CN102229985A - Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali - Google Patents
Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali Download PDFInfo
- Publication number
- CN102229985A CN102229985A CN2011101365521A CN201110136552A CN102229985A CN 102229985 A CN102229985 A CN 102229985A CN 2011101365521 A CN2011101365521 A CN 2011101365521A CN 201110136552 A CN201110136552 A CN 201110136552A CN 102229985 A CN102229985 A CN 102229985A
- Authority
- CN
- China
- Prior art keywords
- peach
- primer
- phomopsis
- fruit
- branch
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a special PCR indentifying method of phomopsis amygdali. According to the method provided by the invention, PCR amplification is carried out by utilizing a primer pair 4, wherein a positive primer sequence is Pa-F2: 5'GCCGGCCCCCTTCTG3'; a negative primer sequence is Pa-R2: 5'GCCTGCCTCGTTTTTACACA3'. The specificity PCR identifying method of phomopsis amygdali, provided by the invention, can be used as an efficient way for identifying the phomopsis amygdali and other strains in and out of the genus of the phomopsis. The method provided by the invention has the advantages of high speed, high flexibility, good specificity, simpleness and convenience for operation and low needed experiment conditions, thereby extremely high practical value.
Description
Technical field
The invention belongs to the harmful organism molecular diagnosis field, be specifically related to the specific PCR discrimination method of a kind of peach branch ulcer bacteria (Phomopsis amygdali).
Background technology
Peach (Prunus persica) belongs to the temperate zone deciduous fruit tree, is a planting fruit-trees that originates in China.Peach variety is a lot, a kind surplus in the of nearly in the world 3000, and wherein China has more than 1000 kinds.According to they adaptability, growth characteristics and fruit characteristics, can be divided into some product populations to weather condition.
With fruit properties and maturity classification, specific as follows: as 1. to be divided into common peach, flat peach (being peento) by fruit shape.2. have or not by the pericarp fine hair and be divided into wild peach, nectarine, wherein nectarine is the individual event variation of common peach.3. be divided into freestone, clingstone and half clingstone by nuclear and the sticking of pulp from degree.Wherein clingstone is an Evolutionary Type, and freestone kind pulp organization is pine, and ripe inhomogenous phenomenon is arranged.Clingstone kind pulp is fine and close, and fiber is few, and fruit maturity is comparatively even, should process the system jar.4. be divided into 3 types in meat solute, meat non-solute and hard meat peach by fruit texture.Soft and succulency during solute type fruit maturation wherein, suitable eating raw.The solute type can be divided into reflowing matter type and hard solute type again.Strong but pliable in texture, full of elasticity during non-solute type fruit maturation, be suitable for processing system jar (but also requiring not red colouration of pulp).Pulp was hard and crisp when hard meat peach fruit was just ripe, was cement during complete ripeness, and change face, so be good with eating quality before the complete ripeness.5. be divided into plain boiled pork peach, yellow meat peach and red meat peach by pulp colour.6. be divided into special early maturing variety, early maturing variety, medium variety and late variety, special late variety by the fruit growth date.
With ecological classification, specific as follows: 1. northern product population.Mainly be distributed in North China, northwest, Central China one band.More with Shandong, Hebei, Beijing, Shanxi, Henan, Shaanxi, Gansu and Xinjiang cultivation.This product population is more cold-resistant and drought-enduring, and the warm many moistures of heatproof are not waited.2. southern product population.Mainly be distributed in the provinces such as Jiangsu, Zhejiang, Sichuan, Guizhou, Hubei and Hunan on the south China the Changjiang river.This area belongs to the wettability weather of north subtropical and middle subtropical zone.This product population can be divided into 3 types of honey peach, hard meat peach and peentos again.How circular the honey peach fruit is, the flat circle in top, and pericarp is easily peeled off, pulp soft and succulency, not storage tolerance.There is short point on hard meat peach fruit top, and suture line is shallow, and the meat hard ﹠ brittle is close, and juice is less, than storage tolerance.Peento pulp soft and succulency mostly is the honey peach type.3. southern Europe product population.System imports Europe into westwards by China Gansu, Xinjiang after the kind that long-term domestication forms.Mainly be distributed in the littoral all states in Mediterranean Sea.This area belongs to Mediterranean-mode climate, and is more suitable in the northern China cultivation.
China is except that the Heilongjiang Province, and other each provinces all have peach cultivation, main economic cultivation area in North China, the each province, East China, comparatively there are Haidian District Beijing, Pinggu county, Ji County, Tianjin, Feicheng, Shandong, Yidu, Qingdao in the area of Ji Zhonging, Shangshui, Henan, Kaifeng, Funing, Hebei, Zunhua, Shen Xian, Linzhang, Baoji, Xi'an, Chengdu, Sichuan, the Dalian, Fenghua, Zhejiang, Nanhui, Shanghai, Fengxian, jiangsu wuxi, Xuzhou.Add up national cultivated area according to data in 2007 and surpass 9,000,000 mu, produce 400,000 tons in peach, rank first in the world.Yellow peach is with fame spreading far and wide for Fenghua, Ningbo, Yangshan, Wuxi honey peach and Nanhui, Shanghai honey peach, Fengxian.Plant peach and become the important main income source of China various places peasant.
Disease species traditional on the peach is a lot, as resin disease, leaf-curl, brown heart or the like, is familiar with by the numerous orchard workers of China.Serious branch Peptic Ulcers takes place in spring in 2009 in the part orchard in the beautiful Huang Tao of Zhejiang Jiaxing base, honey peach base, Nanhui, Shanghai, the strain sickness rate reaches 30-40%, causes serious production loss.This disease is passed through leaf scar in the fall, infect the peach branch in spring by bud, bud scale scar, flower, fruit trace etc., ulcer is the center with node on the branch mainly, the initial stage sorrel, sink into dark brown gradually, can kill young shoot when disease develops into early summer and cause branch withered, and the branch fruit that causes thus falling ill can not be grown up and lost commodity.
Peach branch ulcer is a kind of by the fungal disease due to the Phomopsis amygdali infection process, yet there are no report in China at present.Should disease find first at N.J. in the world in 1934, find in states such as Maryland, Delaware, Virginia, New York, Massachusetts in succession in the 40-50 age in last century subsequently, after the nineties in last century in the Alabama, Georgia and southern Caro come that etc. the southeastern US area discovery is also arranged.
The present invention finds its cause of disease unanimity through the honey peach on ground such as China Shanghai, Zhejiang Jiaxing, the cause of disease of yellow peach branch ulcer are studied, and is Phomopsis amygdali germ, but the situation of this germ harm peach branch yet there are no report so far in China.Because the generation of peach fruit rot is also very serious, the present invention still studies it simultaneously, finds that its cause of disease is not Phomopsis amygdali, but Phomopsis belongs to other interior bacterial classification, and has the not mixed infection phenomenon of pathogenic fungi of the same race.Though the germ of harm peach branch ulcer, peach fruit rot is to belong to together not of the same racely, its bacterium colony, spore shape are similar, at molecular level notable difference are arranged.Therefore, set up the method for quick of peach branch ulcer bacteria, have very important realistic meaning and using value for this sick quick diagnosis and control.
Summary of the invention
Technical problem to be solved by this invention is to provide the specific PCR discrimination method of a kind of peach branch ulcer bacteria (Phomopsis amygdali), to remedy the blank of prior art.
The present invention obtains the pathogenic fungi (Phomopsis spp.) that multiple Phomopsis belongs to from causing that regional honey peach, yellow peach ulcer, septic fruits such as Shanghai separate, and finds their pathogenic bacteria and the plesiomorphism of peach branch ulcer bacteria Phomopsis amygdali.Entrust Shanghai to give birth to the order-checking of worker's biotechnology company limited these pathogenic fungies, honey peach, yellow peach branch Peptic Ulcers bacterial strain have been obtained respectively, multiple Phomopsis such as honey peach, yellow peach fruit rot bacterial strain belongs to pathogenic fungi, compare through the DNA similarity, find that honey peach and its characterization of molecules sequence similarity of Huang Tao branch Peptic Ulcers pathogenic bacteria reach 99%, and honey peach, yellow peach fruit rot germ and branch ulcer bacteria similarity are only at 89-95.9%.Though this explanation peach branch ulcer bacteria and peach fruit rot bacterium are similar and be difficult to differentiation on form, can distinguish differentiation by the characterization of molecules sequence.
Therefore, the invention provides a kind of specific PCR discrimination method of peach branch ulcer bacteria, at the characterization of molecules sequence difference of peach branch ulcer bacteria and peach fruit rot bacterium, it is right to design a plurality of primers, respectively peach branch ulcer bacteria, peach fruit rot germ is carried out the specific PCR amplified reaction.
Wherein amplification reaction system is 20 μ l, comprises template DNA 1 μ L, and primer is to (forward and reverse primer) each 2 μ L, dNTP mixture (every kind of 2.0mM/) 2 μ L, PCR reaction buffer (10 *) 2 μ L, MgCl
2Solution (25mmol/L) 2 μ L, Taq enzyme (1u/ μ L) 0.4 μ l replenishes deionized water to 20 μ l.
Amplification reaction condition is: 1 circulation of 95 ℃ of 3min; 95 ℃ of 45sec, 55-60 ℃ of 30sec, 72 ℃ of 30sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
With above-mentioned pcr amplification product through Agrose gel electrophoresis post analysis, found that: only have primer can go out the target fragment of peach branch ulcer bacteria (Phomopsis amygdali) by specific amplification, but can not in the Phomopsis sp. bacterium of all the similar peaches fruit rotten pathogenic bacterias and the U.S., amplify target fragment at 326bp to 4 pcr amplification method; Though the employing primer can amplify the target fragment of peach branch ulcer bacteria (Phomopsis amygdali) at 309bp to 6 pcr amplification method, but in 1 the rotten Phomopsis germ of fruit bacterial strain and 1 Phomopsis bacterial strain, also amplify identical 309bp fragment, in the rotten Phomopsis bacterial strain of other 1 fruit, amplify the fragment of 750-1000bp simultaneously from the U.S..Explanation thus: primer belongs to interior, as to belong to outer pathogenic fungi discriminating to 4 specific PCR augmentation detection and honey peach, yellow peach branch ulcer bacteria and other Phomopsis that can be used for peach branch ulcer bacteria, and primer can not to 6.
Described primer to 4 and primer as follows respectively to 6 sequence:
Primer is to 4:
Forward primer Pa-F2:5 ' GCCGGCCCCCTTCTG 3 '
Reverse primer Pa-R2:5 ' GCCTGCCTCGTTTTTACACA 3 '
Primer is to 6:
Forward primer Pa-F3:5 ' GGCCCCTCGTTCCTGAC 3 '
Reverse primer Pa-R2:5 ' GCCTGCCTCGTTTTTACACA 3 '
The specific PCR discrimination method of peach branch ulcer bacteria of the present invention can be used as a kind of evaluation peach branch ulcer bacteria Phomopsis amygdali, and Phomopsis belongs to interior, as to belong to outer other bacterial classification effective means.
Advantage of the present invention:
1) differentiates fast: finish qualification time and only need 3-4 hour; The traditional form authentication method needs the time long, induces the time that just needs more than 14 days for the only necessary pycnidium of its identification of morphology of phomopsis genus pathogenic fungi that the present invention relates to.
2) method sensitivity: the present invention can detect the above germ DNA quantity of 100fg.
3) specificity is good: can differentiate the phomopsis genus pathogenic fungi on peach branch and the fruit, traditional pass through pycnidium and the conidium form is difficult to difference.
4) easy and simple to handle: the present invention only needs 1 pcr amplification instrument and the required conventional reagent of pcr amplification reaction.
Therefore method of the present invention has very high practical value.
Description of drawings
Fig. 1 is the observations of peach branch ulcer pathogenic strains, and wherein A is the early stage bacterium colony of this bacterial strain, and B is the bacterium colony in mid-term of this bacterial strain, and C is the anaphase of this bacterial strain.
Fig. 2 is 1% gel electrophoresis figures of a plurality of primers to pcr amplification peach branch ulcer bacteria bacterial strain, wherein M:Marker; 1-2: primer is to 1; 3-4: primer is to 2; 5-6: primer is to 3; 7-8: primer is to 4; 9-10: primer is to 5; 11-12: primer is to 6; 13: negative control.
Fig. 3 is 1% gel electrophoresis figure of primer to 4,6 specific PCRs discriminating peach branch Peptic Ulcers bacterial strain, wherein M:Marker; The 1-10:PCR primer is to 4; The 11-20:PCR primer is to 6; 21: negative control; A: peach fruit decomposing disease bacterial strain; B: U.S. peach Phomopsis sp. germ strain; C: peach branch Peptic Ulcers bacterial strain.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
The collection of embodiment 1 pathogenic strains with obtain
Peach branch Peptic Ulcers bacterial strain and peach fruit decomposing disease bacterial strain all be from Shanghai, the ulcer branch of the honey peach of zhejiang and other places, Huang Tao and the sick sample collection of rotten fruit and obtain.After their diseased tissues adopted surperficial clorox or alcohol disinfecting, place potato sucrose nutrient agar (PSA) (potato 200 grams, sucrose 20 grams, agar 20 grams, 1000 milliliters of distilled water) on, cultivate after 2-3 days under 25 ℃ of conditions, will go to from the mycelia that diseased tissues grows on two other new PSA substratum.One of them culture dish continues to cultivate, and carries out the germ morphologic observation.Fig. 1 is the observations of peach branch Peptic Ulcers bacterial strain, and wherein A is the early stage bacterium colony of this bacterial strain, is white in color; B is the bacterium colony in mid-term of this bacterial strain, white particle occurs; C is the anaphase of this bacterial classification: develop into the pycnidium of black gradually, flaxen viscous material conidium can be formed on its top, is respectively ovalize α type spore and linear β type spore.The bacterium colony of peach fruit decomposing disease bacterial strain, conidium form are similar to peach branch Peptic Ulcers.
Another culture dish was cultivated after 3-4 days, provoke the honey peach of the inoculated by hypha block of isolate in health, on the branch or fruit of Huang Tao, (100% relative humidity) returns to the normal growth condition after preserving moisture 48-78 hour, (the peach Peptic Ulcers is for sinking into dark brown scab symptom same symptoms will to occur, the peach fruit rot is circular fruit rot spot symptom) sick branch or sick fruit, being placed on the PSA substratum by surperficial clorox or alcohol disinfecting diseased tissues once more separates, isolate in colonial morphology (white), spore shape (oval α type spore and linear β type spore) and original identical isolate of inoculating of germ obtain 2 peach branch Peptic Ulcers bacterial strains and 7 peach fruit decomposing disease bacterial strains respectively.
The mensuration of the characterization of molecules sequence of embodiment 2 peach branch ulcer and peach fruit decomposing disease bacterial strain
Peach Phytophthora spp bacterial strain and peach fruit decomposing disease bacterial strain that above-mentioned collection obtains are used Cha Shi nutrient solution (sucrose 30g respectively, nitric acid is received 3g, dipotassium hydrogen phosphate 1g, magnesium sulfate heptahydrate 0.5g, Repone K 0.5g, iron vitriol 0.01g, 1000 milliliters of distilled water) 24 ℃, 100 rev/mins, dark condition cultivate after 4-5 days down, filter acquisition germ mycelium with double gauze, extract the genomic DNA of germ mycelium with the urea extraction method then.
Described urea extraction method concrete steps are as follows: the mycelia sample that 0.5g is ground adds 10mL urea extracting solution (7mol/LUrea, 50mmol/L Tris-HCl pH 8.0,62.5mmol/L NaCl, 1%SDS), shake up, the centrifugal 5min of 12000r/min, draw supernatant liquor, supernatant liquor 12000r/min recentrifuge 5min, supernatant liquor is moved in another new pipe, added isopyknic phenol/chloroform/primary isoamyl alcohol (25: 24: 1, volume ratio) solution, with forced oscillation several mixing, the centrifugal 5min of 12000r/min; Get the 3mol/L NaAc (pH 5.2) that adds isopyknic Virahol and 1/10 volume in the new pipe of supernatant to, place 20min, the centrifugal 5min of 12000r/min for-20 ℃; Abandon supernatant liquor, inversion is flow to end tube wall liquid, and 70% dehydrated alcohol is washed precipitation, and room temperature is placed dry 5～10min, is dissolved in the 200 μ L distilled waters, adds RNase A (10 μ g/ μ L) 2 μ L, 37 ℃ of water-bath 30min, and-20 ℃ of preservations are standby.
The germ mycelium genomic dna of said extracted acquisition is carried out the pcr amplification of germ characteristic sequence.Amplification system is 20 μ l, comprises template DNA 1 μ L, each 2 μ L of primer P-F1 and P-R1 (10pmol/ μ L), dNTP mixture (every kind of 2.0mM/) 2 μ L, PCR reaction buffer (10 *) 2 μ L, MgCl
2Molten (25mmol/L) 2 μ L, Taq enzyme (1u/ μ L) 0.4 μ l replenishes deionized water to 20 μ l.Wherein, the sequence of described primer P-F1, P-R1 is as follows respectively:
P-F1：5’TCCGTAGGTGAACCTGCGG?3’；
P-R1：5’TCCTCCGCTTATTGATATGC?3’
Amplification condition is: 1 circulation of 94 ℃ of 3min; 94 ℃ of 1min, 55 ℃ of 30sec, 72 ℃ of 40sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
Entrust Shanghai to give birth to the order-checking of worker's biotechnology company limited the PCR product that above-mentioned amplification obtains, obtain the characterization of molecules sequence (SEQ ID No 2) of the characterization of molecules sequence (SEQ ID No 1) of honey peach branch Peptic Ulcers bacterial strain, yellow peach branch Peptic Ulcers bacterial strain, the characterization of molecules sequence ( SEQ ID No 3,4,5,6,7) of 5 bacterial strains of honey peach fruit canker, the characterization of molecules sequence (SEQ ID No 8,9) of 2 bacterial strains of yellow peach fruit canker respectively.
The branch Peptic Ulcers bacterial strain of embodiment 3 honey peachs and Huang Tao, the comparison of the characterization of molecules sequence similarity of peach fruit rot bacterial strain
The characterization of molecules sequence of branch ulcer bacteria, honey peach branch Peptic Ulcers bacterial strain and the strain of honey peach fruit rot germ of the honey peach of above-mentioned acquisition and Huang Tao is carried out the similarity comparison respectively.Found that: the characterization of molecules sequence similarity of the branch ulcer bacteria of honey peach and Huang Tao (SEQ ID No1 and 2) is 99%; Honey peach branch ulcer bacteria (SEQ ID No 1) is 89% with the characterization of molecules sequence similarity of honey peach fruit decomposing disease germ (SEQ ID No 5), specifically compares as follows.
1, honey peach and Huang Tao branch ulcer bacteria characterization of molecules sequence similarity comparison (grey sign place is that base does not exist together):
On: SEQ ID No 1
Down: SEQ ID No 2
cggcgcaggc?cggccccctt?ctgggggccc?ctcgttcctg?acgaggagca?ggctcgccgg
cggcgcaggc?cggccccctt?ctgggggccc?ctcgttcctg?acgaggagca?ggctcgccgg
aactttcaac?aacggatctc?ttggttctgg?catcgatgaa?gaacgcagcg?aaatgcgata
aactttcaac?aacggatctc?ttggttctgg?catcgatgaa?gaacgcagcg?aaatgcgata
agtaatgtga?attgcagaat?tcagtgaatc?atcgaatctt?tgaacgcaca?ttgcgccctc
agtaatgtga?attgcagaat?tcagtgaatc?atcgaatctt?tgaacgcaca?ttgcgccctc
tggtattccg?gagggcatgc?ctgttcgagc?gtcatttcaa?ccctcaagcc?tggcttggtg
tggtattccg?gagggcatgc?ctgttcgagc?gtcatttcaa?ccctcaagcc?tggcttggtg
atggggcact?gccttgtgta?aaaacgaggc?aggccctgaa?attcagtggc?gagctcgcca
atggggcact?gccttgtgta?aaaacgaggc?aggccctgaa?attcagtggc?gagctcgcca
ggactccgag?cgcagtagtt?aaaccctcgc?tttggaagga?ctggcggtgc?cctgccgtta
ggactccgag?cgcagtagtt?aaaccctcgc?tttggaagga?ctggcggtgc?cctgccgtta
atatcaataa?gcgga
atatcaataa?gcgga
2, the germ characterization of molecules sequence similarity of honey peach branch Peptic Ulcers and honey peach fruit rot comparison (grey sign place is that base does not exist together):
On: SEQ ID No 1
Down: SEQ ID No 5
aactttcaac?aacggatctc?ttggttctgg?catcgatgaa?gaacgcagcg?aaatgcgata
aactttcaac?aacggatctc?ttggttctgg?catcgatgaa?gaacgcagcg?aaatgcgata
agtaatgtga?attgcagaat?tcagtgaatc?atcgaatctt?tgaacgcaca?ttgcgccctc
agtaatgtga?attgcagaat?tcagtgaatc?atcgaatctt?tgaacgcaca?ttgcgccctc
The specific PCR amplification of embodiment 4 peach branch Peptic Ulcers bacterial strains
Similarity comparison result at the characterization of molecules sequence of above-mentioned peach branch ulcer bacteria and peach fruit rot germ, it is right to design 6 primers, and the Tm value right according to primer, determine the annealing temperature of pcr amplification, then peach branch ulcer bacteria is carried out pcr amplification, amplification reaction system is identical with embodiment 2.
Amplification reaction condition is as follows: 1 circulation of 95 ℃ of 3min; 95 ℃ of 45sec, 55-60 ℃ of 30sec, 72 ℃ of 30sec, 35 circulations; 1 circulation of 72 ℃ of 10min.
Through the 1%Agrose gel electrophoresis, the result shows with above-mentioned pcr amplification product: 6 primers that design in the test are to the target pathogenic bacteria--and peach branch ulcer bacteria can both amplify unique specific fragment (referring to Fig. 2) that 309-430bp is uneven in length respectively.
Wherein, six pairs of primers are as follows respectively to sequence:
Primer is to 1:
Forward primer Pa-F1:5 ' AACTTATACCTTACTGTTGCCTCG 3 '
Reverse primer Pa-R1:5 ' ACCGCCAGTCCTTCCAAA 3 '
Primer is to 2:
Forward primer Pa-F1:5 ' AACTTATACCTTACTGTTGCCTCG 3 '
Reverse primer Pa-R2:5 ' GCCTGCCTCGTTTTTACACA 3 '
Primer is to 3:
Forward primer Pa-F2:5 ' GCCGGCCCCCTTCTG 3 '
Reverse primer Pa-R1:5 ' ACCGCCAGTCCTTCCAAA 3 '
Primer is to 4:
Forward primer Pa-F2:5 ' GCCGGCCCCCTTCTG 3 '
Reverse primer Pa-R2:5 ' GCCTGCCTCGTTTTTACACA 3 '
Primer is to 5:
Forward primer Pa-F3:5 ' GGCCCCTCGTTCCTGAC 3 '
Reverse primer Pa-R1:5 ' ACCGCCAGTCCTTCCAAA 3 '
Primer is to 6:
Forward primer Pa-F3:5 ' GGCCCCTCGTTCCTGAC 3 '
Reverse primer Pa-R2:5 ' GCCTGCCTCGTTTTTACACA 3 '
Select two primers right from above-mentioned primer centering at last, be primer to 4 and primer the Phomopsis sp. bacterial strain that derives from the U.S. that 62 peach branch Peptic Ulcers bacterial strains that respectively embodiment 1 obtained, 7 peach fruit decomposing disease bacterial strains and 1 this laboratory are preserved totally 10 pathogenic bacteria bacterial strains carry out the specific PCR amplification, the amplification reaction system condition is identical with embodiment 2.
The 1%Agrose gel electrophoresis is the result show: the employing primer can go out the target fragment of peach branch ulcer bacteria (Phomopsis amygdali) at 326bp by specific amplification to 4 pcr amplification, but can not amplify target fragment in the Phomopsis sp. bacterium of all the similar peaches fruit rotten pathogenic bacterias and the U.S.; Though the employing primer can amplify the target fragment of peach branch ulcer bacteria (Phomopsis amygdali) at 309bp to 6 pcr amplification, but in 1 the rotten Phomopsis germ of fruit bacterial strain and 1 Phomopsis bacterial strain, also amplify identical 309bp fragment, in the rotten Phomopsis bacterial strain of other 1 fruit, also amplify the fragment (referring to Fig. 3) of 750-1000bp simultaneously from the U.S..
Above-mentioned experimental result explanation: primer belongs to interior, as to belong to outer pathogenic fungi discriminating to 4 specific PCR augmentation detection and honey peach, yellow peach branch ulcer bacteria and other Phomopsis that can be used for peach branch ulcer bacteria, and primer can not to 6.
Need to prove, those skilled in the art are after having read the above-mentioned content of lecturing of the present invention, can shorten or prolong 4 sequences primer, carry out pcr amplification, can obtain primer of the present invention to 4 obtained effects, these equivalent form of values fall within the restricted portion those skilled in the art of the application's appended claims institute equally in technology of the present invention.
Claims (6)
1. the specific PCR discrimination method of a peach branch ulcer bacteria, it is characterized in that, adopt primer to carry out pcr amplification to 4, its forward primer sequence is Pa-F2:5 ' GCCGGCCCCCTTCTG 3 ', and the reverse primer sequence is Pa-R2:5 ' GCCTGCCTCGTTTTTACACA 3 '.
2. specific PCR discrimination method according to claim 1 is characterized in that, described peach branch ulcer bacteria is Phomopsis amygdali.
3. the application of the described specific PCR discrimination method of claim 1 in peach branch ulcer bacteria is differentiated.
4. primer is to 4 or its extension or shorten the application of sequence in peach branch ulcer bacteria specific PCR is differentiated.
5. primer is to 4 or its extension or shorten sequence application in other pathogen species discriminatings in Phomopsis amygdali and Phomopsis belong to.
6. primer is to 4 or its extension or shorten sequence application in other pathogen species discriminatings outside Phomopsis amygdali and Phomopsis belong to.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110136552 CN102229985B (en) | 2011-05-25 | 2011-05-25 | Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110136552 CN102229985B (en) | 2011-05-25 | 2011-05-25 | Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102229985A true CN102229985A (en) | 2011-11-02 |
| CN102229985B CN102229985B (en) | 2012-12-26 |
Family
ID=44842590
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110136552 Expired - Fee Related CN102229985B (en) | 2011-05-25 | 2011-05-25 | Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102229985B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671196A (en) * | 2016-04-19 | 2016-06-15 | 中华人民共和国无锡出入境检验检疫局 | Primer and probe for fluorescence quantitative PCR of phomopsis amydalina TaqMan |
| CN106048010A (en) * | 2016-06-03 | 2016-10-26 | 伊犁出入境检验检疫局综合技术服务中心 | RPA (recombinase polymerase amplification) technology based method for detecting phomopsis helianthi, RPA primers and kit |
| CN113718051A (en) * | 2021-08-30 | 2021-11-30 | 扬州大学 | Specific PCR detection method for peach branch blight bacteria |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5149624A (en) * | 1986-10-07 | 1992-09-22 | University Of Florida | Method for detecting bacterial or fungal diseases in plants |
| CN101899509A (en) * | 2010-07-06 | 2010-12-01 | 王有福 | Primers and probe used for real-time fluorescent PCR assay of apricot chlorotic leafroll phtoplasma and method thereof |
-
2011
- 2011-05-25 CN CN 201110136552 patent/CN102229985B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5149624A (en) * | 1986-10-07 | 1992-09-22 | University Of Florida | Method for detecting bacterial or fungal diseases in plants |
| CN101899509A (en) * | 2010-07-06 | 2010-12-01 | 王有福 | Primers and probe used for real-time fluorescent PCR assay of apricot chlorotic leafroll phtoplasma and method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 曾蓉等: "桃树树枝溃疡病病原鉴定", 《中国植物病理学会2010年学术年会论文集》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671196A (en) * | 2016-04-19 | 2016-06-15 | 中华人民共和国无锡出入境检验检疫局 | Primer and probe for fluorescence quantitative PCR of phomopsis amydalina TaqMan |
| CN105671196B (en) * | 2016-04-19 | 2019-03-01 | 中华人民共和国无锡出入境检验检疫局 | Almond Phomopsis TaqMan fluorescence quantification PCR primer and probe |
| CN106048010A (en) * | 2016-06-03 | 2016-10-26 | 伊犁出入境检验检疫局综合技术服务中心 | RPA (recombinase polymerase amplification) technology based method for detecting phomopsis helianthi, RPA primers and kit |
| CN113718051A (en) * | 2021-08-30 | 2021-11-30 | 扬州大学 | Specific PCR detection method for peach branch blight bacteria |
| CN113718051B (en) * | 2021-08-30 | 2023-06-23 | 扬州大学 | Specific PCR detection method for peach blossom blight |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102229985B (en) | 2012-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112899201B (en) | Bacillus belgii, application thereof and method for preventing and treating banana wilt | |
| CN111534439B (en) | Penicillium oxalicum SDF-25 strain and application thereof | |
| CN102229985B (en) | Specificity PCR (Polymerase Chain Reaction) identifying method of phomopsis amygdali | |
| CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
| CN110734921A (en) | Detection method of kinds of anthracnose bacteria Colletotrichum siamense of tea trees | |
| CN112175887B (en) | Brevundimonas oleifera strain and application thereof | |
| CN107893034B (en) | A kind of identification of needle mushroom pathogenetic bacteria and the screening technique of disease-resistant white gold needle mushroom bacterial strain | |
| Guo-yin et al. | Morphological, molecular and pathogenic characterization of Alternaria longipes, the fungal pathogen causing leaf spot on Atractylodes macrocephala | |
| Sekizaki et al. | Identification of Armillaria nabsnona in Gastrodia tubers | |
| CN104132940A (en) | Convenient observation method of orchid mycorrhiza microstructure | |
| US20230100319A1 (en) | A New Strain of Flammulina fennae and its molecular marker primers and molecular marker method | |
| Hashem et al. | Indigenous yeasts of the rotten date fruits and their potentiality in bioethanol and single-cell protein production. | |
| CN109022538B (en) | Indoor identification method for watermelon anthracnose resistance | |
| CN104126508B (en) | The method of the quick Mycorrhizal of a kind of orchid aseptic seedling | |
| Schaal | VOL. 69 WASHINGTON, DC, SEPTEMBER 1, 1943 No. 5 VARIATION AND PHYSIOLOGIC SPECIALIZATION IN THE COMMON SCAB FUNGUS (ACTINOMYCES SCABIES) ¹ | |
| CN108441443B (en) | Strain for preventing and treating plant nematodes and application thereof | |
| CN110438049A (en) | One plant of tobacco mosaic viruses biological and ecological methods to prevent plant disease, pests, and erosion Yi Shi pseudoalteromonas bacterial strain and its application | |
| CN114507618B (en) | Oncomelania mycorrhizal fungus strain TP-11 with dendrobium new leaf growth promoting capability and application thereof | |
| CN114395486B (en) | Adhesive film fungus strain TP-3 with high growth promoting capability of dendrobium and application thereof | |
| CN113999804A (en) | Rhizobium SCAUY033 and application thereof | |
| CN107488608B (en) | Streptomyces albidoflavus Z9 and application thereof in preventing and treating sunflower sclerotiniose | |
| Robles Yerena et al. | Fusarium oxysporum Schltdl. and Fusarium solani (Mart.) Sacc. cause wilting of Pinus spp. seedlings in the nursery | |
| CN105886416A (en) | Alcaligens faecalis for preventing and treating plant root cancers and use thereof | |
| CN103525707A (en) | Nectria rigidiuscula and application thereof in preparation of bacterium grain wood | |
| CN109566271A (en) | It is a kind of for cultivating the culture medium of wild crimping net gill fungus parent species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: SHANGHAI DONGBAO AGRICULTURAL TECHNOLOGY CO., LTD. Effective date: 20140418 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20140418 Address after: 201106 Shanghai city Minhang District North Zhai Road No. 2901 Patentee after: Shanghai Academy of Agricultural Sciences Patentee after: Shanghai Dongbao Agricultural Technology Co., Ltd. Address before: 201106 Shanghai city Minhang District North Zhai Road No. 2901 Patentee before: Shanghai Academy of Agricultural Sciences |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121226 Termination date: 20180525 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |