T175 square vase covers with, in slight digest amplification to the two T175 square vase, the ratio of (92%DMEM+8%dFBS) substratum in the culture system is reduced to 10% by 25%, the ratio of EXCELL-302 substratum is increased to 90%, leaves standstill a cultivation generation.Until the cell floating cell of rear collection that gets up of growing in 10% (DMEM+8%dFBS) substratum+90%EXCELL-302 substratum, the digestion attached cell is to be not less than 3 * 10 ⁵The inoculum density of cells/ml changes the 100%EXCELL-302 substratum over to and leaves standstill cultivation.Per three to four days centrifugal going down to posterity once can be removed by the mode of natural subsidence if agglomerate occurs.Continuous passage three generations to five is during generation, and cell is with 3 * 10 ⁵The inoculation of cells/ml density, density reached 10 in three days ⁶When cells/ml is above, namely carry out the suspension culture domestication.

Cell is collected floating cell after the square vase the inside adapts to the serum-free culture state fully, to be not less than 3 * 10 ⁵The inoculum density of cells/ml changes shake-flask culture over to.Per three to four days centrifugal going down to posterity once can be removed by the mode of natural subsidence if agglomerate occurs.Cell is with 3 * 10 ⁵The inoculation of cells/ml density, the cell density of cultivating three days can reach 10 ⁶More than the cells/ml, pass continuously 3 generations all can stable growth and cell single evenly, this moment, cell adapted to serum-free suspension culture, liquid nitrogen cryopreservation fully.

4, stability experiment

Investigate cell go down to posterity and amplification procedure in the expression stability of monoclonal antibody.

The cell of recovery liquid nitrogen cryopreservation, a renewal cultivation generation.Then with cell strain with 3 * 10 ⁵The cell density of cells/ml is inoculated in the 100ml shaking flask, and culture volume is 30ml, and shaking flask is put into CO ₂Cultivate on the shaking table, rotating speed is 100rpm; Went down to posterity once in per three days, the front sampling counting that goes down to posterity calculates cell density and cell viability.Add in the proper ratio the EXCELL-302 substratum to final volume 30ml according to the cell density before going down to posterity, make cell density return to 3 * 10 ⁵Cells/ml; Get supernatant after sample is centrifugal and detect expression amount, 24 monoclonal antibodies of continuous passage are expressed stable.

The expression of continuous passage monoclonal antibody sees Table 2:

The monoclonal antibody expression amount of table 2 continuous passage

Passage number	Target protein expression amount (ug/ml)	Passage number	Target protein expression amount (ug/ml)
				1	157.8	13	154.9
2	149.0	14	152.1
				3	145.2	15	162.0
4	150.7	16	153.2
				5	156.1	17	153.1
6	153.9	18	150.8
				7	148.2	19	145
8	151.1	20	151.9
				9	159.7	21	158.9
10	156.2	22	151.0
				11	145.2	23	157
12	159.2	24	154

(2), engineering cell strain feeding culture fermentation

Adopting the mode of feeding culture to carry out single antizymotic technical process comprises: seed recovery, cell spread cultivation, cell fermentation, the centrifugal collection of culture supernatant and the purifying of target protein.Concrete steps are as follows:

1, cell recovery spreads cultivation

The cell recovery method is taken out a cell strain and is put into rapidly multiple melting in 37 ℃ of warm water routinely; Cell suspension is moved to centrifuge tube, add the EXCELL-302 substratum 9ml of 37 ℃ of preheatings, the centrifugal 5min of 800rpm abandons supernatant.The EXCELL-302 substratum 10ml that adds 37 ℃ of fresh preheatings in the cell precipitation, gently after the piping and druming, move into and be equipped with in the 250ml shaking flask of 50ml EXCELL-302 substratum, mix rear obtained cell suspension 0.5ml, carry out cell counting and cell viability and calculate.After sampling is finished, change shaking flask over to shaking table, adjusting rotary speed is 100rpm, in 5%CO ₂, cultivated 72 hours in 37 ℃ of constant-temperature tables.

Carry out the monitoring of cell density and cytoactive every day, goes down to posterity behind the 72hr, and the centrifugal 5min of 800rpm abandons supernatant, adds the substratum that spreads cultivation of fresh 37 ℃ of preheatings in the precipitation, makes cell density reach 3 * 10 ⁵More than/the ml, the enlarged culturing volume continues the inoculation rolling bottle, carries out by that analogy the passage amplification.In the cell amplification process, amplification culture container step by step is when total cellular score reaches 1 * 10 ⁹When individual, transfer to and proceed seed cell cultivation amplification in the 5.0L fermentor tank.Total cellular score reaches 1 * 10 in the 5.0L fermentor tank ¹⁰The time, can as the seed cell of 20L fermentor tank, carry out fermentor tank inoculation and production.

2, fermentation

Seed liquor is moved into the aseptic inoculation bottle from shaking flask in aseptic super clean bench; Connect inoculation bottle and fermentor tank inoculation mouth, by air positive pressure seed liquor is pressed into fermentor tank, the fermentor tank model is B.Braun Biostat B 20L.According to the mammalian cell growth characteristics, selecting culture temperature is 35 ℃～37 ℃, and pH selects and CO ₂And NaHCO ₃Coupling, scope control in pH6.9～7.1, dissolved oxygen is selected and O ₂Coupling, scope control neither make the growth metabolism of cell be hindered 20%～60%, avoid again the too high toxicity that causes of oxyty to suppress cellular metabolism; Bottom ventilation is selected air air flow 0.01～0.2vvm, oxygen ventilation amount 0.01～0.2vvm, CO ₂Air flow 0.01～0.2vvm; Stirring is in order to make whole nutrient solutions and suspension cell in the fermentor tank reach the homogeneous degree, reaches best material transfer effect, and promotes heat exchange.Mixing speed is excessively low, will not reach Blending Efficiency of Blending, and mixing speed is too high, can produce larger shearing force again, causes cell injury.According to the design variable of tank body and stirring arm, select mixing speed 75rpm.For making cell keep for a long time higher vigor, osmotic pressure should maintain in the scope of 290～500mOSM in the fermenting process, lactic acid concn less than 5g/L, ammonia concentration less than 10mmol/L.

When Growth of Cells to plateau, the cell density increase is no longer obvious, Growth of Cells and death reach a kind of running balance, and target protein keeps higher expression level, keeps cell cultures approximately 14 days by the adjusting of adding the culture parameters such as strategy that this area crowds such as glucose and feed supplement (flow feeding culture volume be total culture volume 15～30%) know and pH value, temperature, dissolved oxygen.Along with the increase of apoptosis quantity, plateau balance be broken, dead cell increases gradually, when the viable count in the fermentor tank was lower than 50%, significantly descending appearred in expressing quantity, stop cell cultures and receive liquid this moment.The detection of antibody expression amount uses Protein A post to detect through HPLC, and expressing quantity reached 2g/L in 14 days.Fermentation results sees Table 3.Detected result is seen accompanying drawing 3.

Table 3 monoclonal antibody fermentation results

Time (my god)	Protein expression (mg/l)	Viable cell density (x10 ⁶cells/mL)	Cell viability (%)
				0.00		0.73	95
1.00	88.3	0.81	97
				2.00	158.86	1.37	98.5
3.00	242.65	2.82	99.1
				4.00	424.55	4.22	98.9
5.00	561.42	4.65	98.3
				6.00	783.54	5.07	98.1
7.00	1014.62	5.87	97.6
				8.00	1369.74	5.27	97.5
9.00	1716.86	5.52	94.2
				10.00	1819.45	4.57	92.1
11.00	1900.78	3.78	88.5
				12.00	1990.69	3.13	83.1
13.00	2051.02	2.74	75.2
				14.00	2063.56	1.89	68.8

3, purification assays

Main means of purification in the separation purifying technique is to utilize at present extensively to adopt in the world, the production for treating rProtein A affinity gel of antibody protein, and this affinity gel can be combined with IgG1Fc section protein-specific.Adopt commercial rProteinA Sepharose ^TMFast Flow filler (Amsham Bioscience provides) carries out preliminary purification to nutrient solution, can remove most of impurity and cellular metabolism by product in the substratum by this preliminary purification, obtains purity greater than 90% target protein.Then utilize the physics and chemistry characteristics of target protein, select ion exchange chromatography twice, remove the albumin A of a small amount of impurity and minimal residue, finish again the purifying of antibody through ultrafiltration.Molecular sieve column is used in the detection of antibody purification, and detected result is seen accompanying drawing 4.

Embodiment 4

(1), complementary eukaryotic expression plasmid pCI neo-MTWLD1 and the pCIneo-MTWLD2 screening engineering cell strain of expressing of cotransfection

1, cell cultures, transfection

Transfection the day before yesterday, with trypsin digestion cell and counting, cell bed board, make its transfection day density reach 90% degree of converging.The cell bed board is containing serum, does not contain in the antibiotic DMEM substratum.For every porocyte, use the OPTI-MEM of 250 μ l

The I substratum dilutes pCIneo-MTWLD1 and the pCIneo-MTWLD2 plasmid that makes up among the 5 μ g embodiment 2; For every porocyte, use 250 μ l OPTI-MEM I substratum to dilute 10 μ l LIPOFECTAMINE, 2000 reagent.The LIPOFECTAMINE 2000 of dilution mixes with pCIneo-MTWLD1 and the pCIneo-MTWLD2 plasmid of dilution in 30 minutes, mixed solution room temperature insulation 20 minutes.Mixture is joined in every hole wave and culture plate, gently mixing.At 37 ℃, 5% CO ₂Cultivate after 4-5 hour in the incubator and change growth medium, be incubated 24 hours.

2, mono-clonal and subclone screening

Step is with embodiment 3.

See Table 4 through each stage the selection result of subclone of taking turns the domain-immunoglobulin fusion proteins of MTX pressurization:

Table 4 one is taken turns the rear subclone stage the selection result of expressing domain-immunoglobulin fusion proteins of MTX pressurization

3, serum-free suspends and tames

Step is with embodiment 3.

4, stability experiment

Step is with embodiment 3.

The expression of continuous passage domain-immunoglobulin fusion proteins sees Table 5:

The domain-immunoglobulin fusion proteins expression amount of table 5 continuous passage

Passage number	Target protein expression amount (ug/ml)	Passage number	Target protein expression amount (ug/ml)
				1	125.2	13	126.5
2	129.1	14	132.0
				3	126.3	15	131.7
4	121.7	16	124.1
				5	128.2	17	128.2
6	118.6	18	131.4
				7	118.3	19	123.8
8	122.2	20	127.1
				9	126.5	21	122.8
10	124.5	22	118.3

11	122.3	23	121.6
				12	117.6	24	122.8

(2), engineering cell strain feeding culture fermentation

Adopting the mode of feeding culture to carry out single antizymotic technical process comprises: seed recovery, cell spread cultivation, cell fermentation, the centrifugal collection of culture supernatant and the purifying of target protein.Concrete steps are with embodiment 3.

The detection of fusion protein expression uses Protein A post to detect through HPLC, and expressing quantity reached 1.5g/L in 14 days.Fermentation results sees Table 6, and detected result is seen accompanying drawing 5.

Table 6 fusion rotein fermentation results

Time (my god)	Protein expression (mg/l)	Viable cell density (x10 ⁶cells/mL)	Cell viability (%)
				0.00		0.37	99
1.00	38	0.48	98.5
				2.00	86	1	98
3.00	137	2.8	99
				4.00	205	3.9	99
5.00	277	4.85	99
				6.00	381	6.5	98
7.00	550	6.7	99.2
				8.00	791	6.6	99
9.00	983	6.5	98.5
				10.00	1150	6.3	96.9
11.00	1254	6.0	95
				12.00	1346	5.5	92.7
13.00	1457	5.1	88.9
				14.00	1512	4.6	84.7

Molecular sieve column is used in the detection of purified fusion protein, and detected result is seen accompanying drawing 6.

SEQUENCE LISTING

＜110〉Qilu Pharmaceutical Co., Ltd.

＜120〉complementary cotransfection carrier for expression of eukaryon of expressing of a kind of dhfr and preparation method thereof and application

<160>14

<170>PatentIn version 3.5

<210>1

<211>3020

<212>DNA

＜213〉people

<400>1

gaatccgcgg aagcttctga caaattattc ttcctcttta ggttctcctt tatggaatct 60

tctgtactga tggccatgtc ctttaactac tatgtagata tctgctacta cctgtattat 120

gcctctacct ttattagcag agttatctgt actgttggca tgacaatcat ttgttaatat 180

gacttgcctt tcctttttct gctattcttg atcaaatggc tcctctttct tgctcctctc 240

atttctcctg ccttcacttg gacgtgcttc acgtagtctg tgcttatgac tggattaaaa 300

attgatatgg acttatccta atgttgttcg tcataatatg ggttttatgg tccattatta 360

tttcctatgc attgatctgg agaaggcttc aatcctttta ctctttgtgg aaaatatctg 420

taaaccttct ggttcactct gctatagcaa tttcagttta ggctagtaag catgaggatg 480

cctccttctc tgatttttcc cacagtctgt tggtcacaga ataacctgag tgattactga 540

tgaaagagtg agaatgttat tgatagtcac aatgacaaaa aacaaacaac tacagtcaaa 600

atgtttctct ttttattagt ggttatattt cctgacctat atctggcagg actctttaga 660

gaggtagctg aagctgctgt tatgaccact agagggaaga agatacctgt ggagctaatg 720

gtccaagatg gtggagcccc aagcaaggaa gttgttaagg agcccttttg attgaaggtg 780

ggtgccccca ccttacaggg acaggacatc tggatactcc tcccagtttc tccagtttcc 840

ctttttccta atatatctcc tgataaaatg tctatactca cttccccatt tctaataata 900

aagcaaaggc tagttagtaa gacatcacct tgcattttga aaatgccata gactttcaaa 960

attatttcat acatcggtct ttctttattt caagagtcca gaaatggcaa cattaccttt 1020

gattcaatgt aatggaaaga gctctttcaa gagacagaga aaagaataat ttaatttctt 1080

tccccacacc tccttccctg tctcttaccc tatcttcctt ccttctaccc tccccatttc 1140

tctctctcat ttctcagaag tatattttga aaggattcat agcagacagc taaggctggt 1200

tttttctaag tgaagaagtg atattgagaa ggtagggttg catgagccct ttcagttttt 1260

tagtttatat acatctgtat tgttagaatg ttttataata taaataaaat tatttctcag 1320

ttatatacta gctatgtaac ctgtggatat ttccttaagt attacaagct atacttaact 1380

cacttggaaa actcaaataa atacctgctt catagttatt aataaggatt aagtgagata 1440

atgccctata agattcctat taataacaga taaatacata cacacacaca cacattgaaa 1500

ggattcttac tttgtgctag gaactataat aagttcattg atgcattata tcattaagtt 1560

ctaatttcaa cactagaagg caggtattat ctaaatttca tactggatac ctccaaactc 1620

ataaagataa ttaaattgcc ttttgtcata tatttattca aaagggtaac tcaaactatg 1680

gcttgtctaattttatatat caccctactg aacatgaccc tattgtgata ttttataaaa 1740

ttatctcaag ttattatgag gatgttgaaa gacagagagg atgggtgcta tgccccaaat 1800

cagcctcaca attaagctaa gcagctaaga gtcttgcagg gtagtgtagg gaccacaggg 1860

ttaagggggc agtagaatta tactcccact ttagtttcat ttcaaacaat ccatacacac 1920

acagccctga gcacttacaa attatactac gctctatact ttttgtttaa atgtataaat 1980

aagtggatga aagaatagat agatagacag atagatgata gatagaataa atgcttgcct 2040

tcatagctgt ctccctacct tgttcaaaat gttcctgtcc agaccaaagt accttgcctt 2100

cacttaagta atcaattcct aggttatatt ctgatgtcaa aggaagtcaa aagatgtgaa 2160

aaacaatttc tgacccacaa ctcatgcttt gtagatgact agatcaaaaa atttcagcca 2220

tatcttaaca gtgagtgaac aggaaatctc ctcttttccc tacatctgag atcccagctt 2280

ctaagacctt caattctcac tcttgatgca acagaccttg gaagtataca ggagagctga 2340

acttggtcaa caaaggagaa aagtttgttg gcctccaaag gcacagctca aacttttcaa 2400

gccttctcta atcttaaagg taaacaaggg tctcatttct ttgagaactt cagggaaaat 2460

agacaaggac ttgcctggtg cttttggtag gggagcttgc actttccccc tttctggagg 2520

aaatatttat ccccaggtag ttcccttttt gcaccagtgg ttctttgaag agacttccac 2580

ctgggaacag ttaaacagca actacagggc cttgaactgc acactttcag tccggtcctc 2640

acagttgaaa agacctaagc ttgtgcctga tttaagcctt tttggtcata aaacattgaa 2700

ttctaatctc cctctcaacc ctacagtcac ccatttggta tattaaagat gtgttgtcta 2760

ctgtctagta tccctcaagc agtgtcagga attagtcatt taaatagtct gcaagccagg 2820

agtggtggct catgtctgta attccagcac ttgagaggta gaagtgggag gactgcttga 2880

gctcaagagt ttgatattat cctggacaac atagcaagac ctcgtctcta cttaaaaaaa 2940

aaaaattagc caggcatgtg atgtacacct gtagtcccag ctactcagga ggccgaaatg 3000

ggaggaccgg tagatctgac 3020

<210>2

<211>623

<212>DNA

<213>Woodchuck hepatitis virus

<400>2

gactctagag tcgacaatca acctctggat tacaaaattt gtgaaagatt gactggtatt 60

cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc tttgtatcat 120

gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg gttgctgtct 180

ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tggtgtgcac tgtgtttgct 240

gacgcaaccc ccactggttg gggcattgcc accacctgtc agctcctttc cgggactttc 300

gctttccccc tccctattgc cacggcggaa ctcatcgccg cctgccttgc ccgctgctgg 360

acaggggctc ggctgttggg cactgacaat tccgtggtgt tgtcggggaa gctgacgtcc 420

tttccatggc tgctcgcctg tgttgccacc tggattctgc gcgggacgtc cttctgctac 480

gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg gcctgctgcc ggctctgcgg 540

cctcttccgc gtcttcgcct tcgccctcag acgagtcgga tctccctttg ggccgcctcc 600

ccgcctggcg gccgcttaag gac 623

<210>3

<211>318

<212>DNA

＜213〉synthetic

<400>3

atggttcgac cgctgaactg catcgtcgcc gtgtcccaga atatgggcat cggcaagaac 60

ggagaccttc cctggccaat gctcaggaac gaattcaagt acttccaaag aatgaccacc 120

acctcctcag tggaaggtaa acagaacctg gtgattatgg gccggaaaac ctggttctcc 180

attcctgaga agaatcgacc tttaaaggac agaattaata tagttctcag tagagagctc 240

aaggaaccac cacaaggagc tcattttctt gccaaaagtc tggacgatgc cttaaaactt 300

attgaacaac cagagtaa 318

<210>4

<211>249

<212>DNA

＜213〉synthetic

<400>4

ttagcagata aagtggacat ggtttggata gttggaggca gttccgttta caaggaagcc 60

atgaatcagc caggccatct cagactcttt gtgacaagga tcatgcagga atttgaaagt 120

gacacgttct tcccagaaat tgatttggag aaatataaac ttctcccaga gtacccaggg 180

gtcctttctg aagtccagga ggaaaaaggc atcaagtata aatttgaagt ctatgagaag 240

aaaggctaa 249

<210>5

<211>144

<212>DNA

＜213〉synthetic

<400>5

tctagaatgt ctgacagaat gaaacagctg gaaacgaagg ttgaagaact gctgtccaaa 60

aattatcacc tggaaaatga ggttgccaga ctgaagaaac tggttggcga acgcggcagg 120

ggtggctctg gcggtggcgg atcccgggccc gtcgac 156

<210>6

<211>719

<212>DNA

＜213〉synthetic

<400>6

cgccctctcc gaattccgcc ctctccctcc ccccccccta acgttactgg ccgaagccgc 60

ttggaataag gccggtgtgc gtttgtctat atgttatttt ccaccatatt gccgtctttt 120

ggcaatgtga gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt 180

tcccctctcg ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg 240

gaagcttctt gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca 300

cctggcgaca ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg 360

gcacaacccc agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc 420

tcaagcgtat tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggatct 480

gatctggggc ctcggtgcac atgctttaca tgtgtttagt cgaggttaaa aaacgtctag 540

gccccccgaa ccacggggac gtggttttcc tttgaaaaac acgatgataa gcttgccaca 600

accatggaga aaaaaatcac tggatatacc accgttgata tatcccaatg gcatcgtaaa 660

gaacattttg aggcatttca gtcagttgct caatgtacct ataaccagac cgttcagcc 719

<210>7

<211>28

<212>DNA

＜213〉synthetic

<400>7

gcagatctat ggttcgaccg ctgaactg 28

<210>8

<211>41

<212>DNA

＜213〉synthetic

<400>8

gatgcggccg cgtcgactta ctctggttgt tcaataagtt t 41

<210>9

<211>29

<212>DNA

＜213〉synthetic

<400>9

gcagatcttt agcagataaa gtggacatg 29

<210>10

<211>38

<212>DNA

＜213〉synthetic

<400>10

gatgcggccg cgtcgactta gcctttcttc tcatagac 38

<210>11

<211>564

<212>DNA

＜213〉synthetic

<400>11

atggttcgac cgctgaactg catcgtcgcc gtgtcccaga atatgggcat cggcaagaac 60

ggagaccttc cctggccaat gctcaggaac gaattcaagt acttccaaag aatgaccacc 120

acctcctcag tggaaggtaa acagaacctg gtgattatgg gccggaaaac ctggttctcc 180

attcctgaga agaatcgacc tttaaaggac agaattaata tagttctcag tagagagctc 240

aaggaaccac cacaaggagc tcattttctt gccaaaagtc tggacgatgc cttaaaactt 300

attgaacaac cagagttagc agataaagtg gacatggttt ggatagttgg aggcagttcc 360

gtttacaagg aagccatgaa tcagccaggc catctcagac tctttgtgac aaggatcatg 420

caggaatttg aaagtgacac gttcttccca gaaattgatt tggagaaata taaacttctc 480

ccagagtacc caggggtcct ttctgaagtc caggaggaaa aaggcatcaa gtataaattt 540

gaagtctatg agaagaaagg ctaa 564

<210>12

<211>1416

<212>DNA

＜213〉synthetic

<400>12

atgaagcatc tgtggttctt cctgctgatg gtggccaccc ccagatgggt gctgagcgtg 60

gatcagctgg tggtgagcgg cggcggcgag gtgcagcccg gcggcagcct gagactgcgc 120

tgcgccgtca gcggcttcaa catcgaggac acgtatatcc actggctgcg gcagcccccc 180

ggcaagggcc tggaatgggt gggcagactc taccccgcca acggctatac cagatacgcc 240

gacagcgtga agggcagatt cgccatcatc gccgacacca gcaagaacac cgcctacctg 300

caaatgaact ccctgagagc cgataacgcc gccgtgtact actgttctcg ctggggaggc 360

gacggcttct acgctatgga ctattggggc cagggcaccc tggtgaccgt gtccagcgcc 420

agcaccaagg gccccagcgt gttcccccag gccccctcct ccaaatccac ctccggcggc 480

accgccgccc tgggctgcct ggagacggac tacttccccg agcccgtgac cgtgtcctgg 540

aacagcggcg ccctgaccag cggcgtgcat accttccccg ccgtcctgca atcctccggc 600

ctgtactccc tgagcagcgt ggtgacagtg cccagcagca gcctgggcac cctgagctac 660

atctgcaacg tgaaccataa gcccacgatc accaaggtcg acaagaaagt ggagcccaag 720

agctgcgaca agacccatac ctgccccccc tgccccgccc ccgagctgct gggaggcccc 780

agcgtgttcc tgttcccccc taaacccaag gacaccctga tgatcagcag aacccccgag 840

gtgacatgcg tggtggtgga cgagtcccag gaggaccccg aagtcaagtt caactggtac 900

gtggacggcg tggaggtgca taatgccaag accaagccca gagaggagca gtacaacagc 960

acctaccggg tggtgtccgt gctgaccgtg ctgcaccaag actggctgaa cagcaacgag 1020

tacaagtgca aggtgtccaa caaggccctg cccgccccca tcgagaagac catcagcacg 1080

gccaagggcc agcccagaga gcctcagggc tacaccctgc ccccctcccg ggacgagctg 1140

accaagaacc aggtgtccct gacctgcctg gtgaaaggct tctacccctc cgacatcccc 1200

gtggagtggg agagcaacgg ccagcccgag aacaactaca agaccacccc ccccgagctg 1260

gacagcgacg gcagcttctt ccagtattcc aaactgaccg tggacaagag cagatggcag 1320

cagggcaacg tgttcagctg ctccgtgatg catgaggccc tgcataacca ttacacccag 1380

aagagcctga gcctgagccc cggcaagtag acgcgt 1416

<210>13

<211>711

<212>DNA

＜213〉synthetic

<400>13

atggaggccc ctgcccagct gcagttccag ctgctgctgt ggctgcccga ccccacaggc 60

gacatccaga tgacccagag ccccagatcc ctgtccgcct ctgtgggcga tagagagacc 120

atcacctgcc gggccagcca agacgtggac agcgccgtgg cctggtatca gcaaaagccc 180

ggcaaggccc ccaagctgct ggtctattcc gcctccttcc tgtactcccg cgcgccctcc 240

cggttctccg gctcccggtc cgacaccgac ttcaccctga ccgtctcctc cctgcaaccc 300

gaggacttcg ccacctacta ctgccagcaa cattacacca ccccccccac ctacggacaa 360

ggcaccaaag tggagatcaa gagcaccctg gccgccgcct ccgtgttcat cttccccccc 420

tccgacgagc agctgaagag cggcaccccc tccgtcgtgt gcctgctgaa caacttctac 480

ccccgggagg ccaaagtgca gtggaagctg gacaacgccc tgcagagcgg caacagccag 540

gagagcgtga ccgagcagga ccgcgaggac agccccgaca gcctgagcag caccctgacc 600

ctgagcaagg ccgactacga ggagcataac gtgtacgcct gcgaggtgac acatcagggc 660

ctgagcagcc ccgtgaccaa gagcttcaac agaggcgagt gctagacgcg t 711

<210>14

<211>1470

<212>DNA

＜213〉synthetic

<400>14

atggcccctg tggctgtgtg gtctactctg gccgtgggac tggaactgtg gcccactgct 60

cacgccctgc ctgcccagct gcccttcgcc ccttatgccc ctgagcctag ctccacctgc 120

aggctgcggg agtactacga ccagaccgcc cagatgtgca gctccgagtg ctctcctggc 180

caggacgcca aggtgttctg tgccgagacc tccgacaccg tgtgccacgc ttgcgaggac 240

tccacctaca cccagctgtg gcacagggtg ccccagtgcc tgtcctgcgg ctccagatgt 300

tcctccgacc aggtggagac acaggcctgc acacgggagc agaatcggat ctgcacctgc 360

aggcctggct ggtactgcgc catggccaag caggaaggct gcaggatcag cgcccctctg 420

aggaagtgca gacctggctt cagcgtggct aggcctggca ccgagccatc cgacgtggtg 480

tgcaagcctt gcgcccctgg caccatctcc aacaccacct tctccaccga cctctgccgg 540

cctcatcaga tttgcaacgt gctgaccgtc cctggcaacg cctccatgga ccccctgtgc 600

acatctacct cccccaccag atctctgccc cctggcgccg tgcacctgcc tgagcctgtg 660

tccacccggt cccagcatac ccagcctaca cctgagccct ctaccgcccc ttctacctcc 720

ttcctgctgc ctatgggccc tgctcctcct gctgagggct ctaccggcga cgagcctaag 780

tcctgcgaca agacccacac ctgcccccca tgtcctgctc cagaactgct gggcggtcct 840

tccgtgttcc tgttccctcc tgagcctaag gacaccctga tgatctcccg gacccctgaa 900

gtgacctgcg tggtggtgga cgtgtcccac gaggatcctg aagtgaagtt caattggtac 960

gtggacggcg tggaggtgca cgacgccaag accaagcctc gggaggaaca gtacaactct 1020

acctaccggg tggtgtccgt gctgaccgtg ctgcaccagg actggctgaa ccccaaagaa 1080

tacaagtgca aggtgtccaa caaccccctg ccagccccta tcgaaaagac catctccaag 1140

gccaagggcc agactcggca acctcaggtg tacaccctgc ctcctagccg ggaagagatg 1200

accaagaacc aggtgtccct ggcccgcctg gtgaagggct tctacccttc cgatatcgcc 1260

gtggagtggg agtctaacgg ccagcctgag aacaactaca agaccacccc tcccctgctg 1320

gactccgacg gctccttctt cgtggactcc aagctgaccg tggacaagtc cgggcggcag 1380

cagggcaacg tgttctcctg cgccctgatg cacgaggccc tgcacaacca ctacacccag 1440

aagtccctgt ccctgtctcc tggcaagtga 1470

Claims

1. the complementary cotransfection carrier for expression of eukaryon of expressing of a dhfr, it is characterized in that, in the pCI-neo plasmid, inserted respectively the matrix attachment region territory, woodchuck hepatitis virus post-transcriptional control sequence, the ribosome entry site(RES) sequence, dhfr1-105aa gene fragment or dhfr106-187aa gene fragment;

Specific as follows: inserted people β-globin matrix attachment region territory between adjacent two the restriction enzyme site SacII of pCI-neo plasmid and BglII, nucleotide sequence is shown in SEQ ID NO.1; Inserted woodchuck hepatitis virus post-transcriptional control sequence between adjacent two the restriction enzyme site SalI of pCI-neo plasmid and NotI, nucleotide sequence is shown in SEQ ID NO.2; Inserted the ribosome entry site(RES) sequence between adjacent two the restriction enzyme site MluI of pCI-neo plasmid and XbaI, nucleotide sequence is shown in SEQ ID NO.6; Between adjacent two the restriction enzyme site XbaI of pCI-neo plasmid and SalI, dhfr1-105aa gene fragment or dhfr106-187aa gene fragment have been inserted, the nucleotide sequence of dhfr1-105aa gene fragment is shown in SEQ ID NO.3, and the nucleotide sequence of dhfr106-187aa gene fragment is shown in SEQ ID NO.4; 5 ' end of above-mentioned dhfr1-105aa gene fragment and dhfr106-187aa gene fragment is connected with the leucine zipper structure coding gene sequence; The nucleotide sequence of described coding leucine zipper structure is shown in SEQ ID NO.5.

2. the preparation method of the complementary cotransfection carrier for expression of eukaryon of expressing of the described dhfr of claim 1, step is as follows:

(2) the plasmid pCIneo-M that makes with restriction enzyme SalI and NotI double digestion step (1) inserts the woodchuck hepatitis virus post-transcriptional control sequence (WPRE) through restriction enzyme SalI and NotI double digestion, makes up plasmid pCIneo-MW;

(4) with restriction enzyme BglII and SalI double digestion dhfr1-105aa gene fragment or dhfr106-187aa gene fragment, with restriction enzyme BamHI and SalI double digestion leucine zipper structure coding gene sequence, make up LZ-dhfr1-105aa or LZ-dhfr106-187aa;

3, the complementary cotransfection carrier for expression of eukaryon application in the high level expression target protein in eukaryotic cell expressed of the described dhfr of claim 1.

4, application as claimed in claim 3 is characterized in that, described target protein is one of immunoglobulin (Ig), domain-immunoglobulin fusion proteins, somatomedin, soluble receptors or blood Rh factor.

5, application as claimed in claim 3 is characterized in that, step is as follows:

6, application as claimed in claim 5, it is characterized in that, the culture condition of suspension feeding culture is in the step (3): pH6.9～7.1,35 ℃～37 ℃ of temperature, dissolved oxygen 20%～60%, air air flow 0.01～0.2vvm, oxygen ventilation amount 0.01～0.2vvm, CO ₂Air flow 0.01～0.2vvm, osmotic pressure 290～500mOSM, lactic acid is 15～30% of total culture volume less than 5g/L, ammonia less than 10mmol/L, flow feeding culture volume.