CN102268434A - Quick construction method for arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector - Google Patents
Quick construction method for arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector Download PDFInfo
- Publication number
- CN102268434A CN102268434A CN 201110048020 CN201110048020A CN102268434A CN 102268434 A CN102268434 A CN 102268434A CN 201110048020 CN201110048020 CN 201110048020 CN 201110048020 A CN201110048020 A CN 201110048020A CN 102268434 A CN102268434 A CN 102268434A
- Authority
- CN
- China
- Prior art keywords
- carrier
- fragment
- amir
- synthetic
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a quick construction method for an arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector. An arabidopsis thaliana silencing vector is constructed; silencing segments are modified aiming at different genes; the other parts are the same; an unchanged DNA (Deoxyribonucleic Acid) interval on a target vector is extended; unchanged regions at the two ends of a silencing related segment are previously placed in a transgene target vector; and then a core silencing segment is connected to a reconstructed vector to directly finish the construction of the vector. When a head segment and a tail segment are selected, a DNA sequence is analyzed, so that the head segment is connected with the tail segment through a bridging segment to obtain an StuI enzyme cutting site and an SnaBI enzyme cutting site; and after escherichia coli is converted, the vector can be prepared on a large scale and can be linearized by using StuI and SnaBI endonucleases, and the core silencing segment synthesized by using the method disclosed by the invention is directly connected to finish the construction of the arabidopsis thaliana silencing vector. The method has the beneficial effects of easiness, convenience, practicability, convenience for operation, high benefit, capability of greatly shortening experimental time and capability of reducing reconstruction cost of a single silencing vector.
Description
Technical field
The present invention relates to biological technical field, mainly is a kind of Arabidopis thaliana method for quickly constructing artificial mi RNA gene interference vector.
Background technology
It is core with Overlapping PCR that existing method makes up the arabidopsis gene silent carrier, and the method for replacing Arabidopis thaliana miR319a by PCR makes up arabidopsis gene silent carrier (Schwab et al., 2006).Existing method makes up at single silent carrier and needs to adopt four PCR primers that have reticent correlated series, cooperate with two consensus primers, the pRS300 carrier is increased, the 3 segment DNA fragments that amplification is obtained reclaim, merge PCR again, be connected into the T carrier, be connected into conversion carrier after enzyme is cut again, finally obtain the silent carrier that transgenosis is used.
Method specifically is divided into four steps:
The first step by at synthetic 4 primers that length is 40bp of each different gene interferences design, is synthesized two common combination of primers, is used for the relevant dna fragmentation of the special silence of amplification gene;
Second step, congratulate by reticent primer and two consensus primers of 4 gene specifics, amplification acquisition three segment length are 271bp respectively, 173bp, the dna fragmentation of 299bp is by the electrophoretic separation dna fragmentation, cutting contains the gel of target sizes DNA, carries out dna fragmentation and reclaims;
In the 3rd step, three sections PCR products that recovery is obtained mix, and again with two public PCR that merge, obtaining length is the dna fragmentation of 695bp, and by the electrophoretic separation dna fragmentation, cutting contains the gel of target sizes DNA, carry out dna fragmentation and reclaim;
The 4th step, 695bp fragment after reclaiming is connected to T carrier or other intermediate carriers, by connecting, transform the intestinal bacteria bacterium colony that obtains to carry respective carrier, behind the amplification thalline, extraction has reticent segmental intermediate carrier, adopting restriction enzyme to carry out enzyme again cuts, obtain the dna fragmentation of toughness end, be connected with destination carrier again, by connecting, transform the intestinal bacteria bacterium colony that obtains to carry conversion carrier, order-checking is used for Agrobacterium-mediated Transformation after detecting correctly.
Existing method carrier construction needs four big steps, and the content of each step operation is quite loaded down with trivial details again, needs the experimenter to have certain molecular biology operation basis.The method that this patent relates to only needs two steps, and each step operation is also very simple, and the experimenter with simple molecules Basic of Biology also can be quick, finishes the vector construction task accurately.
Summary of the invention
The present invention will solve the shortcoming of above-mentioned prior art, a kind of Arabidopis thaliana method for quickly constructing artificial mi RNA gene interference vector is provided, relates in particular to the quick silent carrier transformation of Arabidopis thaliana with the synthetic of dna sequence dna and this dna sequence dna and adopt this dna sequence dna to be used to set up Arabidopis thaliana artificial mi RNA gene interference vector efficiently.
In order to solve the technological deficiency of above-mentioned existence, first purpose of the present invention provides the quick silent carrier transformation of Arabidopis thaliana dna sequence dna and synthetic method thereof, second purpose of the present invention provides and is used for carrier that efficiently makes up the arabidopsis gene silent carrier and preparation method thereof, and the 3rd purpose of the present invention provides arabidopsis gene silent carrier and preparation method thereof.The present invention has simplified the method that single silent carrier makes up, and has quickened building process, has improved the efficient of vector construction.
In order to realize first above-mentioned purpose, the present invention has adopted following technical scheme:
The quick silent carrier transformation of Arabidopis thaliana dna sequence dna, this dna sequence dna are shown in SEQ ID NO:1, and SEQ ID NO:1 is described as follows:
caaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttAGGCCTagcgcTACGTAtccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtgacatatatgctgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatg
Wherein, AGGCCT partly is the StuI restriction enzyme site, and TACGTA is the SnaBI restriction enzyme site.
The quick silent carrier transformation of above-mentioned Arabidopis thaliana is synthetic with the DNA joining method, this method adopts Arabidopis thaliana miR319a gene silencing sequence as the basis, shown in SEQ ID NO:2, this arabidopsis thaliana sequence is divided into the reticent fragment (as shown in Figure 2) of first fragment, cauda section and core, merge first fragment, linker fragment and cauda section by connecting, be used for the transformation of rapid gene silent carrier then.
SEQ ID NO:2 is described as follows:
caaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttaggaatatatatgtagagagagcttccttgagtccattcacaggtcgtgatatgattaattagcttccgactcattcatccaaataccgagtcgccaaaattcaaactagactcgttaaatgaatgaatgatgcggtagacaaattggatcattgattctctttgattggactgaagggagctccctctctcttttgtatccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtgacatatatgctgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatg
First fragment such as SEQ ID NO:5,
SEQ ID NO:5 is described as follows::
caaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttagg；
The cauda section, SEQ ID NO:6:
SEQ ID NO:6 is described as follows:
gtatccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtgacatatatgctgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatg；
Linker fragment, SEQ ID NO:7 is described as follows:
cctagcgctac
By sequential analysis and design, make wherein first fragment by the ending of AGG site, and interfere the cauda section initial by the GTA position.So first fragment, junction fragment and the splicing of cauda section obtain and just in time obtain a silent carrier transformation dna sequence dna that comprises StuI restriction enzyme site and SnaBI restriction enzyme site; first segmental front end and the segmental tail end of tail have comprised restriction enzyme site and corresponding protection base simultaneously, cut and connect the destination carrier of transformation in order to enzyme.
As preferably, the quick silent carrier transformation of above-mentioned Arabidopis thaliana comprises the steps: with the synthetic method of dna sequence dna
1. primer is synthetic: synthetic 8 primers, and sequence is as follows:
2. adopt the substep salvage to transform fragment
Adopt synthetic this fragment of method of stepwise synthesis, end fragment before amiR-F1, amiR-R1, amiR-F2 and amiR-R2 are synthetic, the synthetic back of amiR-F2, amiR-R2, amiR-F3 and amiR-R3 end fragment;
As preferred again, synthetic leading portion and back segment PCR system concentration and reaction conditions are:
3. transform segmental splicing
Dilute 100 times respectively, adopt G-F-SacI and G-R-KpnI primer again with merging two sections PCR products, the synthetic segmental DNA chain of complete transformation that has;
As preferred again, corresponding PCR system concentration and reaction conditions are:
After finishing, be used to transform the reticent fragment sequence of Arabidopis thaliana rapid gene shown in SEQ ID NO:1.
In order to realize second above-mentioned purpose, the present invention has adopted following technical scheme:
Be used for efficiently making up the carrier of arabidopsis gene silent carrier, this carrier contains the gene fragment just like dna sequence dna shown in the SEQ ID NO:1.
The above-mentioned preparation method who is used for efficiently making up the carrier of arabidopsis gene silent carrier, this method comprises the steps:
1. carrier is transformed being connected of fragment and destination carrier
Adopt the gene fragment of dna sequence dna shown in the SEQ ID NO:1, adopt SacI and KpnI endonuclease digestion again, if other multiple clone site of the employing of destination carrier, then should be when design of primers, revise restriction enzyme site, and carry out enzyme with corresponding restriction endonuclease herein and cut, be connected into unmodified destination carrier then;
Preferred linked system is as follows:
Linked system after mixing is spent the night 16 ℃ of water-baths;
2. transform the destination carrier transformed into escherichia coli of finishing
Get and connect product 5ul, the CaCl of adding 100ul
2The DH5 α thermal shock competence of handling, 42 ℃ of thermal shocks were handled 90 seconds, added the LB nonreactive substratum of 800ul, recovered 1 hour with 250rpm at 37 ℃; Under aseptic condition, get 100ul and be coated on the LB culture plate that contains the 50ug/ml kantlex, cultivated 16 hours for 37 ℃, select transformant, insert and send order-checking to confirm after LB cultivates again; The correct bacterium of checking order adopts 25% glycerine frozen, in order to life-time service.
In order to realize the 3rd above-mentioned purpose, the present invention has adopted following technical scheme:
Arabidopis thaliana silent carrier, this carrier contain the gene fragment of dna sequence dna shown in the SEQ ID NO:1.
The fast construction method (as Fig. 1) of above-mentioned Arabidopis thaliana silent carrier, this method comprises the steps:
1. " grain is prepared and linearizing
The carrier that is used for efficiently making up the arabidopsis gene silent carrier of above-mentioned acquisition is shaken the bacterium amplification, adopt the plasmid extraction test kit to carry out the plasmid DNA extracting, carry out the double digestion plasmid with StuI and SnaBI then;
It is as follows that enzyme is cut system:
Cut at 37 ℃ of following enzymes and to spend the night, the DNA after enzyme is cut adopts 1% agarose gel electrophoresis, with behind the ethidium bromide staining at ultraviolet lamp incision glue, adopt gel to reclaim test kit and reclaim enzyme and cut product; Carrier after the linearizing is the universal support fragment, can be used for the structure of all quick silent carriers, can be standby-20 ℃ of long-time down preservations.
2. bridge-clip is synthetic
Two of the segmental primers of synthetic bridging, sequence is as follows:
Primer is diluted to 10uM, and carries out PCR by following system; The PCR product is bridge-clip.This fragment is general fragment, can be used for the structure of all quick silent carriers, can be standby-20 ℃ of long-time down preservations.
3. the reticent segmental amplification of core
Be two of the reticent associated clip primers of each gene difference synthetic gene:
At first, exist
Http:// wmd2.weigelworld.org/Design artificial mi RNA sequence (Schwab et al., 2006).The artificial mi RNA fragment reverse complemental that will design obtains carries out G-A with 3,14 and 21, C-A, and T-A, the A-T transversion, and increase " aatatatatgtaga " 5 ', 3 ' increases " tcacaggtcgtgata ", forms At_HESH_F; With the artificial mi RNA fragment reverse complemental of design acquisition, and in 5 ' increase " aaaagagaga ", 3 ' increases " tcaaagagaatcaa " forms special primer At_HESH_R; As following table, the black table worker miRNA fragment of leting others have a look at, grey color part is represented the sequence of adding, underscore represents to carry out the site of transversion.
Get the 1ul bridge-clip, adopt gene specific primer to carry out pcr amplification (Fig. 3), preferred amplification condition is as follows:
4. the reticent fragment of core and carrier is connected
Need not to reclaim, the fragment PCR products that obtains of directly will increasing directly and linearizing carrier is connected, and preferably linked system is as follows:
Linked system after mixing is spent the night 16 ℃ of water-baths.
5. transformed into escherichia coli bacterial strain
This patent recommends to use conventional DH5 α bacterial strain to carry out the transformation of junction fragment.Get and connect product 5ul, the CaCl of adding 100ul
2The DH5 α thermal shock competence bacteria of handling, 42 ℃ of thermal shocks were handled 90 seconds, added the LB nonreactive substratum of 800ul, recovered 1 hour with 250rpm at 37 ℃; Under aseptic condition, get 100ul and be coated on the LB culture plate that contains the 50ug/ml kantlex, cultivated 16 hours for 37 ℃, select transformant, insert LB and cultivate again.
6. the detection of gene silencing carrier
Owing to adopted flat terminal the connection, must select connection transformant in the right direction, hit efficient for improving order-checking, get rid of carrier simultaneously from situation about connecting.Before transformant checks order, at first need carry out bacterium liquid PCR.For this reason, need synthetic two detection primers:
With the flat board after connecting, selected clone shakes bacterium, after the incubated overnight, gets 1ul and carries out bacterium liquid PCR detection.Liquid PCR detection architecture is as follows:
The positive colony that PCR confirms can tentatively be judged as transformed clone, for confirming this result, send 2 positive colonies to check order.Press the operation of this patent method, positive colony order-checking back accuracy is more than 85%.
This patent is transformed the genetically modified destination carrier of Arabidopis thaliana, simplified experiment flow greatly, only need carry out once conventional PCR reaction, a connection just can be finished the structure of gene silencing carrier, the time of vector construction was shortened to 4 days from 9 days, and, can carry out the interference vector structure work of a plurality of genes simultaneously because experimental implementation is very simple.This patent method makes up at the silent carrier of single specific gene, only needs synthetic two the reticent relevant primers of design; And only adopt conventional PCR method, reduced greatly to cause the DNA cloning probability of errors because of Overlapping PCR; After PCR finishes, owing to there is not the interference of plasmid background, need not to carry out electrophoresis and reclaim dna fragmentation, reduced the consumption of reagent in electrophoresis and the reclaimer operation process, further saved experimental cost and experimental period.The important feature of this patent method is in addition, adopts silent carrier that present method makes up and the silent carrier that adopts existing method to make up in full accord, and the downstream transgenic research is not subjected to fully that this method is improved to be influenced.
The effect that the present invention is useful is:
Existing method and this patent method flow comparison sheet
From above-mentioned form as can be seen, the described method of this patent not only can effectively shorten the time that the arabidopsis gene silent carrier makes up, saving related reagent consumptive material that can also be a large amount of.Compare with existing method, this patent makes up the method for single silent carrier, and the reagent consumptive material kind that not only needs is few, and the amount of reagent that is consumed also greatly reduces.
Except that table 1 was listed, making up at each silent carrier in the existing method needed synthetic 4 primers, adopts this patent method, and each silent carrier makes up only needs two primers, caused the vector construction failed probability thereby also reduced because of primer synthetic mistake.
We can also find out from table 1, use this patent to shorten the vector construction time greatly, and existing method needed 9 days just can finish vector construction approximately, and this patent method only needed just can finish in 4 days.And in operating process, existing method need consume a large amount of energy of experimenter, in the overall process, approximately need take more than 20 hour experimental period, and present method only takies 9 hours experimental periods, and wherein be mainly PCR and tie-time, the laboratory technician can carry out other work fully simultaneously.
In sum, this patent method tool high efficiency can greatly shorten experimental period, reduces the improvement cost of single silent carrier.Simultaneously, because present method is simple and easy to do, easy to operate, make single laboratory technician can carry out a plurality of silent carrier transformations simultaneously.
Description of drawings
Fig. 1 is an arabidopsis gene silent carrier fast construction method synoptic diagram.
Fig. 2 transforms segmental synthesis model figure for carrier.
Fig. 3 silent carrier core fragment makes up and illustrates intention.
Embodiment
The invention will be further described below in conjunction with drawings and Examples:
Embodiment 1 transforms the pCAMBIA1300 carrier and is used for quick silent carrier structure
1, in generation, transformed the preparation of conversion carrier
For improving this patent suitability, lay special stress on illustrates the method that destination carrier is transformed together, to offer user's reference of the present invention, can be used for transforming other destination carrier when needed.
For head and the tail batch section is put into carrier, and can carry out linearization for enzyme restriction, we at first adopt transformed pCAMBIA1300 carrier is initial carrier, be connected with 35s promotor and rbcs terminator in being somebody's turn to do, can be used as startup and stop the reticent segmental element of Arabidopis thaliana, this carrier abbreviates the 1300SR carrier as.
At first, adopt SacI and KpnI restriction endonuclease that it is carried out enzyme and cuts, cut at 37 ℃ of following enzymes and spend the night, the DNA after enzyme is cut adopts 1% agarose gel electrophoresis, with behind the ethidium bromide staining at ultraviolet lamp incision glue, adopt gel to reclaim test kit and reclaim enzyme and cut product.Product be stored in-20 ℃ standby.
2, transform the synthetic of fragment relevant primer
Press this patent method and transform conversion carrier, we synthesize 8 primers, are used to transform the 1300SR carrier, and primer sequence is as follows:
3, adopt the synthetic transformation fragment that contains StuI and SnaBI restriction enzyme site of substep stepwise process
By the explanation of patent, the method for stepwise synthesis is synthesized this fragment, end fragment before amiR-F1, amiR-R1, amiR-F2 and amiR-R2 are synthetic, and the synthetic back of amiR-F2, amiR-R2, amiR-F3 and amiR-R3 end fragment, as shown in Figure 2.
Synthetic leading portion and back segment PCR system concentration and reaction conditions are:
4, merge two sections PCR products and obtain complete transformation fragment
Two sections PCR products that obtain are diluted 100 times respectively, adopt G-F-SacI and G-R-KpnI primer again with merging two sections products, the synthetic complete transformation fragment that has restriction enzyme site.PCR system concentration and reaction conditions are:
5, make being connected of fragment and 1300UR carrier
Adopt gel to reclaim test kit and reclaim dna fragmentation,, be connected into unmodified destination carrier adopting SacI and KpnI endonuclease digestion.
Linked system is as follows:
Linked system after mixing is spent the night 16 ℃ of water-baths.
6, transformed into escherichia coli
Get and connect product 5ul, the CaCl of adding 100ul
2The DH5 α thermal shock competence of handling, 42 ℃ of thermal shocks were handled 90 seconds, added the LB nonreactive substratum of 800ul, recovered 1 hour with 250rpm at 37 ℃.Under aseptic condition, get 100ul and be coated on the LB culture plate that contains the 50ug/ml kantlex, cultivated 16 hours for 37 ℃, select transformant, insert and send order-checking to confirm after LB cultivates again.The correct bacterium of checking order adopts 25% glycerine frozen, in order to life-time service.Transform back carrier sequence and see SEQ IDNO:4.
Embodiment 2 usefulness this patent methods make up 5 arabidopsis gene silent carriers fast
1, the preparation work of the quick structure of silent carrier
(1) plasmid is prepared and linearizing
To shake bacterium amplification according to the carrier that embodiment 1 obtains, and adopt the plasmid extraction test kit to carry out the extracting of 1300URA plasmid DNA, and cut with the AfeI enzyme, it is as follows that enzyme is cut system:
Cut at 37 ℃ of following enzymes and to spend the night, the DNA after enzyme is cut adopts 1% agarose gel electrophoresis, with behind the ethidium bromide staining at ultraviolet lamp incision glue, adopt gel to reclaim test kit and reclaim enzyme and cut product.Carrier after the linearizing is the universal support fragment, can be used for the structure of all quick silent carriers, can be standby-20 ℃ of long-time down preservations.
(2) bridge-clip is synthetic
Press two of the segmental primers of this patent method synthetic bridging, sequence is as follows:
Primer is diluted to 10uM, and carries out PCR by following system; The PCR product is bridge-clip.This fragment is general fragment, can be used for the structure of all quick silent carriers, can be standby-20 ℃ of long-time down preservations.
2, the reticent segmental amplification of core
(1) the reticent segmental amplification of core
At synthetic respectively two the gene silencing associated clip primers of each gene,
The amplified fragments of 5 genes is respectively:
At each gene, get the 1ul bridge-clip respectively, adopt gene specific primer to carry out pcr amplification, amplification condition is as follows:
(2) the reticent fragment of core and carrier is connected
Need not to reclaim, the fragment PCR products that obtains of directly will increasing directly is connected with linearizing carrier, and linked system is as follows:
Linked system after mixing is spent the night 16 ℃ of water-baths.
(3) transformed into escherichia coli bacterial strain
This patent recommends to use conventional DH5 α bacterial strain to carry out the transformation of junction fragment.Get and connect product 5ul, the CaCl of adding 100ul
2The DH5 α thermal shock competence bacteria of handling, 42 ℃ of thermal shocks were handled 90 seconds, added the LB nonreactive substratum of 800ul, recovered 1 hour with 250rpm at 37 ℃.Under aseptic condition, get 100ul and be coated on the LB culture plate that contains the 50ug/ml kantlex, cultivated 16 hours for 37 ℃, select transformant, insert LB and cultivate again.
3, the detection of gene silencing carrier
(1) detects the synthetic of primer
Owing to adopted flat terminal the connection, must select connection transformant in the right direction, hit efficient for improving order-checking, get rid of carrier from situation about connecting.Before transformant checks order, at first need carry out bacterium liquid PCR.For this reason, need synthetic two detection primers:
(2) bacterium liquid PCR detects
With the flat board after connecting, selected clone shakes bacterium, after the incubated overnight, gets 1ul and carries out bacterium liquid PCR detection.Bacterium liquid PCR detection architecture is as follows:
The positive colony that PCR confirms can tentatively be judged as transformed clone, for confirming this result, send 2 positive colony order-checkings.
(3) order-checking detects
After five genes that contain the LRR structural domain, bacterium liquid PCR detect and finish, the silent carrier of each gene, send two PCR positive colonies to check order respectively, detect demonstration through sequencing result, 5 carriers all obtain correct clone, and wherein 5 carriers send two clones of survey correct.So batch 5 gene silencing carrier order-checking positive rates that make up are 100%.
In addition to the implementation, the present invention can also have other embodiments.All employings are equal to the technical scheme of replacement or equivalent transformation formation, all drop on the protection domain of requirement of the present invention.
Claims (8)
1. the quick silent carrier transformation of Arabidopis thaliana dna sequence dna, it is characterized in that: this dna sequence dna is shown in SEQ ID NO:1, and SEQ ID NO:1 is described as follows:
caaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttAGGCCT
agcgcTACGTAtccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtgacatatatgc
tgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatg；
Wherein, AGGCCT partly is the StuI restriction enzyme site, and TACGTA is the SnaBI restriction enzyme site.
2. one kind is synthesized the method that dna sequence dna is used in the quick silent carrier transformation of Arabidopis thaliana as claimed in claim 1, it is characterized in that: this method adopts Arabidopis thaliana miR319a gene silencing sequence as the basis, shown in SEQ ID NO:2, this arabidopsis thaliana sequence is divided into the reticent fragment of first fragment, cauda section and core; First fragments sequence is shown in SEQ ID NO:5, and the tail fragments sequence is shown in SEQ ID NO:6; The designed joint fragment has designed restriction enzyme site and corresponding protection base at segmental front end of head and the segmental tail end of tail shown in SEQ ID NO:7; First fragment, linker fragment and the splicing of cauda section are obtained a silent carrier transformation dna sequence dna that comprises StuI and SnaBI restriction enzyme site, and wherein first fragment is by the ending of AGG site, and interference cauda section is initial by the GTA position.
3. the quick silent carrier transformation of Arabidopis thaliana according to claim 2 is characterized in that with the synthetic method of dna sequence dna this method comprises the steps:
1. " primer is synthetic: synthetic 8 primers, and sequence is as follows:
Primer title primer sequence
amiR-F1 atgaattcctgcagccccaaacacacgctcggacgcatattacacatgttcat
amiR-F2 ttgatgttttaggcctagcgctacgtatccaattttcttgattaatctttcctg
amiR-F3 agtgacatatatgctgccttcgtatatatagttctggtaaaattaacattttgg
amiR-R1 ggcctaaaacatcaattcaaaacagcgagtattaagtgtatgaacatgtgtaat
amiR-R2 agcatatatgtcacttagtggatcaagcatgtttttgtgcaggaaagattaatc
amiR-R3 agggatccccccatggcgatgccttaaataaagataaacccaaaatgttaattt
G-F-Sacl TCGAGCTCatgaattcctgcagccccaac
G-R-Kpnl TCGGTACCagggatccccccatggcgatg
2. adopt the substep salvage to transform fragment
Adopt synthetic this fragment of method of stepwise synthesis, end fragment before amiR-F1, amiR-R1, amiR-F2 and amiR-R2 are synthetic, the synthetic back of amiR-F2, amiR-R2, amiR-F3 and amiR-R3 end fragment;
Synthetic leading portion and back segment PCR system concentration and reaction conditions are:
Reagent dosage concentration
H
2O 33.5ul /
PCRBuffer 5.0ul /
dNTP 5.0ul 2.5mM?each
pb-Taq 0.5ul /
Primer1 1.0ul 10mM
Primer2 1.0ul 10mM
Primer3 2.0ul 10mM
Primer4 2.0ul 10mM
The temperature-time circulation
95℃ 2min /
95℃ 30″ 34cycles
55℃ 30″ 34cycles
72℃ 40″ 34cycles
72℃ 7min /
3. transform segmental splicing
Dilute 100 times respectively, adopt G-F-SacI and G-R-KpnI primer again with merging two sections PCR products, the synthetic segmental DNA chain of complete transformation that has.
4. carrier that is used for efficiently making up the arabidopsis gene silent carrier, it is characterized in that: this carrier contains the gene fragment of dna sequence dna according to claim 1.
5. be used for efficiently making up the preparing carriers method of arabidopsis gene silent carrier according to claim 4, it is characterized in that: this method comprises the steps:
1. carrier is transformed being connected of fragment and destination carrier
Adopt the gene fragment of dna sequence dna according to claim 1, adopt SacI and KpnI endonuclease digestion again, if other multiple clone site of the employing of destination carrier, then should be when design of primers, revise restriction enzyme site, and carry out enzyme with corresponding restriction endonuclease herein and cut, being connected into unmodified destination carrier then, the linked system after mixing is spent the night 16 ℃ of water-baths;
2. transform the destination carrier transformed into escherichia coli of finishing
Get and connect product 5ul, the CaCl of adding 100ul
2The DH5 α thermal shock competence of handling, 42 ℃ of thermal shock places 90 seconds add the LB nonreactive substratum of 800ul, at 37 ℃ with 250rpm recovery 1 hour; Under aseptic condition, get 100ul and be coated on the LB culture plate that contains the 50ug/ml kantlex, cultivated 16 hours for 37 ℃, select transformant, insert and send order-checking to confirm after LB cultivates again; The correct bacterium of checking order adopts 25% glycerine frozen, in order to life-time service.
6. the fast construction method of an Arabidopis thaliana silent carrier is characterized in that: adopt following two primers
At_HESC_B_F tcacaggtcgtgatatgattaa
At_HESC_B_R tcaaagagaatcaatgatccaa
Primer is diluted to 10uM, the performing PCR of going forward side by side; The PCR product is bridge-clip; Bridge-clip is connected with claim 4 described carriers, obtains the arabidopsis gene silent carrier.
7. the fast construction method of Arabidopis thaliana silent carrier according to claim 6, it is that this method comprises following characterization step:
1. " plasmid is prepared and linearizing
The carrier that claim 4 is obtained shakes the bacterium amplification, adopts the plasmid extraction test kit to carry out the plasmid DNA extracting, uses StuI and SnaBI digested plasmid then;
Cut at 37 ℃ of following enzymes and to spend the night, the DNA after enzyme is cut adopts 1% agarose gel electrophoresis, with behind the ethidium bromide staining at ultraviolet lamp incision glue, adopt gel to reclaim test kit and reclaim enzyme and cut product;
2. bridge-clip is synthetic
With following two primers
Primer title primer sequence
At_HESC_B_F tcacaggtcgtgatatgattaa
At_HESC_B_R tcaaagagaatcaatgatccaa
Primer is diluted to 10uM, the performing PCR of going forward side by side; The PCR product is bridge-clip, and bridge-clip is connected with claim 4 described carriers, obtains the arabidopsis gene silent carrier;
3. the reticent segmental amplification of core
Be two of the reticent associated clip primers of each gene difference synthetic gene:
At first, design artificial mi RNA sequence, the artificial mi RNA fragment reverse complemental with design obtains carries out G-A with 3,14 and 21, C-A, T-A, A-T transversion, and in 5 ' increase " aatatatatgtaga ", 3 ' increases " tcacaggtcgtgata ", forms At_HESH_F; With the artificial mi RNA fragment reverse complemental of design acquisition, and in 5 ' increase " aaaagagaga ", 3 ' increases " tcaaagagaatcaa " forms special primer At_HESH_R;
4. the reticent fragment of core and carrier is connected
Need not to reclaim, the fragment PCR products that obtains of directly will increasing directly is connected with linearizing carrier, and the linked system after mixing is spent the night 16 ℃ of water-baths;
5. transformed into escherichia coli bacterial strain
Get connection product 5ul, add the DH5 α thermal shock competence bacteria of the CaCl2 processing of 100ul, 42 ℃ of thermal shocks were handled 90 seconds, added the LB nonreactive substratum of 800ul, recovered 1 hour with 250rpm at 37 ℃; Under aseptic condition, get 100ul and be coated on the LB culture plate that contains the 50ug/ml kantlex, cultivated 16 hours for 37 ℃, select transformant, insert LB and cultivate again;
6. the detection of gene silencing carrier
Detect the synthetic of primer, need synthetic two detection primers:
Primer title primer sequence
Promoter_test_F gattgatgtgatatctccac
At_amiR_test_R tatttggatgaatgagtcgg
Bacterium liquid PCR detects, and with the flat board after connecting, selected clone shakes bacterium, after the incubated overnight, gets 1ul and carries out bacterium liquid PCR detection, and the positive colony that PCR confirms can tentatively be judged as transformed clone.
8. Arabidopis thaliana rapid gene silent carrier is characterized in that: this carrier is made up by the described method of claim 7 by the described carrier of claim 5 and obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110048020 CN102268434A (en) | 2011-02-23 | 2011-02-23 | Quick construction method for arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110048020 CN102268434A (en) | 2011-02-23 | 2011-02-23 | Quick construction method for arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102268434A true CN102268434A (en) | 2011-12-07 |
Family
ID=45050895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110048020 Pending CN102268434A (en) | 2011-02-23 | 2011-02-23 | Quick construction method for arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102268434A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611325A (en) * | 2014-12-31 | 2015-05-13 | 国际竹藤中心 | Cloning method of microRNA precursor genes of moso bamboos |
| CN106615619A (en) * | 2016-12-19 | 2017-05-10 | 浙江大学 | Feed containing miRNA-34 (micro Ribonucleic Acid-34) as well as production method and anti-virus and anti-cancer effects thereof |
| CN109652443A (en) * | 2019-02-25 | 2019-04-19 | 四川大学 | A kind of artificial microRNA interference carrier and its construction method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101709300A (en) * | 2009-10-30 | 2010-05-19 | 浙江省农业科学院 | Method for quickly constructing artificial mi RNA gene interference vector of paddy |
-
2011
- 2011-02-23 CN CN 201110048020 patent/CN102268434A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101709300A (en) * | 2009-10-30 | 2010-05-19 | 浙江省农业科学院 | Method for quickly constructing artificial mi RNA gene interference vector of paddy |
Non-Patent Citations (1)
| Title |
|---|
| 《Plant Physiology》 20090731 Songbiao Chen等 A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics 摘要，图1－6、s1－4，第1112页左栏倒数第1段、右栏第1段，第1113页左栏第1段，第1115页右栏倒数第1段，第1116－1117页，第1119页右栏倒数第1－6段，Supplemental Table S1，Supplemental Materials and Methods S1 1-8 第150卷, * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611325A (en) * | 2014-12-31 | 2015-05-13 | 国际竹藤中心 | Cloning method of microRNA precursor genes of moso bamboos |
| CN104611325B (en) * | 2014-12-31 | 2017-06-23 | 国际竹藤中心 | The cloning process of mao bamboon microRNA precursor-genes |
| CN106615619A (en) * | 2016-12-19 | 2017-05-10 | 浙江大学 | Feed containing miRNA-34 (micro Ribonucleic Acid-34) as well as production method and anti-virus and anti-cancer effects thereof |
| CN109652443A (en) * | 2019-02-25 | 2019-04-19 | 四川大学 | A kind of artificial microRNA interference carrier and its construction method and application |
| CN109652443B (en) * | 2019-02-25 | 2023-04-07 | 四川大学 | Artificial microRNA interference vector and construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10544390B2 (en) | Methods for generating a bacterial hemoglobin library and uses thereof | |
| AU2017339542A1 (en) | S. pyogenes Cas9 mutant genes and polypeptides encoded by same | |
| US10544411B2 (en) | Methods for generating a glucose permease library and uses thereof | |
| US20190194769A1 (en) | Genetic perturbation of the rna degradosome protein complex | |
| CN110938579A (en) | Recombinant tyrosine ammonia lyase strain, tyrosine ammonia lyase and preparation method and application thereof | |
| CN111607613A (en) | Plasmid vector for expressing mRNA of cellular immune vaccine and construction method and application thereof | |
| CN104911199B (en) | Cloned dna molecule method | |
| CN110499274B (en) | Genetic engineering rhodococcus and construction method and application thereof | |
| CN102268434A (en) | Quick construction method for arabidopsis thaliana artificial miRNA (micro Ribonucleic Acid) gene interference vector | |
| CN102559854B (en) | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular | |
| CN109486845B (en) | Method for accurately regulating and controlling gene expression of corynebacterium glutamicum | |
| CN113528563B (en) | Preparation method and application of visual biosensor synthesized by using explosive molecule degradation genes | |
| CN112877332A (en) | Method for detecting activity of chicken RIPK2 promoter by using dual-luciferase reporter gene | |
| CN111909929B (en) | Method for obtaining Trichoderma reesei cellulase regulation gene in targeted manner | |
| CN107012146B (en) | Site-specific recombination-based tetrahymena expression vector and construction and application thereof | |
| CN101333537B (en) | Expression type pre-T vector, preparation thereof and applications | |
| CN107475257B (en) | Promoter-like gene for efficiently promoting expression of foreign protein and application thereof | |
| CN104087606A (en) | Bile salt hydrolase gene BSH and recombinant prokaryotic expression vector thereof | |
| CN116286904B (en) | Bovine-derived CRISPR/boCas13a gene editing system, method and application | |
| CN116240216B (en) | Antibody construction sequencing method using bacterial liquid as template | |
| CN102676469A (en) | Mixed enzyme, digestion modification kit and carrier constructing method | |
| CN109468323B (en) | Artificially synthesized intron, mammalian cell recombinant expression vector, mammalian host cell, expression method and application thereof | |
| CN101921746A (en) | Template p111 for preparing 100bp DNA ladder based on PCR technology, and preparation system thereof | |
| CN106554961B (en) | Anaerobic clostridium xylan inducible promoter and application thereof | |
| KR102010246B1 (en) | Promoter from microalgae Ettlia and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111207 |