CN102229955B - Application of light harvesting chlorophyll a/b binding protein (LHCB6) in plant breeding - Google Patents

Abstract

The invention discloses an application of a light harvesting chlorophyll a/b binding protein (LHCB6) in plant breeding. The invention provides the application of LHCB6 protein in improving the stress tolerance of plant. The stress tolerance is threatened by a hormone which is ABA. The nucleotide sequence of the LHCB6 protein coding genes is the sequence 2 of the sequence list. The stress tolerance of plant is 1) or 2) as follows: 1) introducing LHCB6 protein coding genes to a mutant plant with inactivated expression of LHCB6 to obtain a plant with recovered expression of LHCB6 protein, the plant with recovered expression of LHCB6 protein has higher stress tolerance than the mutant plant with inactivated expression of LHCB6; and 2) the mutant plant with inactivated expression of LHCB6 protein has higher stress tolerance than the plant with expression of LHCB6. Experiments in the invention prove that ABA adjusts the expression of LHCB6 through a signal path involved in ABAR/CHLH.

Description

Catch the application of the conjugated protein LHCB6 of photopigment chlorophyll a/b in plant breeding

Technical field

The present invention relates to biological technical field, relate in particular to a kind of application of the conjugated protein LHCB6 of photopigment chlorophyll a/b in plant breeding of catching.

Background technology

Light harvesting chlorophyll a/b conjugated protein (LHCB) is the lipophorin of photosynthetical system II (PSII) complex body.LHCB albumen is usually caught the optical antenna complex body with chlorophyll, xenthophylls composition complex body become photosynthetical system.These are caught the optical antenna complex body and absorb luminous energy and transmit excitation energy to drive photosynthetic electron transport system to PSII photoresponse center.The exterior antenna albumen LHCBs of PSII complex body catches the integral part that the photorecombination body weight is wanted, and it is the abundantest membranin of occurring in nature content.LHCBs albumen is by less antenna complex body: LHCB4 (CP29), LHCB5 (CP26) and LHCB6 (CP24) and bigger antenna complex body: homology and allogenic tripolymer LHCB1, LHCB2 and LHCB3.

These chloroplast(id)/thylakoid proteins are by nuclear gene encoding, and it is expressed factors such as mainly being subjected to environment and growth and regulates, and comprises mainly being subjected to light (Silverthorne and Tobin, 1984; Sun and Tobin, 1990; Peer et al, 1996; Millar and Kay, 1996; Weatherwax et al, 1996; Yang et al, 1998; H μ Mbeck and Krupinska, 2003; Nott et al, 2006; Staneloni et al, 2008; De Montaigu et al, 2010; Pruneda-Paz and Kay, 2010; Thines and Harmon, 2010); Active oxygen (Nott et al, 2006; Staneloni et al, 2008), the reverse signal of chloroplast(id) (Nott et al, 2006), diel rhythm (Paulsen and Bogorad, 1988; Strayer et al, 2000; Alabadi et al, 2001; Thain et al, 2002; Andronis et al, 2008; Pruneda-Paz et al, 2009; De Montaigu et al, 2010; Pruneda-Paz and Kay, 2010; Thines and Harmon, 2010) and regulation and control (Bartholomew et al, 1991 of bio-hormone dormin (ABA); Chang and Walling, 1991; Weatherwax et al, 1996; Staneloni et al, 2008).Plant is considered to plant to the adjusting of LHCB protein expression and regulates the chloroplast(id) function with one of the important mechanisms of reply adverse circumstance (Nott et al, 2006; De Montaigu et al, 2010; Pruneda-Paz and Kay, 2010; Thines and Harmon, 2010).

ABA is the important biomolecule hormone of coordinate plant growth and growth, especially in (Finkelstein et al, 2002 of playing an important role aspect the plant responding adverse circumstance; Adie et al, 2007).It is believed that ABA negative regulation LHCB expression of gene in the past, and regulated the expression of LHCB with response high light adverse circumstance (Bartholomew et al, 1991 with the light synergy; Chang and Walling, 1991; Weatherwax et al, 1996; Staneloni et al, 2008).The expression that high light is turned down LHCB may be (Weatherwax et al, 1996) that the change by ABA concentration in the plant materials realizes.Yet ABA is not understood fully for the physiological significance of LHCB genetic expression.

ABA signal transduction process has obtained extensive studies, and people identify and obtained many moietys of participating that this is comprising being positioned at cytolemma and intracellular ABA acceptor.Plasmalemma protein GCR2 and GTG1/GTG2 are considered to be in the ABA acceptor that cell surface works.One class START albumen PYR/PYL/RCAR is considered to act on intracellular ABA acceptor, and the upstream that directly acts on the PP2C signal path is to regulate the expression of downstream gene.The H subunit (CHLH/ABAR) of having reported magnesium porphyrin IX (Mg-ProtoIX) chelatase in the Arabidopis thaliana can act on ABA signal transduction process in conjunction with ABA as the ABA acceptor.Recently, reported that again ABAR can suppress the expression of some ABA responsive genes in conjunction with one group of WRKY transcription factor, as ABI5.In fact, thus ABA is considered to plant with diel rhythm be subjected to a key link between the ABA regulation and control response drought environment.ABAR/CHLH also plays many effects in vegetable cell: the combining of catalysis magnesium ion and porphyrin IX in the chlorophyll building-up process, and as the reverse signal transduction process of genome uncoupling protein (GUN5) mediation plastid-nuclear.

ABAR/CHLH is not only the ABA acceptor, also has the GUN phenotype and participate in regulating the LHCB expression of gene in the reverse signal of chloroplast(id).

Summary of the invention

An object of the present invention is to provide a kind of method of controlling plant proterties.

The invention provides the method for controlling plant proterties, is the expression that improves LHCB6 protein coding gene in the plant that sets out, and obtains having following 1) or 2) the purpose plant of feature:

1) resistance of reverse is higher than the described plant that sets out;

2) delayed growth is in the described plant that sets out.

It is following A or B that described purpose plant-growth delays in the described plant that sets out:

The sprouting of A, described purpose plant seed is later than the described plant that sets out;

The growth of B, described purpose roots of plants is later than the described plant that sets out;

The sprouting of described purpose plant seed is later than the described plant that sets out and is presented as that the germination rate of described purpose plant seed is lower than the described plant that sets out;

The growth of the root of described purpose plant seed is later than the described plant that sets out and is presented as that described purpose roots of plants length is less than the described plant that sets out;

Described raising is set out, and the expression of LHCB6 encoding gene is to carry out under hormone is coerced in the plant;

Described hormone is specially ABA;

The nucleotides sequence of the proteic encoding gene of described LHCB6 is classified the sequence 1 in the sequence table as.

Described resistance of reverse is drought-resistant property;

The described plant that sets out is monocotyledons or dicotyledons, and described monocotyledons is an Arabidopis thaliana.

Described raising is set out, and the expression of LHCB6 encoding gene realizes by import described LHCB6 encoding gene in the plant that sets out in the plant.

Described ABA coerces to becoming carry out the length of time in plant seedlings phase or plant;

Described concentration of coercing at plant seedlings phase ABA is 0.5-5 μ M; Described concentration of coercing at plant seedlings phase ABA is specially 0.5 μ M, 1 μ M, 2 μ M, 3 μ M or 5 μ M;

Describedly become concentration that the length of time, ABA coerced to be lower than 200 μ M plant but be not 0 μ M, be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M.

Described drought-resistant property embodies by stomatal aperture and/or percentage of water loss;

Described root growth embodies by main root length.

The expression of described raising LHCB6 encoding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize.

Described activation ABAR-WRKY40 signal path is the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB6 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB6, the LHCB6 encoding gene is expressed;

The aminoacid sequence of described ABA acceptor is the sequence 2 in the sequence table;

The nucleotides sequence of the encoding gene of described ABA acceptor is classified the sequence 3 in the sequence table as;

The aminoacid sequence of described transcription factor WRKY40 is the sequence 4 in the sequence table;

The nucleotides sequence of the encoding gene of described transcription factor WRKY40 is classified the sequence 5 in the sequence table as;

The nucleotides sequence of described LHCB6 promotor is classified the sequence 6 in the sequence table as.

Another object of the present invention provides a kind of method of controlling plant proterties.

Method provided by the invention is the expression that reduces LHCB6 protein coding gene in the purpose plant, obtains having following 1) or 2) plant of feature:

1) resistance of reverse is lower than described purpose plant;

2) growth adds faster than described purpose plant.

It is following A or B that the growth of described plant adds faster than the described plant that sets out:

A) sprouting of the seed of described plant is early than described purpose plant;

B) growth of the root of described plant is early than described purpose plant;

The sprouting of the seed of described plant is presented as that early than described purpose plant the germination rate of seed of described plant is greater than described purpose plant;

The growth of the root of described plant is presented as that early than described purpose plant the root of described plant grows up in described purpose plant;

The expression of LHCB6 protein coding gene is to carry out under hormone is coerced in the described reduction purpose plant;

Described hormone is specially ABA;

The nucleotides sequence of the proteic encoding gene of described LHCB6 is classified the sequence 1 in the sequence table as;

Described resistance of reverse is drought-resistant property;

The described plant that sets out is monocotyledons or dicotyledons, and described monocotyledons is an Arabidopis thaliana;

Described ABA coerces to becoming carry out the length of time in plant seedlings phase or plant;

Described concentration of coercing at plant seedlings phase ABA is 0.5-5 μ M; Described concentration of coercing at plant seedlings phase ABA is specially 0.5 μ M, 1 μ M, 2 μ M, 3 μ M or 5 μ M;

Describedly become concentration that the length of time, ABA coerced to be lower than 200 μ M plant but be not 0 μ M, be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M;

Described drought-resistant property specifically embodies by stomatal aperture and/or percentage of water loss;

Described root growth specifically embodies by main root length;

The expression of described reduction LHCB6 encoding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize;

Described activation ABAR-WRKY40 signal path is specially the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB6 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB6, the LHCB6 encoding gene is expressed;

The aminoacid sequence of described ABA acceptor is the sequence 2 in the sequence table;

The nucleotides sequence of the encoding gene of described ABA acceptor is classified the sequence 3 in the sequence table as;

The aminoacid sequence of described transcription factor WRKY40 is the sequence 4 in the sequence table;

The nucleotides sequence of the encoding gene of described transcription factor WRKY40 is classified the sequence 5 in the sequence table as;

The nucleotides sequence of described LHCB6 promotor is classified the sequence 6 in the sequence table as.

The 3rd purpose of the present invention provides the method that improves a kind of plant stress tolerance or delay plant-growth.

Method provided by the invention comprises the steps: with ABA plant to be coerced, and obtains having the plant of following proterties:

1) the purpose plant stress tolerance is higher than the plant that sets out;

2) delayed growth of purpose plant is in the plant that sets out;

Plant before handling is remembered the plant that sets out, the plant note after handling is done the purpose plant.

Described ABA coerces to becoming carry out the length of time in plant seedlings phase or plant;

Described concentration of coercing at plant seedlings phase ABA is 0.5-5 μ M; Described concentration of coercing at plant seedlings phase ABA is specially 0.5 μ M, 1 μ M, 2 μ M, 3 μ M or 5 μ M;

Describedly become the concentration that the length of time, ABA coerced to be lower than 200 μ M, be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M plant;

The described plant that sets out is monocotyledons or dicotyledons, and described monocotyledons is an Arabidopis thaliana.

Described feature also is embodied in following 1)-6) in any:

1) coerce down at ABA, the wild-type plant resistance of reverse is higher than the mutant lhcb6 of LHCB6 protein expression inactivation;

2) coerce down at ABA, LHCB6 albumen is crossed the expression plant stress tolerance and is higher than wild-type plant;

Described LHCB6 albumen is crossed the expression plant for the proteic encoding gene of LHCB6 is imported wild-type plant, obtains LHCB6 albumen and crosses the expression plant;

3) coerce down at ABA, the germination rate of the seed of wild-type plant is lower than the mutant lhcb6 of LHCB6 protein expression inactivation;

4) coerce down at ABA, LHCB6 albumen is crossed the germination rate of expressing plant seed and is lower than wild-type plant;

5) coerce down at ABA, the root length of wild-type plant is lower than the mutant lhcb6 of LHCB6 protein expression inactivation;

6) coerce down at ABA, LHCB6 albumen is crossed expression roots of plants length and is lower than wild-type plant.

Of the present invention experimental results show that, the expression that ABA regulates LHCB6 is the signal path that participates in by ABAR/CHLH, each LHCB family member's normal expression needs the participation of ABA, and the ABA of high density promotes the expression of LHCB in the physiological level, WRKY40 directly acts on the LHCB gene as negative regulon, LHCB participates in ABA signal transduction process by the signal path of ABAR-WRKY40 mediation, be a positive regulon in the ABA signal transduction process, seed germination, growth of seedling and stomatal movement isophenous that response ABA regulates.

Description of drawings

The fluorescence quantitative PCR detection that Fig. 1 expresses for LHCB6 crosses and the RNAi strain is

Fig. 2 stimulates mRNA and the proteic expression of LHCBs for ABA

Fig. 3 stimulates LHCB6 in phenotype aspect seed germination and the growth of seedling for ABA

Fig. 4 stimulates the influence of LHCB6 to stomatal movement and drought stress for ABA

Fig. 5 stimulates the influence of LHCB6 to germination rate, stomatal movement and drought stress for ABA

Fig. 6 was that expression LHCB6 gene makes seed germination super quick to ABA

Fig. 7 expresses in the lhcbs mutant for 35S drives the LHCBs gene, recovers the phenotype of plant

Fig. 8 expresses fully for LHCB gene under the ABA stimulation

Fig. 9 expresses in different histoorgans for the LHCBs gene

Figure 10 transcribes the sub-WRKY40 of inhibition to combine with LHCB family member's promotor

Figure 11 suppresses the LHCB expression of gene for WRKY40

Figure 12 is a LHCB expression of gene in the abar-3 mutant

Figure 13 is the molecule and the biochemistry detection of lhcb double-mutant and lhcbcch double-mutant

Figure 14 is the expression of ROS stable state and a series of ABA responsive genes in the lhcb mutant

Figure 15 makes the wrky40 mutant partly return to wild-type status to the susceptibility of ABA for the LHCB2 gene expression amount reduces

Figure 16 is molecule and the biochemical identification of mutant lhcb1-6.

Figure 17 is endogenous aba content and a dry matter content mensuration in the different lhcb mutant

Figure 18 does not have the gun phenotype for wrky40 and wrky40wrky18 mutant

The mode chart that Figure 19 increases for LHCBs albumen response physiological level concentration ABA

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Agents useful for same etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

Material used among the following embodiment is as follows:

1, T-DNA inserts mutant and comprises that the lhcb1.1 (SALK-134810) of LHCB1.1 gene (At1g29920) is (hereinafter to be referred as lhcb1, LHCB1 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), the lhcb2.2 (SALK-005614) of LHCB2.2 gene (At2g05070) is (hereinafter to be referred as lhcb2, LHCB2 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), LHCB3 gene (At5g54270, LHCB3 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not have to change) lhcb3 (SALK-036200), the lhcb4.3 (SALK-032779) of LHCB4.3 gene (At2g40100) is (hereinafter to be referred as lhcb4, LHCB4 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), lhcb5 (the SALK-139667 of LHCB5 gene (At4g10340), LHCB5 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), lhcb6 (the SALK-074622 of LHCB6 gene (At1g15820), LHCB6 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), the seed of these mutant is all available from ABRC.

2, available from cold spring harbor laboratory, this mutant has a Ds transposon to insert at second exon of WRKY40 (At1g80840) gene to wrky40-1 (ET5883, the environmental background of Ler is hereinafter to be referred as the wrky40 mutant).The wrky40-1 mutant is to be transformed into the Col background by backcrossing from the Ler background.

Wrky18-1 (SALK-093916) is that the T-DNA insertion on first exon of WRKY18 (At4g31800) gene knocks out mutant available from ABRC, has identified it is two amorphss before these two mutant.

3, two sudden changes

All double-mutants all pass through hybridization and the PCR evaluation obtains: the double-mutant construction process: the petal that a kind of mutant is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming or not blooming in the another kind of mutant, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation.

4, cch mutant (Col background, the mutant of ABA acceptor) (Shen Y-Y, Wang X-F, Wu F-Q, Du S-Y, Cao Z, Shang Y, Wang X-L, Peng C-C, Yu X-C, Zhu S-Y, Fan R-C, Xu Y-H, Zhang D-P (2006) .The Mg-chelatase H subunit is an abscisic acid receptor.Nature 443:823-826, the public can obtain from Tsing-Hua University.) present by doctor J.Chory.

5, ABA synthesis mutant aba2 (CS156:aba2-1, Col background, ABA acceptor) is available from ABRC.

Plant growing condition: MS substratum in illumination box 19-20 ℃, light intensity is 80 μ molm- ²s ^-1, illumination intensity is 120 μ molm-when growing in the soil ²s ^-1, 16h illumination.

6, cross expression Arabidopis thaliana and RNAi Arabidopis thaliana

1), LHCB6 crosses expression vector pCAMBIA1300-LHCB6

Extract the genomic dna of the Arabidopis thaliana plant that Colombia (Col-0) ecotype is a background (ABRC:CS60000, hereinafter to be referred as the wild-type Arabidopis thaliana, note is made col), carry out pcr amplification with following primer:

forward?primer：5’-GCTCTAGAATGGCGATGGCGGTCTCC-3’

reverse?primer：5’-CGGTCGACTCACAAACCAAGAGCACCGAG-3’

Obtain the PCR product of 777bp, through order-checking, this product be the sequence 1 (the LHCB6 gene ORF is 777bp) in the sequence table.

The PCR product is cut through XbaI and SalI enzyme, obtaining enzyme cuts after product and cuts pCAMBIA1300 (the Shang Y that obtains through same enzyme, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935 contains 35S promoter and the green fluorescent protein (GFP) of cauliflower mosaic virus, and the public can obtain from Tsing-Hua University.) the big fragment connection of carrier, obtain connecting the product transformed into escherichia coli, extract the transformant plasmid, the carrier that checks order and obtain, called after pCAMBIA1300-LHCB6 between the XbaI that the sequence in the sequence table 1 (LHCB6 gene ORF) inserted pCAMBIA1300 and SalI restriction enzyme site.

2), the RNAi interference carrier pSK-int-LHCB6-R of LHCB6

Extracting Colombia (Col-0) ecotype is the genomic dna of the Arabidopis thaliana plant of background, carries out pcr amplification with following primer:

forward?primer：5’-CGGTCGACATGGCGATGGCGGTCTCC-3’

reverse?primer：5’-CCATCGATCGAGCCATCGAGCCATTCAG-3’

Obtain the fragment (sequence 1 is from 5 ' terminal 1-228 position) of 228bp, through order-checking, this PCR product has the 182-410 position Nucleotide of AF332425, is the fragment of the 228-bp of 1 to 228bp specific combination after the cDNA initiator codon of LHCB6.

After the fragment of above-mentioned 228bp cut with the SalI/ClaI enzyme, and cut pSK-int carrier (Shen Y-Y, the Wang X-F that obtains through same enzyme, Wu F-Q, Du S-Y, Cao Z, Shang Y, Wang X-L, Peng C-C, Yu X-C, Zhu S-Y, Fan R-C, Xu Y-H, Zhang D-P (2006) .The Mg-chelatase H subunit is an abscisic acid receptor.Nature 443:823-826, the public can obtain from Tsing-Hua University.) the fragment connection, obtain connecting product, to connect product changes in the intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, the result inserts the carrier that obtains between the SalI/ClaI restriction enzyme site of pSK-int carrier, called after pSK-int-228 for this plasmid for the fragment forward with 228bp.

After the fragment of 228bp cut with the EcoRI/XbaI enzyme, cutting the pSK-int-228 carrier that obtains with the same enzyme of process is connected, obtain connecting product, to connect product changes in the intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, the result for this plasmid for the fragment of 228bp is oppositely inserted the carrier that obtains between the SalI/ClaI restriction enzyme site of pSK-int-228 carrier, called after pSK-int-LHCB6-R, plasmid is with the fragment forward of 228bp, oppositely inserts in the pSK-int-228 carrier, be the RNAi interference carrier.

3), LHCB6 crosses and expresses that Arabidopis thaliana, RNAi change the LHCB6 Arabidopis thaliana, LHCB6 cch crosses the acquisition of expressing Arabidopis thaliana

Above-mentioned expression vector pCAMBIA1300-LHCB6 excessively and RNAi interference carrier pSK-int-LHCB6-R are transformed into agrobacterium tumefaciens GV3101 bacterial strain (Shang Y respectively, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.), bacterium 1 and reorganization bacterium 2 obtain recombinating.Extract the plasmid of reorganization bacterium 1 and reorganization bacterium 2 respectively, order-checking respectively, the result is pCAMBIA1300-LHCB6 for the plasmid of reorganization bacterium 1, the plasmid of bacterium 2 of heavily continuing is pSK-int-LHCB6-R, the bacterium 1 called after GV3101/pCAMBIA1300-LHCB6 that will recombinate, bacterium 2 called after GV3101/pSK-int-LHCB6-R will recombinate.

GV3101/pCAMBIA1300-LHCB6 and GV3101/pSK-int-LHCB6-R are infected the wild-type Arabidopis thaliana by the petal osmose process respectively, obtain T0 and cross expression Arabidopis thaliana and T0 for LHCB6 and change the LHCB6 Arabidopis thaliana for RNAi.

GV3101/pCAMBIA1300-LHCB6 is infected the cch mutant by the petal osmose process, obtain T0 and cross the expression Arabidopis thaliana for LHCB6 cch.

Respectively from T0 for LHCB6 cross expression Arabidopis thaliana, T0 for RNAi change the LHCB6 Arabidopis thaliana, T0 crosses the expression Arabidopis thaliana for LHCB6 cch and gathers in the crops seed, sowing, continue to go down to posterity, up to obtain respectively T3 for LHCB6 cross expression Arabidopis thaliana, T3 for RNAi change the LHCB6 Arabidopis thaliana, that T3 crosses the expression Arabidopis thaliana for LHCB6 cch is stand-by.

Extract T3 and cross expression Arabidopis thaliana, T3 cross the expression Arabidopis thaliana for LHCB6 cch for RNAi commentaries on classics LHCB6 Arabidopis thaliana, T3 RNA for LHCB6, it is template that reverse transcription obtains cDNA, carrying out fluorescent quantitation detects, with LHCB6:forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ' reverse primer:5 '-CCATGGCGTTGCCCACTCA-3 ' is primer, is confidential reference items with β-Actin;

The primer of confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ';

reverse?primer?5’-AACGACCTTAATCTTCATGCTGC-3’；

Each numerical value all is three independent biology multiple mean values.With wild-type Arabidopis thaliana col and cch mutant is contrast.

The result is shown in Figure 1A, four LHCB6 of fluorescence quantitative PCR detection cross the (OE1 of expression Arabidopis thaliana strain system, OE2, OE5, OE8) and three RNAi change LHCB6 Arabidopis thaliana (R8, R9, R18) strain system, the mRNA relative expression quantity of the LHCB6 gene among col, OE1, OE2, OE5, OE8, R8, R9, the R18 is respectively 0.85,1.05,1.30,1.45,1.10,0.38,0.45,0.30; Compare with the expression amount among the wild-type Arabidopis thaliana col, in crossing expression strain system, raise, reduce in the RNAi strain system.

LHCB6 crosses three transgenic line (cch/LHCB6-4 of expression at cch, cch/LHCB6-5, and cch/LHCB6-10) the mRNA relative expression quantity result of the LHCB6 in is shown in Figure 1B, col, cch, cch/LHCB6-4, cch/LHCB6-5, and cch/LHCB6-10 is respectively 0.82,0.58,0.90,0.90,1.00; The result shows in the transgenic line suitable with wild-type.

7, the acquisition of the complementary Arabidopis thaliana of lhcbs mutant

Extract the Arabidopis thaliana plant that Colombia (Col-0) ecotype is a background (ABRC, genomic dna CS60000) carry out pcr amplification with following primer:

forward?primer：5’-TCCCCCGGGATGGCCGCCTCAACAATGG-3’(SmaI)

reverse?primer：5’-ACGCGTCGACTCACTTTCCGGGAACAAAGTTG-3’(SalI)

Obtain the PCR product of 777bp, through order-checking, this product has the Nucleotide shown in the sequence 1 (LHCB6 gene ORF) in the sequence table.

The PCR product is cut through SmaI and SalI enzyme, obtain enzyme and cut after product, this enzyme is cut after product and the pCAMBIA1300-221 carrier (Shang Y, Yan L, the Liu ZQ that cut through same enzyme, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) connect, obtain transformant, extract the plasmid of transformant, through order-checking, this plasmid is the carrier that obtains between the SmaI of the sequence in the sequence table 1 (LHCB6 gene ORF) insertion pCAMBIA1300-221 carrier and SalI restriction enzyme site, called after pCAMBIA1300-221-LHCB6.

Change pCAMBIA1300-221-LHCB6 over to agrobacterium tumefaciens GV3101 bacterial strain, bacterium 3 obtains recombinating, extract plasmid and send to order-checking, the result is pCAMBIA1300-221-LHCB6 for the plasmid of reorganization bacterium 3, and bacterium 3 called after GV3101/pCAMBIA1300-221-LHCB6 will recombinate.

GV3101/pCAMBIA1300-221-LHCB6 is infected mutant lhcb6 by the petal osmose process, obtain T0 for the complementary Arabidopis thaliana of LHCB6.

T0 is planted, sows for the complementary Arabidopis thaliana receipts of LHCB6, continue to go down to posterity, up to obtaining T3 for the complementary Arabidopis thaliana of LHCB6, be the complementary Arabidopis thaliana of lhcbs mutant, note is made lhcb6 ^*

8, ch1-1 is the chlorophyll synthesis mutant, available from Arabidopis thaliana Biological resources center ABRC, CS3119.

Experiment among the following embodiment is three repetitions, and three experiments that are that relate to quantitative test are averaged.

Embodiment 1, LHCB6 expresses under the coercing of ABA influences plant seed germination, growth of seedling and drought-enduring

One, external source applies the influence of lower concentration ABA (being equivalent to physiological condition high density ABA) to LHCB6 mRNA and protein level expression

Carrying out ABA in two stages of development of plants respectively handles: the seedling phase with become the length of time.

The seedling phase: three days wild-type Arabidopis thaliana (col) of common MS substratum growth (ABRC, CS60000) seedling moves to middle two weeks of regrowth of substratum (ABA+MS substratum) of the ABA that contains 0,0.5,1,3,5 or 10 μ M;

Become the length of time: move to ABA solution (the ABA aqueous solution of configuration 10ml different concns) the growth 5h that sprays different concns after three weeks of wild-type Arabidopis thaliana growth of seedling in the soil.

The concrete detection method that mRNA expresses: with reference to BioRad Real-Time System CFX96TM C1000 Thermal Cycler (Singapore) instrument specification sheets RT-PCR is carried out in the expression of the mRNA level of LHCB6 and detect, template is the cDNA of plant, and primer is forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ';

reverse?primer：5’-CCATGGCGTTGCCCACTCA-3’，

Confidential reference items are β-Actin:

The primer of confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ';

reverse?primer?5’-AACGACCTTAATCTTCATGCTGC-3’。

The concrete detection method of LHCB6 protein expression:, with grinding cymbals and grinding rod that precooling is good material is clayed into power in liquid nitrogen, in the 1.5mL centrifuge tube of packing into plant tissue (whole plant) quick-frozen in liquid nitrogen.Extracting the damping fluid composition is 50mMTris-HCl, and pH 7.5,150mMNaCl, and 1mM EDTA, 0.1% (v/v) Triton X-100,10% (v/v) glycerol, and add proteinase inhibitor.Add centrifuge tube according to extracting damping fluid and 4: 1 ratio of sample, and put into the liquid nitrogen quick-frozen rapidly.Utilize the cytoclasis ultrasonic apparatus that the mixture supersound process is extremely thawed fully, and then put into the liquid nitrogen quick-frozen.The above-mentioned steps triplicate.With centrifugal 3 minutes of mixture 10000g, remove insolubles and broken cell.It is stand-by that supernatant liquor is transferred to new centrifuge tube, is LHCB6 albumen.

LHCB6 albumen is carried out the SDS-PAGE and the immune marking, concrete experimental procedure is with reference to paper (the Wu F-Q that has delivered, Xin Q, Cao Z, Liu Z-Q, Du S-Y, Mei C, Zhao C-X, Wang X-F, Shang Y, Jiang T, Zhang X-F, Yan L, Zhao R, Cui Z-N, Liu R, Sun H-L, Yang X-L, Su Z, Zhang D-P (2009) .The Mg-chelatase H subunit binds abscisic acid and functions in abscisic acid signaling:New evidence in Arabidopsis.Plant Physiol 150:1940-1954), the specific antibody of LHCB6 is available from Agrisera (Stockholm, Sweden; Website:www.agrisera.com; Product No.AS01010.)。

The result as shown in Figure 2,

Fig. 2 A: in the seedling: the mRNA expression level that 0 to 5 μ M ABA handles back LHCB6 raises, and reduces but 10 μ M ABA handle the mRNA expression level of back LHCB6.With three days wild-type seedling, move on on the substratum that contains different concns ABA, continued growth two weeks sampling detects (concrete detection method is seen above-mentioned mRNA detection of expression).Every group of data all are three independent biology multiple mean values.

0 μ M ABA handles, and the mRNA relative expression quantity of LHCB6 is 0.40;

0.5 μ M ABA handles, the mRNA relative expression quantity of LHCB6 is 0.70;

1 μ M ABA handles, and the mRNA relative expression quantity of LHCB6 is 1.00;

2 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 0.98;

3 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 0.95;

5 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 1.00;

10 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 0.10;

Fig. 2 B: become in the seedling in age: be lower than 200 μ M ABA and handle the mRNA expression level rising that makes LHCB6, handle the mRNA expression level reduction that makes LHCB6 but be higher than 200 μ M ABA.ABA solution sprays the plant detection (concrete detection method is seen above-mentioned mRNA detection of expression) of taking a sample after 5 hours in three ages in week.Every group of data all are three independent biology multiple mean values.

0 μ M ABA handles, and the mRNA relative expression quantity of LHCB6 is 1.20;

20 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 1.35;

50ABA handles, and the mRNA relative expression quantity of LHCB6 is 2.00;

100 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 1.20;

150 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 1.15;

200 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 1.00;

300 μ M ABA handle, and the mRNA relative expression quantity of LHCB6 is 0.75.

Fig. 2 C: in the seedling: the protein expression level that 0 to 5 μ MABA handles back LHCB6 raises, and reduces but 10 μ M ABA handle the protein expression level of back LHCB6.Material processing is with (A).Actin is last sample contrast, tests and repeats to obtain similar result three times.

Detection method sees that specifically the LHCB protein expression detects.

Fig. 2 D: become in the seedling in age: be lower than 200 μ M ABA and handle the protein expression level rising that makes LHCBs (LHCB1～6), handle the protein expression level reduction that makes LHCBs (LHCB1～6) but be higher than 200 μ M ABA.Material processing is with (B).Actin is last sample contrast, tests and repeats to obtain similar result three times.

Detection method sees that specifically the LHCB protein expression detects.

From as can be seen above-mentioned: in the seedling phase, the ABA concentration of 0.5 to 5 μ M promotes the mRNA of LHCB6 to express, expression amount decline (Fig. 2 A) during 10 μ M.Becoming the length of time, the ABA concentration that is lower than 200 μ M is handled the mRNA expression that Arabidopis thaliana promotes LHCB6, and when being higher than 200 μ M, the mRNA expression amount of LHCB6 descends, and the ABA of 50 μ M is the optimal concentration (Fig. 2 B) that promotes that LHCB6 expresses.

Further research ABA is to the influence of LHCB protein expression.In the seedling phase, the LHCB protein expression is in full accord for response and mRNA level that ABA handles, and expression amount reaches maximum (Fig. 2 C) when 1 to 3 μ M handles.Becoming the length of time, from 20 to 300 μ M all promote the proteic expression of LHCB, and along with the increase of ABA concentration, expression amount increases (Fig. 2 D), this expression with mRNA different (Fig. 2 B).

Experimental result shows, being expressed in to transcribe with translation skill of LHCB is subjected to different adjustings.

In a word, above data basic explanation, the lower concentration that external source applies is equivalent to high density ABA under the physiological condition, promotes rather than suppress the expression of LHCB.

Two, improve the germination rate and the long variation of root of the detection of expression seed of LHCB6 encoding gene in the plant that sets out

1, seed germination experiment

Divide three parts to broadcast about 100 seed disinfections for the treatment of measuring plants at MS substratum (Sigma, St.Louis, MO, USA; Full-strength MS).Substratum contains 3% sucrose and 0.8% agar powder (pH 5.9) and contains the ABA of 0,0.5,1 μ M.Seed vernalization 3 days under 4 ℃ of conditions is placed on growth under 20 ℃ of illumination conditions then, sprouts the data of (appearance of root) at the time record that indicates.

The above-mentioned measuring plants for the treatment of is the lhcb6 mutant, wild-type Arabidopis thaliana col, double-mutant lhcb1 lhcb6 (double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb6 or not blooming, on the lhcb1 pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), lhcb6-i (RNAi changes the LHCB6 Arabidopis thaliana), double-mutant lhcb4 lhcb6 (double-mutant construction process: the petal that lhcb is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb6 or not blooming, on the lhcb4 pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), LHCB6 (LHCB6 crosses the expression Arabidopis thaliana), the cch mutant, lhcb6 cch (double-mutant construction process: the petal that cch is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb6 or not blooming, on the cch pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), cch/LHCB6 (is incorporated into LHCB6 gene ORF full length sequence (sequence 1) in the pCAMBIA1300-221 carrier of 35S promoter driving, introduce in the cch mutant), ch1-1 (Arabidopis thaliana Biological resources center ABRC, CS3119).

Each numerical value all is three independent biology multiple mean values.

Result such as Fig. 3 A-3D, Fig. 5 A-5C and shown in Figure 6,

As can be seen from Figure 3A, lhcb6 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 38%, 100%, 100%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 20%, 78%, 97%, 100%, 100%; In the substratum of the ABA of 1 μ M, 24,26,48,60, the germination rate of 72h is respectively 5%, 60%, 80%, 98%, 100%;

Lhcb6-i (RNAi change LHCB6 Arabidopis thaliana) in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 30%, 98%, 100%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 37%, 58%, 90%, 100%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 2%, 57%, 78%, 88%, 100%;

Ch1-1 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 80%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 1%, 30%, 72%, 90%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 0%, 20%, 43%, 75%, 84%;

Col in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 78%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60,72 germination rate is respectively 0%, 22%, 70%, 86%, 100% in the substratum of the ABA of 1 μ M, and 24,36,48,60, the germination rate of 72h is respectively 0%, 17%, 35%, 70%, 83%;

As can be seen from Figure 3B,

The lhcb6 single mutant in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 90%, 100%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 18%, 75%, 98%, 100%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 65%, 82%, 98%, 100%;

Double-mutant lhcb1 lhcb6 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 90%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 8%, 50%, 78%, 80%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 2%, 35%, 62%, 80%, 95%;

Double-mutant lhcb4 lhcb6 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 12%, 90%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 47%, 78%, 90%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 2%, 38%, 56%, 80%, 98%;

Col in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 8%, 80%, 96%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 2%, 22%, 65%, 82%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 0%, 10%, 30%, 62%, 80%.

From Fig. 3 C as can be seen,

The lhcb6 single mutant in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 18%, 90%, 95%, 100%, 100%

Lhcb6 cch in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 73h is respectively 15%, 80%, 90%, 100%, 100%,

Wild-type col in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 78%, 88%, 100%, 100%,

Cch in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 19%, 90%, 98%, 100%, 100%;

LHCB6 in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 15%, 78%, 90%, 100%, 100%.

From Fig. 3 D as can be seen, cch/LHCB6 is respectively 98%, 100%, 100% at the germination rate through 0 μ M ABA processing 36,48,60h,

Wild-type col is respectively 96%, 98%, 100% at the germination rate through 0 μ M ABA processing 36,48,60h;

Cch is respectively 96%, 100%, 100% at the germination rate through 0 μ M ABA processing 36,48,60h;

Cch/LHCB6 is respectively 40%, 63%, 70% at the germination rate through 3 μ M ABA processing 36,48,60h,

Wild-type col is respectively 15%, 20%, 35% at the germination rate through 3 μ M ABA processing 36,48,60h,

Cch is 65%, 95%, 100% at the germination rate through 3 μ M ABA processing 36,48,60h respectively,

From Fig. 5 A-5C also as can be seen, the germination rate of mutant LHCB6 is higher than wild-type col.

From Fig. 5 D as can be seen, mutant desensitizes for ABA aspect growth of seedling, and the double-mutant of LHCB family desensitizes for ABA aspect growth of seedling, and the double-mutant of mutant and cch desensitizes for ABA aspect growth of seedling.

Plant seed to be measured distributes directly to broadcast in the MS of the ABA that contains 0.5 and 1 μ M substratum and sows, growth 12 statistics germination rates after the vernalization, and the result treats that wherein measuring plants is that wild-type Arabidopis thaliana col, LHCB6 cross expression Arabidopis thaliana (OE1) as shown in Figure 6.Each numerical value all is that three independent biology multiple are average.

As can be seen from Figure 6,

Col handles 24,36,48 on 0.5 μ MABA substratum, the seed germination rate of 60h is 20%, 28%, 68%, 98%;

OE1 handles 24,36,48 on 0.5 μ MABA substratum, the seed germination rate of 60h is 10%, 18%, 30%, 60%;

Col handles 24,36,48 on 1 μ MABA substratum, the seed germination rate of 60h is 12%, 23%, 40%, 65%;

OE1 handles 24,36,48 on 1 μ MABA substratum, the seed germination rate of 60h is 8%, 12%, 25%, 52%;

Above description of test: 1.lhcb single mutant and LHCB6-RNAi strain tie up to ABA inhibition seed germination aspect and show the phenotype that ABA is desensitized; 2.LHCB6 the downstream of the ABA signal transduction process that participates at ABAR.

2, the long experiment of root

Plant seed to be measured is directly broadcast in the MS of the ABA that contains 1 μ M substratum and is sowed, and growth 12 days after the vernalization (3E, 3F) or (3G 3H) took pictures that to observe the statistics root long, added up with main root length in 10 days.

Treat that measuring plants is single mutant lhcb6, double-mutant lhcb1 lhcb6 (double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb6 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), wild-type Arabidopis thaliana col, the cch single mutant, double-mutant lhcb6 cch (double-mutant construction process: the petal that lhcb6 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the cch or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation), LHCB6 cch crosses expression Arabidopis thaliana (LHCB6cch), LHCB6 crosses expression Arabidopis thaliana (OE1, OE5), RNAi changes LHCB6 Arabidopis thaliana (R9 and R18).Each numerical value all is that three independent biology multiple are average.

The result is (following all is the root length that identical time point detects) shown in Fig. 3 E-3H,

As can be seen, the root of lhcb6 is long to be 6.5mm from 3E;

The root of Col is long to be 2.0mm;

The root of double-mutant lhcb1 lhcb6 is long to be 5.5mm;

From Fig. 3 F as can be seen,

The seedling root of LHCB6 cch on the ABA substratum that contains 1 μ M is long to be 4.0mm;

The seedling root of lhcb6 cch double-mutant on the ABA substratum that contains 1 μ M is long to be 6.0mm;

The seedling root of cch single mutant on the ABA substratum that contains 1 μ M is long to be 6.3mm;

The seedling root of wild-type col on the ABA substratum that contains 1 μ M is long to be 2.0mm;

From Fig. 3 G as can be seen, the RNAi transfer-gen plant of LHCB6 and mistake express transgenic plant desensitize to ABA aspect growth of seedling.

More than experiment shows that the 1.lhcb single mutant suppresses to show the phenotype that ABA is desensitized aspect the growth of seedling at ABA; 2.LHCB6 the downstream of the ABA signal transduction process that participates at ABAR.

From 3H as can be seen,

LHCB6 crosses the long 1.8mm of being of root of expression Arabidopis thaliana (OE1);

LHCB6 crosses the long 2.6mm of being of root of expression Arabidopis thaliana (OE5);

RNAi changes the long 8.0mm of being of root of LHCB6 Arabidopis thaliana (R9);

RNAi changes the long 12.5mm of being of root of LHCB6 Arabidopis thaliana (R18);

The root of Col is long to be 5.6mm.

Above-mentioned experiment as can be seen, all lhcb cch double-mutants (lhcb1 cch, lhcb3 cch, lhcb4 cch, and lhcb6 cch) are in the phenotype that is showing aspect seed germination (Fig. 3 C) and the growth of seedling (Fig. 3 F) ABA desensitization.Lhcb cch double-mutant is lower than lhcb or cch single mutant, consistent with the lhcb double-mutant (Fig. 3 A to C) to the degree of ABA desensitization aspect seed germination.Aspect growth of seedling, lhcb cch double-mutant for the degree of ABA desensitization consistent with lhcb double-mutant, single mutant and cch single mutant phenotype (Fig. 3 E, 3F).What is interesting is, expression LGCB6 gene is crossed in discovery in the cch mutant, transgenic line can both partly recover the phenotype of cch mutant for the ABA desensitization in the phenotype of all response ABA: ABA suppresses seed germination (Fig. 3 D), and ABA suppresses growth of seedling (Fig. 3 F).

Three, improve the influence of the expression of LHCB6 encoding gene in the plant that sets out to resistance of reverse

1, stomatal movement experiment:

ABA inductive stomatal closure system: the plant leaf to be measured in 3 weeks of growth in the soil is immersed in the damping fluid that contains 50mM KCl and 10mMMes-Tris (pH 6.15), with 200 μ molm- ²s ^-1Intensity is placed 2.5h under cold light source, add (±)-ABA of different concns then.After ABA handles 2.5h, tear and get the epidermis bar, the measurement and record of stomatal aperture.

ABA suppresses the pore open system: the plant leaf to be measured in 3 weeks of growth in the soil is immersed in the identical damping fluid, and dark processing 2.5h adds ABA then and moves under the cold light source and shine 2h, the measurement and record of stomatal aperture in damping fluid.

Treat that measuring plants is col, ch1-1 is (available from ABRC, CS3119), cch, lhcb6 mutant and LHCB6 cross expression Arabidopis thaliana (LHCB6), double-mutant lhcb1 lhcb6 (double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb6 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), double-mutant lhcb6 cch (double-mutant construction process: the petal that lhcb6 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the cch or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation), cch/LHCB6 (the LHCB6 cch of embodiment front crosses expression Arabidopis thaliana (LHCB6 cch)).

The result is shown in Fig. 4 A, Fig. 4 B and Fig. 5 F, and wherein inducing stomatal closure is last figure, and suppressing pore open is figure below.Each numerical value all is that five independent biology multiple are average.The aperture of each 60 pores of duplicate record.

From Fig. 4 A as can be seen,

Col 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.5 μ M, 5.2 μ M, 2.8 μ M, 0.8 μ M;

The aperture of Col pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is respectively 1.0 μ M, 5.6 μ M, 2.5 μ M, 0.8 μ M;

Ch1-1 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.3 μ M, 5.0 μ M, 2.6 μ M, 0.7 μ M;

The aperture of ch1-1 pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 1.1 μ M, 5.4 μ M, 2.6 μ M, 0.9 μ M;

The lhcb6 mutant 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.5 μ M, 5.3 μ M, 4.9 μ M, 4.0 μ M;

The aperture of lhcb6 mutant pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 0.8 μ M, 5.5 μ M, 5.0 μ M, 3.5 μ M;

LHCB6 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.2 μ M, 5.1 μ M, 1.6 μ M, 0.4 μ M;

The aperture of LHCB6 pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 0.8 μ M, 5.6 μ M, 1.0 μ M, 0.5 μ M;

From as can be seen as Fig. 4 B,

Col 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.0 μ M, 5.1 μ M, 2.8 μ M, 0.3 μ M;

The aperture of Col pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 1.4 μ M, 4.4 μ M, 2.2 μ M, 0.2 μ M;

Cch 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 6.2 μ M, 6.3 μ M, 5.8 μ M, 2.6 μ M;

The aperture of cch pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 1.5 μ M, 6.7 μ M, 5.5 μ M, 2.3 μ M;

The lhcb6 mutant 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.1 μ M, 4.9 μ M, 4.7 μ M, 1.5 μ M;

The aperture of lhcb6 mutant pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 1.0 μ M, 5.0 μ M, 4.1 μ M, 1.5 μ M;

Lhcb1 lhcb6 double-mutant 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 5.0 μ M, 5.1 μ M, 5.0 μ M, 1.7 μ M;

The aperture of lhcb1 lhcb6 double-mutant pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 1.0 μ M, 5.0 μ M, 4.9 μ M, 1.7 μ M;

Lhcb6 cch double-mutant 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be 6.0 μ M, 6.1 μ M, 5.1 μ M, 2.0 μ M;

The aperture of lhcb6 cch double-mutant pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is 1.1 μ M, 6.4 μ M, 5.5 μ M, 2.3 μ M;

It should be noted that lhcb6 cch double-mutant and cch single mutant compare the not significantly enhancing of desensitization of ABA.

From Fig. 5 F as can be seen, col 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be respectively 5.3 μ m, 5.2 μ m, 2.8 μ m, 0.8 μ m;

The aperture of col pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is respectively 1.2 μ m, 5.4 μ m, 2.5 μ m, 0.8 μ m;

Cch 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be respectively 6.8 μ m, 6.8 μ m, 5.9 μ m, 4.9 μ m;

The aperture of cch pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is respectively 1.3 μ m, 6.5 μ m, 6.0 μ m, 4.2 μ m;

Single mutant lhcb6 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 30 μ MABA handle 2.5h induce stomatal closure the time pore aperture be respectively 5.2 μ m, 5.1 μ m, 4.8 μ m, 4.0 μ m;

The aperture of single mutant lhcb6 pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 30 μ MABA processing 2.5h is open is respectively 1.0 μ m, 5.3 μ m, 4.9 μ m, 3.6 μ m;

Double-mutant cch/LHCB6 is (by XbaI and the SalI restriction enzyme site ORF (sequence 1 with LHCB6,777bp) be connected introducing pCAMBIA1300 carrier with the 35S promoter of cauliflower mosaic virus, infect plant cch by the petal osmose process, screen positive seedling, multiply to T3 experimentize for homozygote) 0 μ MABA handle 0h, 0 μ MABA handle 2.5h, 20 μ MABA handle 2.5h, 50 μ MABA handle 2.5h induce stomatal closure the time pore aperture be respectively 5.5 μ m, 5.2 μ m, 3.8 μ m, 2.8 μ m;

The aperture of double-mutant cch/LHCB6 pore when the inhibition pore of 0 μ MABA processing 0h, 0 μ MABA processing 2.5h, 20 μ MABA processing 2.5h, 50 μ MABA processing 2.5h is open is respectively 1.2 μ m, 6.2 μ m, 3.7 μ m, 2.0 μ m.

2, arid experiment and percentage of water loss experiment

To treat that measuring plants after the growth, does not water and carries out drought stress, takes pictures from substratum immigration soil.Be contrast normally to water.With wild-type and different lhcb mutant, at every turn each sample get 5 strain blades experimentize (around choosing age the fully-developed blade on the bolting plant not, be placed on the pan paper, weigh once every 1h, calculate the blade percentage of water loss.Formula should be:

(0h weight-1h weight)/0h weight), add up the rate-of-loss of coolant of excised leaf in 6 hours.Treat that measuring plants is wild-type Arabidopis thaliana Col, mutant lhcb6.

Take pictures the result that observes shown in Fig. 4 C-E and Fig. 5 H,

From Fig. 4 C as can be seen, for normally watering wild-type Arabidopis thaliana Col, mutant lhcb6 indifference.

From Fig. 4 D as can be seen, be drought stress: rehydration is 2 days after stopping to water 18 days, and wild-type Arabidopis thaliana Col growth is better, mutant lhcb6 is withered substantially.

From Fig. 4 E as can be seen, be drought stress: arid is rehydration after 21 days, Taking Pictures recording after 2 days, and wild-type Arabidopis thaliana Col growth is better, mutant lhcb6 is withered substantially.

From 5H as can be seen, drought stress: arid is rehydration after 21 days, takes pictures after 2 days, and wild-type Arabidopis thaliana Col growth is better, mutant lhcb6 is withered substantially.

Fig. 5 D shows that the lhcb6 mutant desensitizes for ABA aspect growth of seedling, lhcb1 lhcb6 and lhcb6 cch double-mutant desensitize for ABA aspect growth of seedling.。

The result of percentage of water loss shown in Fig. 5 G, as can be seen,

Lhcb6 is respectively 16%, 32%, 48%, 59%, 76% in the percentage of water loss of ABA processing 1,2,3,4,5,6h;

Col is respectively 12%, 24%, 34%, 44%, 54% in the percentage of water loss of ABA processing 1,2,3,4,5,6h.

As can be seen, ABA inductive stomatal closure and suppress pore open aspect, the lhcb6 mutant shows the desensitization phenotype to ABA, and the mistake of LHCB6 is expressed strain system and shown phenotype to the ABA sensitivity.Double-mutant lhcb1 lhcb6 shows the desensitization phenotype of same degree.The ch1-1 mutant is in the phenotype that does not show aspect ABA inductive stomatal closure and the opening of inhibition pore the ABA desensitization, and this is with consistent for ch1-2 mutant result of study in the past.

The excised leaf of discovering the lhcb mutant is more with the equal time dehydration under the exsiccant condition.This may desensitization causes to ABA aspect stomatal movement owing to these mutant.Simultaneously, find the lhcb mutant in that normally to water under the water condition growth conditions consistent with wild-type, and under drought condition, the water retention capacity of mutant is lower than wild-type.

4, the complementary Arabidopis thaliana of lhcbs mutant is in seed germination, growth of seedling and drought-enduring research

1) seed germination, root are long

Lhcb6* represents the complementary strain system (preparation method is as implied above) of LHCB6 gene.

With lbcb6* and col after after the vernalization on the ABA substratum of 1 μ M 48 hours, the statistics seed germination rate.

After after the vernalization on the ABA substratum of 1 μ M 12 days, the statistics root is long with lbcb6* and col.

The result is shown in Fig. 7 A, col, lbcb6* 48 hours germination rate after vernalization on the ABA substratum of 1 μ M is respectively 32%, 21%, as can be seen the lhcb6 mutant aspect seed germination to the phenotype of ABA desensitization since the reduction of LHCB6 gene expression amount cause.

Col, lbcb6* 12 days root long (main root length) after vernalization on the ABA substratum of 1 μ M is respectively 2.5mm, 1.7mm, as can be seen the lhcb6 mutant aspect growth of seedling to the phenotype of ABA desensitization since the reduction of LHCB6 gene expression amount cause.

Lbcb6* can recover the wild-type phenotype as can be seen, and in conjunction with the experiment of front, lhcb6 mutant phenotype to the ABA desensitization aspect growth of seedling causes owing to the LHCB6 gene expression amount reduces.

2) drought-enduring (stomatal aperture)

Lbcb6* and col are induced stomatal closure according to the method described above and suppress the pore opening experiment, and at the initial stomatal aperture of 0 μ M ABA 0 hour record, 0 μ M or 20 μ M ABA handle after 2.5 hours measurement and record of stomatal aperture again.Each numerical value all is that five independent biology multiple are average.The aperture of each 60 pores of duplicate record.The identical expression of letter (in P＜0.05 level of difference) does not have significant difference, and alphabetical different table is shown with significant difference.

The result is shown in 7B, and it is last figure that ABA induces stomatal closure, and suppressing pore open is figure below,

Col and lbcb6* are respectively 6.0 μ m, 6.0 μ m at the stomatal aperture of inducing stomatal closure that the ABA of 0 μ M handled 0 hour, and wild-type is identical with the transgenic line original state in this experiment as can be seen.

Col and lbcb6* are respectively 1.0 μ m, 1.0 μ m at the open stomatal aperture of inhibition pore that the ABA of 0 μ M handled 0 hour, and wild-type is identical with the transgenic line original state in this experiment as can be seen.

Col and lbcb6* are respectively 5.1 μ m, 5.0 μ m at the stomatal aperture of inducing stomatal closure that the ABA of 0 μ M handled 2.5 hours, as can be seen in this experiment, with water as negative control treatment wild-type and transgenic line, its phenotype unanimity.

Col and lbcb6* 2.5 hours the open stomatal aperture of inhibition pore after vernalization on the ABA substratum of 0 μ M is respectively 5.5 μ m, 5.8 μ m, as can be seen in this experiment, with water as negative control treatment wild-type and transgenic line, its phenotype unanimity.

Col and lbcb6* are respectively 3.2 μ m, 2.4 μ m at the stomatal aperture of inducing stomatal closure that the ABA of 20 μ M handled 2.5 hours, as can be seen after ABA handles, transgenic line recovers lhcb6 mutant phenotype to the ABA desensitization aspect stomatal movement substantially, illustrates that the lhcb6 mutant causes owing to the LHCB6 gene expression amount reduces the phenotype of ABA desensitization.

Col and lbcb6* are respectively 2.4 μ m, 2.2 μ m at the open stomatal aperture of inhibition pore that the ABA of 20 μ M handled 2.5 hours, as can be seen after ABA handles, transgenic line recovers lhcb6 mutant phenotype to the ABA desensitization aspect stomatal movement substantially, illustrates that the lhcb6 mutant causes owing to the LHCB6 gene expression amount reduces the phenotype of ABA desensitization.

Embodiment 2, LHCB6 expression of gene are regulated by the ABAR-WRKY40 signal path

One, the normal expression of LHCB6 gene needs the participation of ABA

Whether is necessary in order to detect ABA to the expression of LHCB6, utilizes ABA defective mutant aba2 to experimentize.

The detection of expression method of the mRNA of LHCB6: three days aba2 seedling moves on on the substratum that does not contain or contain (1-60 μ M) ABA, and quantitative fluorescent PCR (template: the cDNA of sample is carried out in the back sampling of two week of continued growth; Primer: the primer of LHCB6:forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ' reverse primer:5 '-CCATGGCGTTGCCCACTCA-3 ' confidential reference items: β-Actin, confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 ') detect the expression level of LHCB6, be contrast with wild-type Arabidopis thaliana (col).Every group of data all are three independently biology multiple mean values.

The result is shown in Fig. 8 A, as can be seen, among the ABA synthesis mutant aba2, (aba2-ABA) turned down in the expression of LHCB6, ABA can make the expression of the LHCB6 among the ABA synthesis mutant aba2 be restored (aba2+ABA) after handling, but occurs restraining effect when ABA concentration is higher than 40 μ M.

The detection method of LHCB6 protein expression: three days aba2 seedling moves on to and contains (0,1,3,5,10,20,40, and60 μ M) on the substratum of ABA, the back sampling of two week of continued growth, extract total protein, (specific antibody is available from Agrisera (Stockholm, Sweden to carry out Western blot detection; Website:www.agrisera.com; Product No.AS01010),, the result is shown in Fig. 8 B, and Western blot band concentration is represented the albumen relative expression quantity.Numerical value below the band is represented the level relatively of protein expression.The LHCB protein content is 100 among the setting Col, and the LHCB protein content quantizes by comparison in the mutant.Actin is last sample contrast, tests and repeats to obtain similar result three times.

From as can be seen above-mentioned, the mRNA of LHCB6 and expressing quantity all are lower than wild-type in the aba2 mutant.The processing of ABA can recover the expression level of each LHCB member in the aba2 mutant, and (＞20or＞40 μ M handle LHCB mRNAs but the ABA of higher concentration handles;＞20 μ M handle to remove the proteic LHCB albumen of LHCB5:＞40 μ M) mRNA and the expression of protein level in mutant all begin to descend (Fig. 8 A, 8B).These experimental results show that LHCB6 is transcribing the participation that needs ABA with the normal expression of translation skill.

It should be noted that in the aba2 mutant, LHCB6 for the response of ABA protein level and mRNA level in full accord (Fig. 8 A, 8B).Yet in the aba2 mutant, the maximum concentration that stimulates LHCB to express is three times in the wild-type experimental system.

Two, the Promoter-GUS analyzing gene is expressed

Genomic dna with the wild-type Arabidopis thaliana is a template, utilize forward primer 5 '-CCCAAGCTTCCGGACATGGG TTCAAATCA-3 ' and reverse primer 5 '-C GGGATCCAACCAAGCCCACTGAGGACA-3 ' amplification, obtain the product of 1109bp, this product is sent to order-checking, the result is the promotor pLHCB6 of Arabidopis thaliana At1g15820 (LHCB6) gene for this product has sequence 6 Nucleotide in the sequence table.

Promotor pLHCB6DNA is utilized the PstI/BamHI restriction enzyme site, promoter fragment is connected into carrier to pCAMBIA1391 (Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.Contain the gus gene.) in, be converted into Agrobacterium GV3101, transform wild-type Arabidopis thaliana (Col) respectively by the flower infestation method, wrky40 mutant and wrky40wrky18 double-mutant (double-mutant construction process: the petal that wrky40 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky18 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, and F2 can obtain homozygote for growth through the PCR evaluation.), obtain respectively T0 for the wild-type Arabidopis thaliana that changes pLHCB6, T0 for the wrky40 mutant that changes pLHCB6 and T0 for the wrky40wrky18 double-mutant that changes pLHCB6.

Above-mentioned T0 is gone down to posterity for plant, obtain T3 for plant.Adopt GUS dyeing process screening T3 for plant, the GUS dyeing process is with reference to Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO J 20:3901-3907, the result shown in Fig. 9 A-9I, (A) dry seeds; (B) and (C) seed of sprouting; (D) 9 days seedling; (E) and (F) pore of mature leaf; Mainly in the guard cell of pore, express.(G) root; (H) flower; (I) angle fruit.As can be seen, LHCB6 all has the expression of LHCB6 in the as above tissue of T3 for the wild-type Arabidopis thaliana that changes pLHCB6.

Extract the RNA of the different tissues of wild-type Arabidopis thaliana respectively, reverse transcription obtains cDNA, LHCB6:forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ' reverse primer:5 '-CCATGGCGTTGCCCACTCA-3 ' confidential reference items: β-Actin, the primer of confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 ', fluorescence quantitative PCR detection, result such as Fig. 9 J, the root of LHCB6 in the wild-type plant, stem, leaf, flower, mRNA relative expression quantity in angle fruit and the seed is respectively 0.05,0.55,1.75,0.40,0.20,0.00.

Three, the WRKY40 transcription factor combines with LHCB family member's promotor and suppresses its expression

Attempting a key that research directly acts on the ABAR downstream transcribes and suppresses son---and whether the WRKY40 transcription factor can directly combine with the promoter region of LHCB and regulate the expression of LHCB.

1, the PCR and the real-time fluorescence quantitative PCR of testing by the chromatin co-immunoprecipitation

Shown in Figure 10 A-10D that concrete experiment is stated as follows,

Figure 10 A be the structure of LHCB6 gene promoter: Wn (W1, W2 ...) represent the order of W-box from left to right and they position with respect to initiator codon (ATG).On behalf of CHIP, red line analyze the sequence fragment that detects in (Figure 10 B).Arrow is represented sequence fragment used in the gel retardation assay, and same fragment is represented p1, p2 with two arrows of same color ... represent selected segmental number.

Figure 10 B is that the promotor of WRKY40 and LHCB6 gene is done mutually:

Concrete grammar: with the N terminal specific antibody of WRKY40 (the N end of WRKY40 be the 21-131 position Nucleotide of genbank CP002684, the nucleotides sequence of WRKY40 is classified the sequence 5 of sequence table as, aminoacid sequence is the sequence 4 in the sequence table) carry out the PCR electrophoresis detection result that CHIP analyzes (CHIP analyze with reference to before method (Saleh A, Alvarez-Venegas R, Avramova Z (2008) An efficient chromatin immunoprecipitation (ChIp) protocol for studying histone modifications in Arabidopsis plants.Nat Protoc 3:1081-1025; Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagomzes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935).Experiment material be the wild-type Arabidopis thaliana two the week age seedling.The specific antibody of WRKY40 is N-end antibody (the Shang Y of WRKY40, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du S Y, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935).Active in order to detect WRKY40 with combining of LHCB promotor, with reference to (Mukhopadhyay A, Deplancke B, Walhout AJM, Tissenbaum HA (2008) .Chromatin immunoprecipitation (ChIp) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.Nat Protoc 3:698-709; Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935) method is that confidential reference items contrast carrying out real-time quantitative PCR detects with 3 ' the non-translational region sequence of Actin2.

Confidential reference items primer Actin2:

forward?primer：5’-GGTAACATTGTGCTCAGTGGTGG-3’

reverse?primer：5’-AACGACCTTAATCTTCATGCTGC-3’

The sequence of promoter fragment indicates in (Figure 10 A).The result is shown in Figure 10 B, and ' Input ' swimming lane: the genomic dna of wild-type Arabidopis thaliana seedling in two ages in week is a template, amplification PCR products; ' control ' swimming lane: the DNA that preimmune serum precipitation (antibody manufacturing company provides) obtains is a template, amplification PCR products; ' LHCB-p ' swimming lane: the DNA that WRKY40N terminal specific antibody precipitation obtains is a template, amplification PCR products.

pLHCB6-1：

forward?primer：5’-TCCCGTGACTTTGCCTCCA-3’

reverse?primer：5’-ACCAATAGAGTCCATCCCAACAAT-3’

The fragment sequence that amplification obtains is a sequence 7.

As can be seen, WRKY40 combines with the promotor of LHCB6 gene.

Figure 10 C is that the promotor of WRKY40 and LHCB6 gene is done mutually: the N terminal specific antibody with WRKY40 carries out the quantitative fluorescent PCR that CHIP analyzes.

The result is shown in 10C, and Actin promotor (Actin-p) (be with Actin2 3 ' non-translational region sequence be the product of confidential reference items contrast carrying out real-time quantitative PCR) is negative contrast.

As can be seen, the relative combination rate with the WRKY40 bonded of the promotor of LHCB6 gene (LHCB6-p) is 26.

Every group of data all are three independently biology multiple mean values.

Show that WRKY40 combines with the promotor of LHCB gene.

Figure 10 D is the yeast one-hybrid experiment: the AH109 bacterial strain that yeast one-hybrid utilizes Clontech test kit (Matchmaker.One-Hybrid Library Construction﹠Screening Kit CATALOG No.630304) to provide.

With wild-type Arabidopis thaliana plant complete genome DNA is template, carries out pcr amplification with following primer, obtains 1137bp product (order-checking for the sequence 6 in the sequence table from 5 ' terminal 1-1137 position Nucleotide):

LHCB6?promoter(1137bp)：

forward?primer：5’-TCCCCCGGGACCAGTCAACATTAACGCCACC-3’

reverse?primer：5’-CGACGCGTTCCGGTGAGGAACGAAGAAC-3’

Cut 1137 bp products with the SmaI/MluI enzyme, with the pHIS2 carrier (Clontech test kit (Matchmaker that cuts through same enzyme ^TMOne-Hybrid Library Construction﹠Screening Kit CATALOG No.630304) connects, obtain pHIS2-pLHCB6.

Utilize the yeast one-hybrid method of AH109 bacterial strain to carry out according to the explanation of handbook.With pHIS2 carrier that comprises target gene promoters and the prey vector (pGADT7-WRKY40 (Clontech test kit (Matchmaker that contains the WRKY40 opening code-reading frame ^TMOne-Hybrid Library Construction﹠Screening Kit CATALOG No.630304), common transformed yeast cell.

Transform empty carrier pGADT7 (Clontech test kit (MatchmakerT simultaneously ^MAnd pHIS2 (Clontech test kit (Matchmaker One-Hybrid Library Construction﹠Screening Kit CATALOG No.630304)) ^TMOne-Hybrid Library Construction﹠Screening Kit CATALOG No.630304)) to yeast cell, as negative contrast.This tests triplicate, obtains same result.

Yeast cell after the conversion is grown on the SD-Trp-Leu substratum earlier and is confirmed that the carrier conversion enters cell, grows cell transformed then on the SD-Trp-Leu-His substratum.SD-Trp-Leu or SD-Trp-Leu-His substratum comprise 25mM 3-AT (SIGMA) (WRKY40-LHCB1-, LHCB2-or LHCB5-promoter do mutually) or 10mM (WRKY40-LHCB3 promotor or LHCB6-promotor are done mutually).The yeast flat board was 30 ℃ of growths 3 days.

The result is shown in 10D, and as seen from the figure, WRKY40 combines with the promotor of LHCB6 gene.

Figure 10 E is a gel retardation assasy: (the WRKY40 protein sequence is seen sequence 4 to the His-WRKY40 fusion rotein of utilization purifying from intestinal bacteria, total length for WRKY40, the WRKY40 protein coding gene is connected on the pET48-b carrier, constitute the His-WRKY40 fusion rotein, HIS is pET48-b carrier (Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University) label that has) carry out gel retardation assasy, specific as follows:

The fragment of LHCB6 promotor (order-checking for the sequence in the sequence table 6 from 5 ' terminal 704-905 position Nucleotide) utilizes following primer purifying from the PCR product, and template is the cDNA of wild-type Col:

LHCB6 promotor (pLHCB6;-374～-173,202bp): forward primer

5’-ATTCATTGCTGTCATTTACATTTC-3’reverse?primer?5’-GATAGATTTCTGACCAATTAGGAG-3’

The LHCB6 promotor is suddenlyd change at the critical sites of W-box, becomes GTTA or TGAC becomes TTAC by GTCA, and method is to utilize following primer (mutational site is subscript) and above-mentioned corresponding primer to carry out independently PCR twice:

forward?primer?5’-ATTCATTGCTGTCATTTACATTTC-3’reverse?primer

5 '-GATAGATTTCTAACCAATTAGGAGTTAG-3 ' is with W-boxes W1 (GTCA_GTTA) and W2 (TGAC_TTAC) sudden change;

forward?primer?5’-AATTTCCACGTGTTATTTTATTTTCC-3’reverse?primer

5 '-GATAGATTTCTGACCAATTAGGAG-3 ' suddenlys change W-box W3 (GTCA_GTTA);

Forward primer 5 '-ATTCATTGCTGTTATTTACATTT-3 ' and reverse primer

5 '-GATAGATTTCTGACCAATTAGGAG-3 ' suddenlys change W-box W4 (GTCA-GTTA).

The W1-W4 position of LHCB6 promotor has been labeled in Figure 10 A.Each promotor utilization by pcr amplification get etc. the fragment of molar mass, as the template of PCR for the third time.The sequence of mutant is identified through order-checking.The fragment of each promotor according to operational manual by digoxin-dUTP (Roche, Mannheim, Germany) mark.The working method of labeled reactant is with reference to paper (the Shang Y that has delivered, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935).The promoter fragment that uses 50ng His-WRKY40 fusion rotein and the corresponding digoxigenin labeled of 26ng to cross.The doubly unmarked fragment of 5-20 is used in competitive experiment.

Result such as Figure 10 G, Y40: the 6His-WRKY40 fusion rotein of purifying; Lp: the promoter probe of mark (ATTCATTGCTGTCATTTACATTTCAATAAGAAAATAAATTAATTTCCACGTGTCAT TTTATTTTCCTCTCACAATTTAGATTTAGATAAGTAAAGTATTAGAAAAATGTAAA TACTGAGTTGGCAGAATAAGACAGTGGTGAGTGTGGGTGATGTGGATATGGTGAAG TAGTTTCTGACTCCTAATTGGTCAGAAATCTATC; 5p, 10p, 20p represents 5 times respectively, 10 times, 20 times of cold probe amounts, (G) Lp1/2mW among the figure, Lp3mW and Lp4mW represent respectively first and second, the 3rd, the 4th W-box in the LHCB6 promotor are carried out point mutation (W1, W2, W3 and W4 marks in Figure 10 A).The 6His representative is with 6 histidine-tagged peptides, and BSA represents bovine serum albumin, and 6His and BSA are respectively as negative contrast.This tests triplicate, obtains same result.Verified the combining of WRKY40 and promotor (the W-box zone combines on the promotor of WRKY40 and LHCB6).

2, test in the body that WRKY40 and promotor are done mutually

This experimental technique is with reference to the paper Shang Y that has delivered, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935.

The cDNA of WRKY40 utilizes following primer to obtain (cDNA that template is wild-type Col) by pcr amplification:

5 '-CGCGGATCCATGGATCAGTACTCAT-3 ' and reverse

Primer5 '-CCGCTCGAGCTATTTCTCGGTATGA-3 ', PCR product (sequence 5 in the sequence table) utilizes the BamHI/XhoI site to be connected PBI121 carrier (Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelataseH subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) CaMV 35S promoter downstream, obtain PBI121-WRKY40.

The LHCB6 promotor utilizes following primer amplification to obtain:

LHCB6：forward?primer5’-GGGGTACCTCCCGTGACTTTGCCTCCA-3’

reverse?primer5’-TCCCCCGGGTCCGGTGAGGAACGAAGAAC-3’(1109?bp)。

The fragment sequence that amplification obtains is a sequence 8.

The cDNA sequence of LUC utilizes following primer with segmental pGL3-Basic carrier (the Shang Y of the cDNA that comprises LUC, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) obtain for template amplification: forward primer 5 '-TCCCCCGGGATGGAAGACGCCAAAAAC-3

Reverseprimer 5 '-CGGGATCCTTACACGGCGATCTTTCCGC-3 ' obtains the cDNA of LUC.

The LHCB6 promotor utilizes the KpnI/SmaI site to connect the pCAMBIA1300 carrier, obtains pCAMBIA1300-LHCB6.

The cDNA sequence of LUC is connected the downstream of the LHCB6 promotor of pCAMBIA1300-LHCB6 by the SmaI/BamHI site, obtains pLHCB-LUC (the single commentaries on classics), change the GV3101 bacterial strain over to, obtain GV3101/pLHCB-LUC-LHCB6 (the single commentaries on classics).

Change PBI121-WRKY40 over to the GV3101 bacterial strain, obtain GV3101/PBI121-WRKY40.

GV3101/pLHCB-LUC-LHCB6 (the single commentaries on classics) is injected into tobacco N.benthamiana blade (the Shang Y in seven weeks of young tender while full extension with needleless injector, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.), obtain changeing the pLHCB-luc tobacco.

GV3101/pLHCB-LUC-LHCB6 and GV3101/PBI121-WRKY40 mixed bacteria liquid together are injected into the N.benthamiana blade in seven weeks of young tender while full extension with needleless injector; Obtain changeing the pLHCB-luc+WRKY40 tobacco.

The experimental group carrier is identical with control group carrier GV3101/pLHCB-LUC-LHCB6 total amount.

After the injection,, be placed on continued growth 60h under room temperature (25 degree) the condition 16h/ days illumination then with tobacco dark processing 12h.

LUC is active, and (UK) vision facilities is observed for AndoriXon, Andor by CCD.With LUC empty carrier and control group carrier GV3101/pLHCB-LUC-LHCB6 is contrast, and this experiment is independent to be repeated more than five times, and experimental result is identical.

The result as shown in figure 11,

Figure 11 A is the result of WRKY40 and the common transformation of tobacco blade of LHCB promotor-luciferase (Luc) carrier, and as can be seen, in vivo WRKY40 significantly suppresses the promoter activity of LHCB6 gene.Behind the corotation pLHCB-LUC+WRKY40, the expression of pLHCB-LUC obviously dies down and does not even express.Test three repetitions, obtain same result.

Whether be affected in these two mutant in order to detect the LHCB expression of gene, pCAMBIA1391-LHCB6 is transformed wrky40 single mutant and wrky40wrky18 double-mutant, obtain wild-type Arabidopis thaliana (Col)-GUS, mutant wrky40-GUS, double-mutant wrky40/18-GUS.

The result is shown in Figure 11 B, Figure 11 B is that the T3 of wild-type Arabidopis thaliana (Col)-GUS, mutant wrky40-GUS, double-mutant wrky40/18-GUS is for the seedling GUS coloration result of homozygote at 13 days, wherein, (a topmost, b) be wild-type Arabidopis thaliana (Col)-GUS, middle (c d) is mutant wrky40-GUS, below (e f) is double-mutant wrky40/18-GUS.As can be seen, the expression of LHCB6 obviously strengthens among wrky40 and the wrky4018b.WRKY18 is the gene higher with the WRKY40 homology, it and WRKY40 fellowship ABA signal transduction process.Discovery LHCB6 expression of gene amount in wrky40 single mutant and wrky40wrky18 double-mutant significantly improves.

Figure 11 C is for detecting wild-type Arabidopis thaliana (Col) mutant wrky40, the mRNA of the LHCB6 of double-mutant wrky40/18 expresses and protein expression: real-time quantitative PCR detects wild-type Arabidopis thaliana (Col), mutant wrky40, the mRNA horizontal expression of the LHCB6 of double-mutant wrky40/18, LHCB6:forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ' reverse primer:5 '-CCATGGCGTTGCCCACTCA-3 ' confidential reference items: β-Actin, the primer of confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 '.

Immunoblotting detects the expression of protein level, Actin is that last sample contrast Arabidopis thaliana total protein extracting method carries out with reference to the scheme of LHCB antibody supplier Agrisera suggestion, SDS-PAGE and immunoblotting detect with reference to Shang Y, Yan L, LiuZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935.

The above results is shown in Figure 11 C, and the numerical value in the square frame is represented proteic relative expression's level.Setting the middle LHCB protein content of Col (wild-type Arabidopis thaliana) is standard, and the LHCB protein content quantizes by comparison in the mutant.Immunoblotting assay carries out three independent biology to be repeated, and obtains similar result.Every group of data of RT-PCR are three independent biology multiple mean values.

As can be seen, in wrky40 single mutant and wrky40wrky18 double-mutant, the expression amount of LHCB6 significantly improves, and the LHCB6 expressing quantity significantly improves in the wrky40 single mutant.Yet in the wrky40wrky18 double-mutant, the LHCB6 expression amount does not have noticeable change.

In sum, above experimental result shows that WRKY40 and WRKY18 suppress LHCB genetic expression jointly.

In order to study the function that hormesis that ABA expresses LHCB depends on ABAR and WRKY40 to a certain extent, carry out following experiment:

Cch, wrky40, three days seedling of col growth are moved to two week of continued growth back sampling detection on the substratum that contains 0,1,3,5 μ M ABA respectively.Real-time quantitative PCR detects the mRNA horizontal expression of the LHCB6 of wild-type Arabidopis thaliana (Col), mutant wrky40, double-mutant wrky40/18, and the primer of LHCB6:forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ' reverse primer:5 '-CCATGGCGTTGCCCACTCA-3 ' confidential reference items: β-Actin, confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 '.

Immunoblotting detects the expression of protein level, Actin is that last sample contrast Arabidopis thaliana total protein extracting method carries out with reference to the scheme of LHCB antibody supplier Agrisera suggestion, SDS-PAGE and immunoblotting detect with reference to Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, experiment triplicate, unanimity as a result.

As a result shown in Figure 11 D and the 11E,

Wherein, shown in the 11D left hand view, cch compares with the wild-type Arabidopis thaliana, and the LHCB6 of cch (' * ' marks) is in the slight rising of having only of protein level.

Shown in Figure 11 D right part of flg, cch compares with wrky40, and the protein expression of LHCB6 is unaffected.

Concentration according to the immunoblotting band estimates expressing quantity, is standard reference (in the column diagram shown in the red arrow) not carry out expression amount in the wild-type that ABA handles.The result is shown in Figure 11 E, and 1,3, the ABA of 5 μ M significantly is lower than in the wild-type in cch and wrky40 mutant the hormesis that LHCB6 expresses.Data are three independent biology multiple mean values.

Cch LHCB6 relative expression quantity under the ABA of 0,1,3,5 μ M handles is 40,50,55,

Wrky40 mutant LHCB6 relative expression quantity under the ABA of 0,1,3,5 μ M handles is 500,500,500, and col LHCB6 relative expression quantity under the ABA of 0,1,3,5 μ M handles is 100,400,270,150.

Four, the mutant of ABAR and WRKY40 influences the regulation and control that ABA expresses LHCB

With abar-3 mutant (the allelic simple point mutation body of ABAR, Shang Y, Yah L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) and wild-type Col extraction RNA and protein, by the expression of quantitative fluorescent PCR and immunoblotting detection (detection method is the same) LHCB gene mRNA and protein level, immunoblotting is last sample contrast with Actin.Numerical value under the protein band in the square frame is represented the proteic relative expression quantity of LHCB.With the Actin band is standard.Immunoblotting three secondary pollutants are learned and are repeated, as a result unanimity.Each numerical value all is three independent biology multiple mean values.

The result as shown in figure 12, the LHCB6 gene mRNA relative expression quantity of col is 1.00;

The LHCB6 gene mRNA relative expression quantity of abar-3 mutant is 0.75;

In conjunction with above-mentioned LHCB family member's protein level at lower concentration ABA (1,3 or 5 μ M) handling down, expression amount improves, but LHCB3 in cch and wrky40 mutant, the result that the ability of LHCB4 and LHCB6 response ABA descends significantly shows: ABA promotes the expression of LHCB by the signal path of ABAR-WRKY40 mediation.

Five, ABAR and LHCB because of double-mutant have phenotype to ABA desensitization, cross in the cch mutant and express the LHCB6 gene and can partly recover its desensitization phenotype ABA

With double-mutant lhcb1 lhcb3, lhcb1 lhcb6, lhcb1 cch, lhcb3 cch, lhcb4 cch, lhcb6 cch and wild-type Col extract RNA and protein, by the expression of quantitative fluorescent PCR and immunoblotting detection (detection method is the same) LHCB gene mRNA and protein level, immunoblotting is last sample contrast with Actin.Numerical value under the protein band in the square frame is represented the proteic relative expression quantity of LHCB.The result is as shown in figure 13: Figure 13 A is double-mutant lhcb1 lhcb3, Different L HCB expression of gene among the lhcb1 lhcb6, and Figure 13 B is a Different L HCB expression of gene among double-mutant lhcb1 cch, lhcb3 cch, lhcb4 cch, the lhcb6 cch.

Fluorescence quantitative PCR detection (Figure 13 A, the column diagram among the 13B) is passed through in the expression of mRNA level,

Protein level is expressed by immunoblotting and is detected, and Actin is last sample contrast.The proteic relative expression quantity of numeric representation LHCB among Figure 13 A below the protein band is that standard compares quantification with the wild-type.(13A detects in 13B) for be expressed in cch mutant (Figure 13 B) and all double-mutants of six LHCB (LHCB1-LHCB6).Three independent biology of immunoblotting assay repeat, and the result is similar.Each numerical value of quantitative fluorescent PCR all is three independent biology multiple mean values.

In order to study ABAR and the LHCBs gene concerns in genetic upstream and downstream, with cch-lhcbs double-mutant lhcb1 cch, lhcb3 cch, lhcb4 cch and lhcb6 cch are the phenotype that object is studied its response ABA.In the cch mutant, LHCB gene expression amount significantly descend (Figure 13 B).Yet double-mutant and cch single mutant that the mutant (lhcb1, lhcb4, or lhcb6) of single LHCB downward modulation obtains after hybridizing with cch are compared, and LHCB family gene content is significantly downward modulation not, has promoted other LHCB family members' expression on the contrary.LHCB3 knocks out in the double-mutant that obtains after mutant and the hybridization of cch mutant, and the LHCB3 gene is knocked out, but LHCB2, LHCB4, the mRNA of LHCB6 gene is raised, and the LHCB4 protein level is expressed and is raised (Figure 13 B).These data declarations have the complicated feedback regulation mechanism of a cover to keep the stability of LHCB gene family integral body in double-mutant.

Six, turn down or knock out stable state and the gene of a series of participation ABA signal paths and the expression of gene of response ABA of LHCB effect gene active oxygen

1, influences the stable state of active oxygen

As everyone knows, active oxygen (ROS) participates in ABA signal transduction process (Pei et al, 2000; Murata et al, 2001; Mustilli et al, 2002; Kwak et al, 2006; Miao et al, 2006; Zhang et al, 2009), and ROS mainly results from (Kwak et al, 2006 in the chloroplast(id) in vegetable cell; Nott et al, 2006; Galvez-Valdivieso and Mullineaux, 2010).In the chloroplast(id), the generation of ROS is main relevant with photoabsorption and electron transport, and LHCB also in these two processes, play an important role (Jansson, 1994,1999; Galvez-Valdivieso and Mullineaux, 2010).

Therefore, detect the content of ROS in the lhcb6 mutant.

Blade is taken from the soil wild-type Arabidopis thaliana plant in three weeks of growth, and at 50mMKCl, 10mMMes-Tris (pH 6.15) also contains in the damping fluid of ABA of different concns, places 200 μ Mol m ^-2Sec ^-1Pre-treatment 1h under the illumination.Then with add 0.1mg/mL NBT (being dissolved in the 100mM potassium phosphate solution) in the damping fluid and vacuumize infiltration make leaf dyeing (Amresco, Solon, OH, USA).Sample moves into 80% ethanol then at the dark 2h. that places of room temperature, and boiling water bath is handled 10min, to remove chlorophyllous interference.The detection of ROS content utilizes H2DCF-DA (SIGMA among the guard cell, D6883) contaminate the blade table leather strap that peels off, method is with reference to Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C, Song CP (2006) An Arabidopsis glutathione peroxidase functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses.Plant Cell 18:2749-2766.Pre-treatment epidermis bar in containing 0 (equal volume ethanol in contrast) or 5 μ M (±)-ABAMES-Tris damping fluid (with above) promotes stomatal opening.Then the epidermis bar was immersed in the damping fluid that 50mMTris-KCl (pH 7.2) comprises 50mM H2DCF-DA dark processing 20 minutes.Utilize MES-Tris damping fluid rinsing sample, remove unnecessary dyestuff.Utilize fluorescence microscopy (Olympus, BX51, Japan) fluorescence in the detection epidermis bar.ROS contaminates fluorescence and clicks the parameter observation: exciting light, 488nm; Transmitted light, 525nm.Experimental result as shown in figure 14, Figure 14 A is that NBT dyeing detects the generation that different concns ABA (wild-type col 0-50 μ M, 0-10 μ M in the lhcb6 mutant) handles ROS behind wild-type and the lhcbs mutant blade.The experiment triplicate obtains similar result.

Figure 14 B is the quantification that ROS produces among Figure 14 A.Estimate that by scanning dyeing brightness the dyeing concentration of ROS in the wild-type is decided to be 100%, and other quantize by comparison.

The result is 150%, 50%, 50% for the ROS amount of lhcb6 under 0,5,10 μ MABA handle;

The ROS amount of col under 0,5,10,50 μ MABA handle is 100%, 150%, 100%, 50%;

Figure 14 C is the epidermis bar that 5 μ M ABA handle wild-type and different lhcb mutant, passes through H ₂The ROS production among the guard cell is observed in DCF-DA dyeing.Test and repeat to obtain similar result three times.

Figure 14 D is the expression that real-time quantitative PCR detects a series of ABA responsive genes in the lhcbs mutant.Every group of data all are three independent biology multiple mean values.

From as can be seen above-mentioned, the content of ROS is higher than the wild-type plant in the lhcb mutant, and this all has embodiment (Figure 14 A to C) in blade and guard cell.Find to handle the generation that blade can promote ROS with the ABA of low concentration (1 to 5 μ M).This and former result of study consistent (Pei et al, 2000; Murata et al, 2001; Mustilli et al, 2002; Kwak et al, 2006; Miao et al, 2006; Zhang et al, 2009); And handle the content (50 μ M) (Figure 14 A) that just no longer includes accelerating effect even can reduce ROS with the ABA of higher concentration (10 μ M).Yet in the lhcb mutant, handle plant with low concentration ABA, and though be complete blade (1 to 10 μ M ABA, Figure 14 A and Figure 12 B) still in the guard cell ROS content of (5 μ M ABA handle, Figure 14 C) all descend.These experimental results show that turning down or knock out the LHCB gene all will influence the stable state of ROS in the vegetable cell and the ROS response to ABA.

2, turn down or knock out the gene of a series of participation of LHCB effect gene ABA signal path and the expression of gene of response ABA

Adopt fluorescent quantitation to detect the following expression that participates in ABA signal path gene and ABA responsive genes among the lhcb mutant 1-6: ABF1, ABF2/AREB1, ABF3, ABF4/AREB2 (Choi et al, 2000; Uno et al, 2000), ABI1 (Leung et al, 1994; Meyer et al, 1994; Gosti et al, 1999), ABI2 (Leung et al, 1997), ABI3 (Giraudat et al, 1992), ABI4 (Finkelstein et al, 1998), ABI5 (Finkelstein and Lynch, 2000), ERD10 (Kiyosue et al, 1994), KIN1 and KIN2 (Kurkela and Borg-Franck, 1992), MYB2 and MYC2 (Abe et al, 2003), OST1 (Mustilli et al, 2002), RAB18 (Lang and Palva, 1992), RD29A (Yamaguchi-Shinozaki and Shinozaki, 1994).

Primer is as follows:

ABF1(At1g49720)：

forward?primer：5’-TCAACAACTTAGGCGGCGATAC-3’

reverse?primer：5’-GCAACCGAAGATGTAGTAGTCA-3’

ABF2(At1g45249)：

forward?primer：5’-TTGGGGAATGAGCCACCAGGAG-3’

reverse?primer：5’-GACCCAAAATCTTTCCCTACAC-3’

ABF3(At4g34000)：

forward?primer：5’-CTTTGTTGATGGTGTGAGTGAG-3’

reverse?primer：5’-GTGTTTCCACTATTACCATTGC-3’

ABF4(At3g19290)：

forward?primer：5’-AACAACTTAGGAGGTGGTGGTC-3’

reverse?primer：5’-CTTCAGGAGTTCATCCATGTTC-3’

ABI1(At4g26080)：

forward?primer：5’-AGAGTGTGCCTTTGTATGGTTTTA-3’

reverse?primer：5’-CATCCTCTCTCTACAATAGTTCGCT-3’

ABI2(At5g57050)：

forward?primer：5’-GATGGAAGATTCTGTCTCAACGATT-3’

reverse?primer：5’-GTTTCTCCTTCACTATCTCCTCCG-3’

ABI3(At3g24650)：

forward?primer：5’-TCCATTAGACAGCAGTCAAGGTTT-3’

reverse?primer：5’-GGTGTCAAAGAACTCGTTGCTATC-3’

ABI4(At2g40220)：

forward?primer：5’-GGGCAGGAACAAGGAGGAAGTG-3’

reverse?primer：5’-ACGGCGGTGGATGAGTTATTGAT-3’

ABI5(At2g36270)：

forward?primer：5’-CAATAAGAGAGGGATAGCGAACGAG-3’

reverse?primer：5’-CGTCCATTGCTGTCTCCTCCA-3’

ERD10(At1g20450)：

forward?primer：5’-TCTCTGAACCAGAGTCGTTT-3’

reverse?primer：5’-CTTCTTCTCACCGTCTTCAC-3’

KIN1(At5g15960)：

forward?primer：5’-ACCAACAAGAATGCCTTCCA-3’

reverse?primer：5’-CCGCATCCGATACACTCTTT-3’

KIN2(At5g15970)：

forward?primer：5’-ACCAACAAGAATGCCTTCCA-3’

reverse?primer：5’-ACTGCCGCATCCGATATACT-3’

MYB2(At2g47190)：

forward?primer：5’-TGCTCGTTGGAACCACATCG-3’

reverse?primer：5’-ACCACCTATTGCCCCAAAGAGA-3’

MYC2(At1g32640)：

forward?primer：5’-TCATACGACGGTTGCCAGAA-3’

reverse?primer：5’-AGCAACGTTTACAAGCTTTGATTG-3’

OST1(At4g33950)：

forward?primer：5’-TGGAGTTGCGAGATTGATGAGAG-3’

reverse?primer：5’-CCTGTGGTTGATTATCTCCCTTTTT-3’

RAB18(At5g66400)

forward?primer：5’-CAGCAGCAGTATGACGAGTA-3’

reverse?primer：5’-CAGTTCCAAAGCCTTCAGTC-3’

RD29A(At5g52310)：

forward?primer：5’-ATCACTTGGCTCCACTGTTGTTC-3’

reverse?primer：5’-ACAAAACACACATAAACATCCAAAGT-3’

The result shown in Figure 14 D, ten important function of gene: ABI4 wherein, ABI5, ERD10, KIN1, KIN2, MYB2, MYC2, OST1, RAB18 and the RD29A expression in the lhcb mutant is significantly suppressed.All these repressed genes all are just to respond the gene of ABA or the positive regulon of coding ABA signal path.Three coding important transcription factor---genes of the positive regulon of ABA signal path, ABF1, ABF4 and ABI3, at lhcb2, lhcb4 is also significantly suppressed in the lhcb5 mutant.ABF1 and the ABF4 expression in the lhcb6 mutant does not have considerable change, and being expressed in of ABI3 do not have noticeable change (Figure 14 D) yet in lhcb1 and the lhcb3 mutant.Yet these two of ABI1 and ABI2 directly act on ABA acceptor PYR/PYL/RCAR (Fujii et al, 2009) downstream, the gene of the negative regulon of coding ABA signal path, and the expression amount in the lhcb mutant does not have noticeable change (Figure 14 D).On the contrary, gene expression amount in the lhcb mutant except that lhcb5 and lhcb6 of the positive regulon of ABF2 and ABF3 these two codings ABA signal path raises, in lhcb5 and lhcb6 mutant, ABF2 and ABF3 gene expression amount do not have considerable change (Figure 14 D).These ABA signal transduction process Expression of Related Genes quantitative changeizations fundamentally illustrate the positive regulon of LHCB gene A BA signal, but this wherein has a potential complex mechanism.

Nine, turn down or knock out the LHCB Gene Partial and suppress the phenotype of wrky40 mutant the ABA sensitivity

1, protein expression and sprouting speed

With wrky40lhcb1, wrky40lhcb3, wrky40lhcb6 mutant (wrky40lhcb1 double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky40 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation; Wrky40lhcb3 double-mutant construction process: the petal that lhcb is very bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky40 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation; Wrky40lhcb6 double-mutant construction process: the petal that lhcb6 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky40 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), wrky40 and wild-type Col extract RNA and protein, by the expression of quantitative fluorescent PCR and immunoblotting detection (detection method is the same) LHCB6 gene mRNA and protein level, immunoblotting is last sample contrast with Actin.Numerical value under the protein band in the square frame represent the proteic relative expression quantity of LHCB, and the sprouting speed of adding up after the vernalization 72 hours.With col is contrast.

The result is shown in Figure 15 A, and the sprouting speed of wrky40lhcb1 on 0,0.5,1,3 μ MABA substratum is 100%, 80%, 65%, 40%;

The sprouting speed of wrky40lhcb3 on 0,0.5,1,3 μ MABA substratum is 100%, 85%, 65%, 50%;

The sprouting speed of wrky40lhcb6 mutant on 0,0.5,1,3 μ MABA substratum is 100%, 80%, 62%, 47%;

The sprouting speed of wrky40 on 0,0.5,1,3 μ MABA substratum is 100%, 75%, 50%, 25%;

The sprouting speed of col on 0,0.5,1,3 μ MABA substratum is 100%, 100%, 90%, 59%;

As can be seen, double-mutant can significantly suppress wrky40 mutant phenotype for the ABA sensitivity aspect ABA inhibition seed germination.

2, LHCB1, LHCB3, LHCB6 expression amount reduce make the wrky40 mutant after sprouting aspect the growth susceptibility to ABA weaken

Wrky40lhcb1, wrky40lhcb3, wrky40lhcb6 mutant, wrky40 seed are directly sowed in the result of growth after 9 days on the substratum that does not contain or contain (0.6 μ M) ABA.

The result is shown in Figure 15 B, and last figure is that phenotype is observed figure, and following column diagram showed in growth on the substratum that contains 0.6 μ M ABA after 9 days, wild-type and mutant main root extended length;

The main root extended length of wrky40lhcb1 is 0.58cm;

The main root extended length of wrky40lhcb3 is 0.58cm;

The main root extended length of wrky40lhcb6 mutant is 0.58cm;

The main root extended length of wrky40 is 0.34cm;

The main root extended length of col is 1.00cm;

3, ABA induce stomatal closure (on) and ABA suppress pore open aspect, LHCB1, LHCB3, the LHCB6 expression amount reduces does not influence the response of wrky40 mutant to ABA

Wrky40lhcb1, wrky40lhcb3, wrky40lhcb6 mutant, wrky40 seed are directly sowed in the result of growth after 9 days on the substratum that contains (0.6 μ M) ABA.

The result shown in Figure 15 C,

Wrky40lhcb1 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 6.0 μ m, 5.9 μ m, 2.5 μ m, 0.9 μ m;

Wrky40lhcb3 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 5.7 μ m, 5.9 μ m, 2.0 μ m, 1.0 μ m;

Wrky40lhcb6 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 6.0 μ m, 5.9 μ m, 2.5 μ m, 1.0 μ m;

Wrky40 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 5.9 μ m, 5.9 μ m, 2.7 μ m, 0.8 μ m;

Col handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 6.0 μ m, 6.0 μ m, 2.3 μ m, 1.0 μ m;

Wrky40lhcb1 handles the open stomatal aperture of 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h inhibition pore at 0 μ M ABA and is respectively 0.8 μ m, 6.0 μ m, 3.0 μ m, 1.0 μ m;

Wrky40lhcb3 is respectively 0.8 μ m, 5.8 μ m, 3.0 μ m, 1.2 μ m at the open stomatal aperture of inhibition pore that 0 μ M ABA handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h;

Wrky40lhcb6 is respectively 0.8 μ m, 5.6 μ m, 3.0 μ m, 1.0 μ m at the open stomatal aperture of inhibition pore that 0 μ M ABA handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h;

Wrky40 is respectively 0.6 μ m, 5.8 μ m, 2.8 μ m, 1.2 μ m at the open stomatal aperture of inhibition pore that 0 μ M ABA handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h;

Col is respectively 0.8 μ m, 5.7 μ m, 2.9 μ m, 1.0 μ m at the open stomatal aperture of inhibition pore that 0 μ M ABA handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h;

Every group of data of 1-3 are three independent biology multiple mean values.

Former experimental result proof wrky40 mutant suppresses seed germination at ABA, suppress to show aspect the growth of seedling phenotype to the ABA sensitivity, do not show the phenotype that responds ABA but suppress pore at ABA inductive stomatal closure and ABA aspect open.Lhcb1, lhcb3, lhcb6 mutant are found with wrky40 mutant hybridization respectively, double-mutant can significantly suppress the wrky40 mutant ABA suppress aspect seed germination and the growth of seedling for the ABA sensitivity phenotype (Figure 15 A, 15B); But suppress the phenotype of pore aspect open for the wrky40 mutant at response ABA inductive stomatal closure and ABA and do not change (Figure 15 C).This may be because the ABA signal path that WRKY40 participates in is having the complicated mechanism of a cover to cause that the disappearance of WRKY40 function may cause the effect of ABA signal path complexity in this process aspect the adjusting stomatal movement.Yet these data provide enough genetics evidences to show that LHCB acts on the downstream of WRKY40 transcription factor, and to be that WRKY40 transcribes the direct target gene result who suppresses son consistent with the LHCB gene.

Ten, the molecule of mutant lhcb1-6 and biochemical identification

The T-DNA of Figure 16 (A-F) LHCB1-6 inserts synoptic diagram .A, lhcb1-1 (salk-134810); B, lhcb2 (salk-005614); C, lhcb3 (salk-036200); D, lhcb4 (salk-032779); E, lhcb5 (salk-139667); F, lhcb6 (salk-074622) .LP and RP identify left end primer and right-hand member primer on the genome that lhcbs uses; LBa1, T-DNA sequence left end primer; RBa1, T-DNA sequence right-hand member primer; First copy and last copy (the copy differential concatenation is inserted more than) that on behalf of the same site of insertion, T-DNA1 and T-DNAn insert respectively.

Figure 16 (A) is in LHCB1, and the T-DNA sequence of single copy is inserted into the promoter district of LHCB1 gene, concrete on position atg start codon ATG upstream-592nt and-523nt between, insert and cause 70bp to lack;

Figure 16 (B) is in LHCB2, and the T-DNA sequence is inserted into the promoter region of LHCB2 gene, concrete on position atg start codon ATG upstream-102nt and-126nt between, insert the disappearance cause 24bp;

Among Figure 16 (C) LHCB3, the T-DNA sequence is inserted into first exon district of LHCB3 gene, and concrete on position inserts the disappearance that causes 6bp between atg start codon ATG downstream 120nt and 125nt;

Among Figure 16 (D) LHCB4, the T-DNA sequence is inserted into the promoter district of LHCB4 gene in the mode of differential concatenation, concrete on position atg start codon ATG upstream-1263nt and-1247nt between, insert the disappearance that causes 17bp;

Among Figure 16 (E) LHCB5, the T-DNA sequence is inserted into the promoter district of LHCB5 gene, concrete on position atg start codon ATG upstream-483nt and-477nt between, insert the disappearance that causes 7bp;

Among Figure 16 (F) LHCB6, the T-DNA sequence is inserted into the promoter district of LHCB6 gene, concrete on position atg start codon ATG upstream-391nt and-346nt between, insert the disappearance that causes 46bp.

LHCB's transcribes and translation skill in Figure 16 (G) RT-PCR and western blot detection mutant lhcb1～6.

It is last sample contrast that immunoblotting detects with Actin.The column diagram of real-time quantitative PCR is made as standard with the expression of corresponding gene in the wild-type, and the expression amount in the mutant is a relative value, lhcb1-1 wherein, and lhcb2, hcb4, lhcb5, lhcb6 is turned down in various degree, and lhcb3 is the gene knockout mutant.Western blot detects, and the numerical value in the square frame is represented the level relatively of protein expression.The LHCB protein content is 100 among the setting Col, and the LHCB protein content quantizes by comparison in the mutant.This tests triplicate, unanimity as a result.

(lhcb1～lhcb6) middle chlorophyll a/b content significantly is not affected Figure 16 (H) mutant.Left figure: chlorophyll a, chlorophyll b and total chlorophyll content in the different mutants.Each numerical value all is three independent biology multiple mean values.Right figure: the growth of seedling state of different mutants does not have the phenotype of chlorophyll disappearance.

11, endogenous aba content and dry matter content determination and analysis material are the seedling (wild-type Arabidopis thaliana col and mutant lhcb6) in two weeks of growth in the different lhcb mutant.

(A) ABA level.Test kit is by the ABA content (Sigma test kit, Plant GrowthRegulator Immmunoassay DETECTION Kit) in the ELISA mensuration lotus throne blade.

(B) estimate dry matter content by dry weight/fresh weight.

The result shows that ABA and the dry matter content in mutant and the wild-type do not have significant difference as shown in figure 17.

12, wrky40 and wrky40wrky18 mutant do not have the gun phenotype

A, with wild-type Col, cch, wrky40 single mutant, wrky40wrky18 double-mutant seed are directly broadcast and are not being contained or containing 5 μ MNF (NF:Norflurazon, it is a kind of weedicide, after it is added into substratum, the plastid of seedling is grown by havoc, and plastid sends the reverse signal of plastid-examine to nucleus; And the mutant that this process produces is not influenced by NF promptly, and the phenotype that cell nuclear energy continues the coding plastogene be and examines phenotype---the GUN phenotype of uncoupling) substratum on, vernalization was put into 100 μ molm after three days ^-2s ^-1Under the illumination, carry out continuous illumination in 24 hours, the fluorescence quantitative PCR detection of taking a sample after 6 days.The experiment triplicate obtains same result.

Primer is to be primer with LHCB6:forward primer:5 '-GCGATGGCAGCGGTTCTTG-3 ' reverse primer:5 '-CCATGGCGTTGCCCACTCA-3 ', with β-Actin is that the primer of confidential reference items, confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 ', the result all detects the expression less than LHCBsmRNA in wrky40 single mutant and wrkywrky18 double-mutant shown in Figure 18 A.

B, with wild-type Col, cch, wrky40 single mutant seed is directly broadcast on the substratum that does not contain or contain 5 μ MNF, vernalization was put into 100 μ molm after three days ^-2s ^-1Under the illumination, carry out continuous illumination in 24 hours, the sampling immunoblotting detects after 6 days.The experiment triplicate obtains same result.

The result shown in Figure 18 B, with the same at wild-type, wrky40 and wrkywrky18 mutant, after NF handles cch, six expression of gene of LHCBs all detect less than, shown the complicacy of GUN-type chloroplast(id) reverse signal.All these results show wrky40 and wrky40wrky18 mutant right and wrong gun mutant.

From as can be seen above-mentioned, LHCBs albumen response physiological level concentration ABA and a mode chart increasing are as shown in figure 19, the WRKY40 transcription factor suppresses the expression of LHCB, ABA promotes that WRKY40 enters tenuigenin from nucleus, promote ABAR and WRKY40 to do mutually, the expression releasing by downward modulation WRKY40 is to the restraining effect of LHCBs (LHCB1/2/3/4/5/6) gene.In the tenuigenin synthetic LHCB protein transport to chloroplast(id) keeping the proteic stable state of LHCB, the challenge that plant is conformed, the proteic stable state of LHCB is essential to the foundation of ROS stable state.

Claims (12)

1. the method for a controlling plant proterties is the expression that improves LHCB6 protein coding gene in the plant that sets out, and obtains having following 1) or 2) the purpose plant of feature:

1) resistance of reverse is higher than the described plant that sets out; Described resistance of reverse is drought-resistant property;

2) delayed growth is in the described plant that sets out;

The described plant that sets out is an Arabidopis thaliana.

2. method according to claim 1 is characterized in that: it is following A or B that described purpose plant-growth delays in the described plant that sets out:

The sprouting of A, described purpose plant seed is later than the described plant that sets out;

The growth of B, described purpose roots of plants is later than the described plant that sets out.

3. method according to claim 2 is characterized in that: described drought-resistant property embodies by stomatal aperture and/or percentage of water loss;

Described root growth embodies by main root length.

4. method according to claim 1 and 2 is characterized in that: described raising is set out, and the expression of LHCB6 protein coding gene is to carry out under ABA coerces in the plant.

5. method according to claim 1 and 2 is characterized in that: the expression of described raising LHCB6 protein coding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize.

6. method according to claim 5, it is characterized in that: described activation ABAR-WRKY40 signal path is the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB6 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB6, the LHCB6 protein coding gene is expressed;

The aminoacid sequence of described ABA acceptor is the sequence 2 in the sequence table; The aminoacid sequence of described transcription factor WRKY40 is the sequence 4 in the sequence table; The nucleotides sequence of described LHCB6 promotor is classified the sequence 6 in the sequence table as.

7. the method for a controlling plant proterties is the expression that reduces LHCB6 protein coding gene in the purpose plant, obtains having following 1) or 2) plant of feature:

1) resistance of reverse is lower than described purpose plant; Described resistance of reverse is drought-resistant property;

2) growth is faster than described purpose plant;

Described purpose plant is an Arabidopis thaliana.

8. method according to claim 7 is characterized in that: described growth is following A or B faster than described purpose plant:

A) sprouting of seed is early than described purpose plant;

B) growth of root is early than described purpose plant.

9. method according to claim 8 is characterized in that: described drought-resistant property specifically embodies by stomatal aperture and/or percentage of water loss; Described root growth specifically embodies by main root length.

10. according to claim 7 or 8 described methods, it is characterized in that: the expression of LHCB6 protein coding gene is to carry out under ABA coerces in the described reduction purpose plant.

11. according to claim 7 or 8 described methods, it is characterized in that: the expression of described reduction LHCB6 protein coding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize.

12. method according to claim 11, it is characterized in that: described activation ABAR-WRKY40 signal path is specially the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB6 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB6, the LHCB6 protein coding gene is expressed;

The aminoacid sequence of described ABA acceptor is the sequence 2 in the sequence table; The aminoacid sequence of described transcription factor WRKY40 is the sequence 4 in the sequence table; The nucleotides sequence of described LHCB6 promotor is classified the sequence 6 in the sequence table as.

Images