CN102229952A

CN102229952A - Application of light-harvesting pigment chlorophyll a/b binding protein LHCB3 to plant breeding

Info

Publication number: CN102229952A
Application number: CN2011101487834A
Authority: CN
Inventors: 张大鹏; 徐艳红; 刘蕊; 王小芳; 严璐; 刘志强
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2011-06-03
Filing date: 2011-06-03
Publication date: 2011-11-02
Anticipated expiration: 2031-06-03
Also published as: CN102229952B

Abstract

The invention discloses application of a light-harvesting pigment chlorophyll a/b binding protein LHCB3 to plant breeding. The invention provides application of an LHCB3 protein to plant stress tolerance improvement. An amino acid sequence of the LHCB3 protein is shown as a sequence 1 in the sequence table. The improvement of plant stress tolerance is stressed by a hormone; and the hormone is an ABA. A nucleotide sequence of an LHCB3 protein coding gene is shown as a sequence 2 in the sequence table. The improvement of plant stress tolerance comprises 1) or 2) as follows: 1) the LHCB3 protein coding gene is introduced into an LHCB3 expression inactivated mutant plant to obtain an LHCB3 protein expression recovered plant, and stress tolerance of the LHCB3 protein expression recovered plant is stronger than that of the LHCB3 protein expression inactivated mutant; 2) stress tolerance of the LHCB3 protein expression inactivated mutant is stronger than that of an LHCB3 expressed plant. Experiments of the present invention prove that adjusting of the LHCB3 expression by the ABA is through a signal path, which an ABAR/CHLH is participated in.

Description

Catch the application of the conjugated protein LHCB3 of photopigment chlorophyll a/b in plant breeding

Technical field

The present invention relates to biological technical field, relate in particular to a kind of application of the conjugated protein LHCB3 of photopigment chlorophyll a/b in plant breeding of catching.

Background technology

Light harvesting chlorophyll a/b conjugated protein (LHCB) is the lipophorin of photosynthetical system II (PSII) complex body.LHCB albumen is usually caught the optical antenna complex body with chlorophyll, xenthophylls composition complex body become photosynthetical system.These are caught the optical antenna complex body and absorb luminous energy and transmit excitation energy to drive photosynthetic electron transport system to PSII photoresponse center.The exterior antenna albumen LHCBs of PSII complex body catches the integral part that the photorecombination body weight is wanted, and it is the abundantest membranin of occurring in nature content.LHCBs albumen is by less antenna complex body: LHCB4 (CP29), LHCB5 (CP26) and LHCB6 (CP24) and bigger antenna complex body: homology and allogenic tripolymer LHCB1, LHCB2 and LHCB3.

These chloroplast(id)/thylakoid proteins are by nuclear gene encoding, and it is expressed factors such as mainly being subjected to environment and growth and regulates, and comprises mainly being subjected to light (Silverthorne and Tobin, 1984; Sun and Tobin, 1990; Peer et al, 1996; Millar and Kay, 1996; Weatherwax et al, 1996; Yang et al, 1998; Humbeck and Krupinska, 2003; Nott et al, 2006; Staneloni et al, 2008; De Montaigu et al, 2010; Pruneda-Paz and Kay, 2010; Thines and Harmon, 2010); Active oxygen (Nott et al, 2006; Staneloni et al, 2008), the reverse signal of chloroplast(id) (Nott et al, 2006), diel rhythm (Paulsen and Bogorad, 1988; Strayer et al, 2000; Alabadi et al, 2001; Thain et al, 2002; Andronis et al, 2008; Pruneda-Paz etal, 2009; De Montaigu et al, 2010; Pruneda-Paz and Kay, 2010; Thines and Harmon, 2010) and regulation and control (Bartholomew et al, 1991 of bio-hormone dormin (ABA); Chang and Walling, 1991; Weatherwax et al, 1996; Staneloni et al, 2008).Plant is considered to plant to the adjusting of LHCB protein expression and regulates the chloroplast(id) function with one of the important mechanisms of reply adverse circumstance (Nott et al, 2006; De Montaigu et al, 2010; Pruneda-Paz and Kay, 2010; Thines and Harmon, 2010).

ABA is the important biomolecule hormone of coordinate plant growth and growth, especially in (Finkelstein et al, 2002 of playing an important role aspect the plant responding adverse circumstance; Adie et al, 2007).It is believed that ABA negative regulation LHCB expression of gene in the past, and regulated the expression of LHCB with response high light adverse circumstance (Bartholomew et al, 1991 with the light synergy; Chang andWalling, 1991; Weatherwax et al, 1996; Staneloni et al, 2008).The expression that high light is turned down LHCB may be (Weatherwax et al, 1996) that the change by ABA concentration in the plant materials realizes.Yet ABA is not understood fully for the physiological significance of LHCB genetic expression.

ABA signal transduction process has obtained extensive studies, and people identify and obtained many moietys of participating that this is comprising being positioned at cytolemma and intracellular ABA acceptor.Plasmalemma protein GCR2 and GTG1/GTG2 are considered to be in the ABA acceptor that cell surface works.One class START albumen PYR/PYL/RCAR is considered to act on intracellular ABA acceptor, and the upstream that directly acts on the PP2C signal path is to regulate the expression of downstream gene.The H subunit (CHLH/ABAR) of having reported magnesium porphyrin IX (Mg-ProtoIX) chelatase in the Arabidopis thaliana can act on ABA signal transduction process in conjunction with ABA as the ABA acceptor.Recently, reported that again ABAR can suppress the expression of some ABA responsive genes in conjunction with one group of WRKY transcription factor, as ABI5.In fact, thus ABA is considered to plant with diel rhythm be subjected to a key link between the ABA regulation and control response drought environment.ABAR/CHLH also plays many effects in vegetable cell: the combining of catalysis magnesium ion and porphyrin IX in the chlorophyll building-up process, and as the reverse signal transduction process of genome uncoupling protein (GUN5) mediation plastid-nuclear.

ABAR/CHLH is not only the ABA acceptor, also has the GUN phenotype and participate in regulating the LHCB expression of gene in the reverse signal of chloroplast(id).

Summary of the invention

An object of the present invention is to provide a kind of method of controlling plant proterties.

The invention provides the method for controlling plant proterties, is the expression that improves LHCB3 protein coding gene in the plant that sets out, and obtains having following 1) or 2) the purpose plant of feature:

1) resistance of reverse is higher than the described plant that sets out;

2) delayed growth is in the described plant that sets out.

It is following A or B that described purpose plant-growth delays in the described plant that sets out:

The sprouting of A, described purpose plant seed is later than the described plant that sets out;

The growth of B, described purpose roots of plants is later than the described plant that sets out;

The sprouting of described purpose plant seed is later than the described plant that sets out and is presented as that the germination rate of described purpose plant seed is lower than the described plant that sets out;

The growth of the root of described purpose plant seed is later than the described plant that sets out and is presented as that described purpose roots of plants length is less than the described plant that sets out;

Described raising is set out, and the expression of LHCB3 encoding gene is to carry out under hormone is coerced in the plant;

Described hormone is specially ABA;

The nucleotides sequence of the proteic encoding gene of described LHCB3 is classified the sequence 1 in the sequence table as.

Described resistance of reverse is drought-resistant property;

The described plant that sets out is monocotyledons or dicotyledons, and described monocotyledons is an Arabidopis thaliana.

Described raising is set out, and the expression of LHCB3 encoding gene realizes by import described LHCB3 encoding gene in the plant that sets out in the plant.

Described ABA coerces to becoming carry out the length of time in plant seedlings phase or plant;

Described concentration of coercing at plant seedlings phase ABA is 0.5-5 μ M; Described concentration of coercing at plant seedlings phase ABA is specially 0.5 μ M, 1 μ M, 2 μ M, 3 μ M or 5 μ M;

Describedly become concentration that the length of time, ABA coerced to be lower than 200 μ M plant but be not 0 μ M, be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M.

Described drought-resistant property embodies by stomatal aperture and/or percentage of water loss;

Described root growth embodies by main root length.

The expression of described raising LHCB3 encoding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize.

Described activation ABAR-WRKY40 signal path is the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB3 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB3, the LHCB3 encoding gene is expressed;

The aminoacid sequence of described ABA acceptor is the sequence 2 in the sequence table;

The nucleotides sequence of the encoding gene of described ABA acceptor is classified the sequence 3 in the sequence table as;

The aminoacid sequence of described transcription factor WRKY40 is the sequence 4 in the sequence table;

The nucleotides sequence of the encoding gene of described transcription factor WRKY40 is classified the sequence 5 in the sequence table as;

The nucleotides sequence of described LHCB3 promotor is classified the sequence 6 in the sequence table as.

Another object of the present invention provides a kind of method of controlling plant proterties.

Method provided by the invention is the expression that reduces LHCB3 protein coding gene in the purpose plant, obtains having following 1) or 2) plant of feature:

1) resistance of reverse is lower than described purpose plant;

2) growth adds faster than described purpose plant.

It is following A or B that the growth of described plant adds faster than the described plant that sets out:

A) sprouting of the seed of described plant is early than described purpose plant;

B) growth of the root of described plant is early than described purpose plant;

The sprouting of the seed of described plant is presented as that early than described purpose plant the germination rate of seed of described plant is greater than described purpose plant;

The growth of the root of described plant is presented as that early than described purpose plant the root of described plant grows up in described purpose plant;

The expression of LHCB3 protein coding gene is to carry out under hormone is coerced in the described reduction purpose plant;

Described hormone is specially ABA;

The nucleotides sequence of the proteic encoding gene of described LHCB3 is classified the sequence 1 in the sequence table as;

Described resistance of reverse is drought-resistant property;

The described plant that sets out is monocotyledons or dicotyledons, and described monocotyledons is an Arabidopis thaliana;

Describedly become concentration that the length of time, ABA coerced to be lower than 200 μ M plant but be not 0 μ M, be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M;

Described drought-resistant property specifically embodies by stomatal aperture and/or percentage of water loss;

Described root growth specifically embodies by main root length;

The expression of described reduction LHCB3 encoding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize;

Described activation ABAR-WRKY40 signal path is specially the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB3 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB3, the LHCB3 encoding gene is expressed;

The 3rd purpose of the present invention provides the method that improves a kind of plant stress tolerance or delay plant-growth.

Method provided by the invention comprises the steps: with ABA plant to be coerced, and obtains having the plant of following proterties:

1) the purpose plant stress tolerance is higher than the plant that sets out;

2) delayed growth of purpose plant is in the plant that sets out;

Plant before handling is remembered the plant that sets out, the plant note after handling is done the purpose plant.

Describedly become the concentration that the length of time, ABA coerced to be lower than 200 μ M, be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M plant;

Described feature also is embodied in following 1)-3) in any:

1) coerce down at ABA, the wild-type plant resistance of reverse is higher than the mutant LHCB3 of LHCB3 protein expression inactivation;

2) coerce down at ABA, the germination rate of the seed of wild-type plant is lower than the mutant LHCB3 of LHCB3 protein expression inactivation;

3) coerce down at ABA, the root length of wild-type plant is lower than the mutant LHCB3 of LHCB3 protein expression inactivation.

Of the present invention experimental results show that, the expression that ABA regulates LHCB3 is the signal path that participates in by ABAR/CHLH, each LHCB family member's normal expression needs the participation of ABA, and the ABA of high density promotes the expression of LHCB in the physiological level, WRKY40 directly acts on the LHCB gene as negative regulon, LHCB participates in ABA signal transduction process by the signal path of ABAR-WRKY40 mediation, be a positive regulon in the ABA signal transduction process, seed germination, growth of seedling and stomatal movement isophenous that response ABA regulates.

Description of drawings

Fig. 1 stimulates mRNA and the proteic expression of LHCBs for ABA

Fig. 2 stimulates LHCB3 in phenotype aspect seed germination and the growth of seedling for ABA

Fig. 3 stimulates the influence of LHCB3 to stomatal movement and drought stress for ABA

Fig. 4 stimulates the influence of LHCB3 to germination rate, stomatal movement and drought stress for ABA

Fig. 5 expresses in the lhcbs mutant for 35S drives the LHCBs gene, recovers the phenotype of plant

Fig. 6 expresses fully for LHCB gene under the ABA stimulation

Fig. 7 transcribes the sub-WRKY40 of inhibition to combine with LHCB family member's promotor

Fig. 8 suppresses the LHCB expression of gene for WRKY40

Fig. 9 is a LHCB expression of gene in the abar-3 mutant

Figure 10 is the molecule and the biochemistry detection of lhcb double-mutant and lhcbcch double-mutant

Figure 11 is the expression of ROS stable state and a series of ABA responsive genes in the lhcb mutant

Figure 12 makes the wrky40 mutant partly return to wild-type status to the susceptibility of ABA for the LHCB3 gene expression amount reduces

Figure 13 is molecule and the biochemical identification of mutant lhcb1-6

Figure 14 is endogenous aba content and a dry matter content mensuration in the different lhcb mutant

Figure 15 does not have the gun phenotype for wrky40 and wrky40wrky18 mutant

The mode chart that Figure 16 increases for LHCBs albumen response physiological level concentration ABA

Figure 17 is the expression of LHCB3 in different tissues

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Agents useful for same etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

Material used among the following embodiment is as follows:

1, T-DNA inserts mutant and comprises that the lhcb1.1 (SALK-134810) of LHCB1.1 gene (At1g29920) is (hereinafter to be referred as lhcb1, LHCB1 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), the lhcb2.2 (SALK-005614) of LHCB2.2 gene (At2g05070) is (hereinafter to be referred as lhcb2, LHCB2 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), LHCB3 gene (At5g54270, LHCB3 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not have to change) lhcb3 (SALK-036200), the lhcb4.3 (SALK-032779) of LHCB4.3 gene (At2g40100) is (hereinafter to be referred as lhcb4, LHCB4 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), lhcb5 (the SALK-139667 of LHCB5 gene (At4g10340), LHCB5 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), lhcb6 (the SALK-074622 of LHCB6 gene (At1g15820), LHCB6 gene in the wild-type Arabidopis thaliana inserted by T-DNA knocking out that sudden change obtains, all the other genes do not change), the seed of these mutant is all available from ABRC.

2, available from cold spring harbor laboratory, this mutant has a Ds transposon to insert at second exon of WRKY40 (At1g80840) gene to wrky40-1 (ET5883, the environmental background of Ler is hereinafter to be referred as the wrky40 mutant).The wrky40-1 mutant is to be transformed into the Col background by backcrossing from the Ler background.

Wrky18-1 (SALK-093916) is that the T-DNA insertion on first exon of WRKY18 (At4g31800) gene knocks out mutant available from ABRC, has identified it is two amorphss before these two mutant.

3, two sudden changes

All double-mutants all pass through hybridization and the PCR evaluation obtains: the double-mutant construction process: the petal that a kind of mutant is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming or not blooming in the another kind of mutant, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation.

4, cch mutant (Col background, the mutant of ABA acceptor) (Shen Y-Y, Wang X-F, Wu F-Q, Du S-Y, CaoZ, Shang Y, Wang X-L, Peng C-C, Yu X-C, Zhu S-Y, Fan R-C, Xu Y-H, Zhang D-P (2006) .The Mg-chelatase H subunit is an abscisic acid receptor.Nature 443:823-826, the public can obtain from Tsing-Hua University.) present by doctor J.Chory.

5, ABA synthesis mutant aba2 (CS156:aba2-1, Col background, ABA acceptor) is available from ABRC.

Plant growing condition: MS substratum in illumination box 19-20 ℃, light intensity is 80 μ molm- ²s ^-1, illumination intensity is 120 μ molm-when growing in the soil ²s ^-1, 16h illumination.

6, the acquisition of the complementary Arabidopis thaliana of lhcbs mutant

Extract the genomic dna of the Arabidopis thaliana plant that Colombia (Col-0) ecotype is a background (ABRC:CS60000, hereinafter to be referred as the wild-type Arabidopis thaliana, note is made col), carry out pcr amplification with following primer:

forward?primer：5’-GCTCTAGAATGGCATCAACATTCACGAGCTC-3’(XbaI)

reverse?primer：5’-GGGGTACCAGCTCCAGGTGCAAACTTAGTTG-3’(KpnI)

Obtain the PCR product of 798bp, through order-checking, the nucleotides sequence of this product is classified XM_002864277 (having the Nucleotide shown in the sequence 1) as.

The PCR product is cut through SmaI and SalI enzyme, obtain enzyme and cut after product, this enzyme is cut after product and the pCAMBIA1300-221 carrier (Shang Y, Yan L, the Liu ZQ that cut through same enzyme, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) connection, obtain transformant, extract the plasmid of transformant, through order-checking, this plasmid is the carrier that obtains between the SmaI of LHCB3 gene insertion pCAMBIA1300-221 carrier and SalI restriction enzyme site, called after pCAMBIA1300-221-LHCB3.

Change pCAMBIA1300-221-LHCB3 over to agrobacterium tumefaciens GV3101 bacterial strain, bacterium 3 obtains recombinating, extract plasmid and send to order-checking, the result is pCAMBIA1300-221-LHCB3 for the plasmid of reorganization bacterium 3, and bacterium 3 called after GV3101/pCAMBIA1300-221-LHCB3 will recombinate.

GV3101/pCAMBIA1300-221-LHCB3 is infected mutant LHCB3 by the petal osmose process, obtain T0 for the complementary Arabidopis thaliana of LHCB3.

T0 is planted, sows for the complementary Arabidopis thaliana receipts of LHCB3, continue to go down to posterity, up to obtaining T3 for the complementary Arabidopis thaliana of LHCB3, be the complementary Arabidopis thaliana of lhcbs mutant, note is made lhcb3 ^*

7, ch1-1 is the chlorophyll synthesis mutant, Arabidopis thaliana Biological resources center ABRC, CS3119.

Experiment among the following embodiment is three repetitions, and three experiments that are that relate to quantitative test are averaged.

Embodiment 1, LHCB3 expresses under the coercing of ABA influences plant seed germination, growth of seedling and drought-enduring

One, external source applies the influence of lower concentration ABA (being equivalent to physiological condition high density ABA) to LHCB3 mRNA and protein level expression

Carrying out ABA in two stages of development of plants respectively handles: the seedling phase with become the length of time.

The seedling phase: three days wild-type Arabidopis thaliana (col) of common MS substratum growth (ABRC, CS60000) seedling move to contain 0,0.5,1,3,5 or the substratum (ABA+MS substratum) of the ABA of 10uM in two weeks of regrowth;

Become the length of time: move to the ABA aqueous solution 10ml that sprays different concns after three weeks of wild-type Arabidopis thaliana growth of seedling in the soil) growth 5 hours, collect material.

The concrete detection method that mRNA expresses: with reference to BioRad Real-Time System CFX96TM C1000 Thermal Cycler (Singapore) instrument specification sheets RT-PCR is carried out in the expression of the mRNA level of LHCB3 and detect, template is the cDNA of plant, and primer is forward primer:5 '-AATGATCTTTGGTATGGACCTGAC-3 '

Reverse primer:5 '-CCACACGGACCCACTTTTG-3 ', confidential reference items are that the primer of β-Actin, confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer5 '-AACGACCTTAATCTTCATGCTGC-3 '.

The concrete detection method of LHCB3 protein expression: with the quick-frozen in liquid nitrogen of whole plant, material is clayed into power in liquid nitrogen, in the 1.5mL centrifuge tube of packing into grinding cymbals and grinding rod that precooling is good.Extracting the damping fluid composition is 50mM Tris-HCl, and pH 7.5,150mMNaCl, and 1mM EDTA, 0.1% (v/v) Triton X-100,10% (v/v) glycerol, and add proteinase inhibitor.Add centrifuge tube according to extracting damping fluid and 4: 1 ratio of sample, and put into the liquid nitrogen quick-frozen rapidly.Utilize the cytoclasis ultrasonic apparatus that the mixture supersound process is extremely thawed fully, and then put into the liquid nitrogen quick-frozen.The above-mentioned steps triplicate.With centrifugal 3 minutes of mixture 10000g, remove insolubles and broken cell.It is stand-by that supernatant liquor is transferred to new centrifuge tube, is LHCB3 albumen.

LHCB3 albumen is carried out the SDS-PAGE and the immune marking, concrete experimental procedure is with reference to the paper Wu F-Q that has delivered, XinQ, Cao Z, Liu Z-Q, Du S-Y, Mei C, Zhao C-X, Wang X-F, Shang Y, Jiang T, Zhang X-F, Yan L, Zhao R, Cui Z-N, Liu R, Sun H-L, Yang X-L, Su Z, Zhang D-P (2009) .The Mg-chelatase H subunit binds abscisic acid and functions in abscisic acid signaling:New evidence in Arabidopsis.Plant Physiol 150:1940-1954.The specific antibody of LHCB3 is available from Agrisera (Stockholm, Sweden; Website:www.agrisera.com; Product No.:AS01002).

The result as shown in Figure 1,

Figure 1A: in the seedling: the mRNA expression level that 0 to 5 μ M ABA handles back LHCB3 raises, and reduces but 10 μ M ABA handle the mRNA expression level of back LHCB3.With three days wild-type seedling, move on on the substratum that contains different concns ABA, continued growth two weeks sampling detects (concrete detection method is seen above-mentioned mRNA detection of expression).Every group of data all are three independent biology multiple mean values.

0 μ M ABA handles, and the mRNA relative expression quantity of LHCB3 is 0.30;

0.5 μ M ABA handles, the mRNA relative expression quantity of LHCB3 is 0.61;

1 μ M ABA handles, and the mRNA relative expression quantity of LHCB3 is 0.98;

2 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.08;

3 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.05;

5 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.05;

10 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 0.09;

Figure 1B: become in the seedling in age: be lower than 200 μ M ABA and handle the mRNA expression level rising that makes LHCB3, handle the mRNA expression level reduction that makes LHCB3 but be higher than 200 μ M ABA.ABA solution sprays the plant detection (concrete detection method is seen above-mentioned mRNA detection of expression) of taking a sample after 5 hours in three ages in week.Every group of data all are three independent biology multiple mean values.

0 μ M ABA handles, and the mRNA relative expression quantity of LHCB3 is 1.00;

20 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.10;

50 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.49;

100 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.47;

150 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.25;

200 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 1.15;

300 μ M ABA handle, and the mRNA relative expression quantity of LHCB3 is 0.75.

Fig. 1 C: in the seedling: the protein expression level that 0 to 5 μ M ABA handles back LHCB3 raises, and reduces but 10 μ M ABA handle the protein expression level of back LHCB3.Material processing is with (A).Actin is last sample contrast, tests and repeats to obtain similar result three times.

Detection method sees that specifically the LHCB protein expression detects.

Fig. 1 D: become in the seedling in age: be lower than 200 μ M ABA and handle the protein expression level rising that makes LHCBs (LHCB1～6), handle the protein expression level reduction that makes LHCBs (LHCB1～6) but be higher than 200 μ M ABA.Material processing is with (B).Actin is last sample contrast, tests and repeats to obtain similar result three times.

Detection method sees that specifically the LHCB protein expression detects.

From as can be seen above-mentioned: in the seedling phase, the ABA concentration of 0.5 to 5 μ M promotes the mRNA of LHCB3 to express, expression amount decline (Figure 1A) during 10 μ M.Becoming the length of time, the ABA concentration that is lower than 200 μ M is handled the mRNA expression that Arabidopis thaliana promotes LHCB3, and when being higher than 200 μ M, the mRNA expression amount of LHCB3 descends, and the ABA of 50 μ M is the optimal concentration (Figure 1B) that promotes that LHCB3 expresses.

Further research ABA is to the influence of LHCB protein expression.In the seedling phase, the LHCB protein expression is in full accord for response and mRNA level that ABA handles, and expression amount reaches maximum (Fig. 1 C) when 1 to 3 μ M handles.Becoming the length of time, from 20 to 300 μ M all promote the proteic expression of LHCB, and along with the increase of ABA concentration, expression amount increases (Fig. 1 D), this expression with mRNA different (Figure 1B).

Experimental result shows, being expressed in to transcribe with translation skill of LHCB is subjected to different adjustings.

In a word, above data basic explanation, the lower concentration that external source applies is equivalent to high density ABA under the physiological condition, promotes rather than suppress the expression of LHCB.

Two, improve the germination rate and the long variation of root of the detection of expression seed of LHCB3 encoding gene in the plant that sets out

1, seed germination experiment

Divide three parts to broadcast about 100 seed disinfections for the treatment of measuring plants at MS substratum (Sigma, St.Louis, MO, USA; Full-strength MS).Substratum contain 3% sucrose and 0.8% agar powder (pH 5.9) and contain 0,0.5, the ABA of 1uM.Seed vernalization 3 days under 4 ℃ of conditions is placed on growth under 20 ℃ of illumination conditions then, sprouts the data of (appearance of root) at the time record that indicates.

The above-mentioned measuring plants for the treatment of is the lhcb3 mutant, wild-type Arabidopis thaliana col, double-mutant lhcb1 lhcb3 (double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb3 or not blooming, on the lhcb1 pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), the cch mutant, ch1-1 (ABRC:CS3119), double-mutant lhcb3 cch (double-mutant construction process: the petal that lhcb3 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the cch or not blooming, on the lhcb3 pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation).

Each numerical value all is three independent biology multiple mean values.

The result shown in Fig. 2 A-2D and 4A-4C,

As can be seen from Figure 2A, lhcb3 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 32%, 95%, 100%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 18%, 65%, 93%, 98%, 100%; In the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 8%, 48%, 72%, 91%, 95%;

Ch1-1 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 80%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 1%, 30%, 72%, 90%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 0%, 20%, 43%, 75%, 84%;

Col in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 78%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 0%, 22%, 70%, 86%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 0%, 17%, 35%, 70%, 83%;

As can be seen from Figure 2B,

Double-mutant lhcb1 lhcb3 in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 90%, 98%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 56%, 82%, 94%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 2%, 40%, 60%, 80%, 90%;

Col in the substratum of the ABA of 0 μ M, 24,36,48,60, the germination rate of 72h is respectively 8%, 80%, 96%, 100%, 100%; In the substratum of the ABA of 0.5 μ M, 24,36,48,60, the germination rate of 72h is respectively 2%, 22%, 65%, 82%, 100% in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 0%, 10%, 30%, 62%, 80%.

From Fig. 2 C as can be seen,

Lhcb3 cch in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 9%, 23%, 52%, 85%, 91%,

Wild-type col in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 10%, 78%, 88%, 100%, 100%,

Cch in the substratum of the ABA of 1 μ M, 24,36,48,60, the germination rate of 72h is respectively 19%, 90%, 98%, 100%, 100%;

Above description of test: under the stimulation of ABA, turn down LHCB2 gene expression amount (lhcb3), germination rate improves on the contrary, improve LHCB3 gene expression amount (col), germination rate reduces, and as can be seen, turns down the LHCB3 gene expression amount and has reduced the responding ability of seed germination to ABA.

From Fig. 4 A-4C also as can be seen, the germination rate of mutant LHCB3 is higher than wild-type col.

From Fig. 4 D as can be seen, mutant desensitizes for ABA aspect growth of seedling, and the double-mutant of LHCB family desensitizes for ABA aspect growth of seedling, and the double-mutant of mutant and cch desensitizes for ABA aspect growth of seedling.

2, the long experiment of root

Plant seed to be measured is directly broadcast in the MS of the ABA that contains 1uM substratum and is sowed, and (E F) takes pictures that to observe the statistics root long, adds up with main root length to grow 12 after the vernalization.

Treat that measuring plants is single mutant lhcb3, double-mutant lhcb1 lhcb33 (double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb3 or not blooming, on the lhcb1 pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote through the PCR evaluation construction process please be provided for growth), wild-type Arabidopis thaliana col, the cch single mutant, double-mutant lhcb3 cch.Each numerical value all is that three independent biology multiple are average.

The result shown in Fig. 2 E and 2F,

As can be seen, the root of lhcb3 is long to be 6.2mm from 2E;

The root of Col is long to be 2.0mm;

The root of double-mutant lhcb1 lhcb3 is long to be 7.8mm;

From Fig. 2 F as can be seen,

The seedling root of Lhcb3 cch double-mutant on the ABA substratum that contains 1 μ M is long to be 6.5mm;

The seedling root of cch single mutant on the ABA substratum that contains 1 μ M is long to be 7.2mm;

The seedling root of wild-type col on the ABA substratum that contains 1 μ M is long to be 2.1mm;

Above-mentioned experiment as can be seen, all lhcb3 mutant are in the phenotype that is showing aspect seed germination and the growth of seedling ABA desensitization: ABA suppresses seed germination, and ABA suppresses growth of seedling.

Three, improve the influence of the expression of LHCB3 encoding gene in the plant that sets out to resistance of reverse

1, stomatal movement experiment:

ABA inductive stomatal closure system: the plant leaf to be measured in 3 weeks of growth in the soil is immersed in the damping fluid that contains 50mM KCl and 10mMMes-Tris (pH 6.15), with 200 μ molm- ²s ^-1Intensity is placed 2.5h under cold light source, add (±)-ABA of different concns then.After ABA handles 2.5h, tear and get the epidermis bar, the measurement and record of stomatal aperture.

ABA suppresses the pore open system: the plant leaf to be measured in 3 weeks of growth in the soil is immersed in the identical damping fluid, and dark processing 2.5h adds ABA then and moves under the cold light source and shine 2h, the measurement and record of stomatal aperture in damping fluid.

Treat that measuring plants is col, cch, the lhcb3 mutant.

The result is shown in Fig. 4 E, and wherein inducing stomatal closure is last figure, and suppressing pore open is figure below.Each numerical value all is that five independent biology multiple are average.The aperture of each 60 pores of duplicate record.

From Fig. 4 E as can be seen,

Col 0uMABA handle 0h, 0uMABA handle 2.5h, 20uMABA handle 2.5h, 30uMABA handle 2.5h induce stomatal closure the time pore aperture be respectively 5.0 μ m, 5.1 μ m, 28 μ m, 0.3 μ m;

The aperture of pore was respectively 1.4 μ m, 4.4 μ m, 2.2 μ m, 0.2 μ m when col handled the inhibition pore opening of 0h, 0uMABA processing 2.5h, 20uMABA processing 2.5h, 30uMABA processing 2.5h at 0uMABA;

Cch 0uMABA handle 0h, 0uMABA handle 2.5h, 20uMABA handle 2.5h, 30uMABA handle 2.5h induce stomatal closure the time pore aperture be respectively 6.2 μ M, 6.3 μ M, 5.8 μ M, 2.6 μ M;

The aperture of pore was respectively 1.5 μ M, 6.7 μ M, 5.5 μ M, 2.3 μ M when cch handled the inhibition pore opening of 0h, 0uMABA processing 2.5h, 20uMABA processing 2.5h, 30uMABA processing 2.5h at 0uMABA;

Single mutant lhcb3 0uMABA handle 0h, 0uMABA handle 2.5h, 20uMABA handle 2.5h, 30uMABA handle 2.5h induce stomatal closure the time pore aperture be respectively 6.1 μ M, 6.0 μ M, 5.1 μ M, 4.2 μ M;

The aperture of pore was respectively 0.9 μ M, 6.0 μ M, 5.5 μ M, 4.6 μ M when single mutant lhcb3 handled the inhibition pore opening of 0h, 0uMABA processing 2.5h, 20uMABA processing 2.5h, 30uMABA processing 2.5h at 0uMABA;

As can be seen, ABA inductive stomatal closure and suppress pore open aspect, the lhcb3 mutant shows the desensitization phenotype to ABA: promptly ABA induces down, crosses expression lhcb3 (col) and compares with suppressing lhcb3 (lhcb3), the stomatal aperture change greatly.

2, arid experiment and percentage of water loss experiment

To treat that measuring plants after the growth, does not water and carries out drought stress (arid is rehydration after 21 days, adds up percentage of water loss after 2 days), takes pictures from substratum immigration soil.Be contrast normally to water.With wild-type and different lhcb mutant, at every turn each sample get 5 strain blades experimentize (around choosing age the fully-developed blade on the bolting plant not, be placed on the pan paper, weigh once every 1h, calculate the blade percentage of water loss.Formula should be: (0h weight-1h weight)/0h weight)) rate-of-loss of coolant of excised leaf.

Treat that measuring plants is wild-type Arabidopis thaliana Col, mutant lhcb3.

Take pictures the result that observes shown in Fig. 4 H, and wild-type Arabidopis thaliana Col growth better behind the drought stress, mutant lhcb2 is withered substantially.

The result of percentage of water loss shown in Fig. 4 G, as can be seen,

Lhcb3 is respectively 17%, 38%, 50%, 65%, 73% in the percentage of water loss of

ABA processing

1,2,3,4,5,6h;

Col is respectively 12%, 24%, 34%, 44%, 54% in the percentage of water loss of

ABA processing

1,2,3,4,5,6h.

The excised leaf of discovering the lhcb mutant is more with the equal time dehydration under the exsiccant condition.This may desensitization causes to ABA aspect stomatal movement owing to these mutant.Simultaneously, find the lhcb mutant in that normally to water under the water condition growth conditions consistent with wild-type, and under drought condition, the water retention capacity of mutant is lower than wild-type.

4, the complementary Arabidopis thaliana of lhcbs mutant is in seed germination, growth of seedling and drought-enduring research

1) seed germination, root are long

Lhcb3* represents the complementary strain system (preparation method is as implied above) of LHCB6 gene.

With lbcb3* and col after after the vernalization on the ABA substratum of 1 μ M 48 hours, the statistics seed germination rate.

After after the vernalization on the ABA substratum of 1 μ M 12 days, the statistics root is long with lbcb3* and col.

The result is shown in Fig. 5 A, col, lbcb3* 48 hours germination rate after vernalization on the ABA substratum of 1 μ M is respectively 32%, 26%, lhcb3 mutant phenotype to the ABA desensitization aspect seed germination causes owing to the LHCB3 gene expression amount reduces as can be seen.

Col, lbcb3* 12 days root long (main root length) after vernalization on the ABA substratum of 1 μ M is respectively 2.5mm, 1.8mm, as can be seen the lhcb3 variant aspect growth of seedling to the phenotype of ABA desensitization since the reduction of LHCB3 gene expression amount cause.

2) drought-enduring (stomatal aperture)

Lbcb3* and col are induced stomatal closure according to the method described above and suppress the pore opening experiment, and at the initial stomatal aperture of 0 μ M ABA 0 hour record, 0 μ M or 20 μ M ABA handle after 2.5 hours measurement and record of stomatal aperture again.Each numerical value all is that five independent biology multiple are average.The aperture of each 60 pores of duplicate record.The identical expression of letter (in P＜0.05 level of difference) does not have significant difference, and alphabetical different table is shown with significant difference.

The result is shown in 5B, and it is last figure that ABA induces stomatal closure, and suppressing pore open is figure below,

Col and lbcb3* 0 hour the open stomatal aperture of inhibition pore after vernalization on the ABA substratum of 0 μ M is respectively 6.0 μ m, 5.8 μ m, and wild-type Col is consistent with the initial opening of mutant pore as can be seen.

Col and lbcb3* 2.5 hours the stomatal aperture of inducing stomatal closure after vernalization on the ABA substratum of 0 μ M is respectively 4.9 μ m, 5.8 μ m, does not carry out ABA as can be seen and handles, and wild-type is that phenotype is consistent with transgenosis recovery strain.

Col and lbcb3* 2.5 hours the open stomatal aperture of inhibition pore after vernalization on the ABA substratum of 0 μ M is respectively 5.5 μ m, 5.8 μ m, does not carry out ABA as can be seen and handles, and wild-type is that phenotype is consistent with transgenosis recovery strain.

Col and lbcb3* 2.5 hours the stomatal aperture of inducing stomatal closure after vernalization on the ABA substratum of 20 μ M is respectively 3.1 μ m, 2.5 μ m, as can be seen after ABA handles, transgenic line recovers lhcb3 mutant phenotype to the ABA desensitization aspect stomatal movement substantially, illustrates that the lhcb3 mutant causes owing to the LHCB3 gene expression amount reduces the phenotype of ABA desensitization.

Col and lbcb3* 2.5 hours the open stomatal aperture of inhibition pore after vernalization on the ABA substratum of 20 μ M is respectively 3.2 μ m, 2.6 μ m, as can be seen after ABA handles, transgenic line recovers lhcb3 mutant phenotype to the ABA desensitization aspect stomatal movement substantially, illustrates that the lhcb3 mutant causes owing to the LHCB3 gene expression amount reduces the phenotype of ABA desensitization.

Lbcb3* can recover the wild-type phenotype as can be seen, and in conjunction with the experiment of front, lhcb3 mutant phenotype to the ABA desensitization aspect growth of seedling causes owing to the LHCB3 gene expression amount reduces.

Embodiment 2, LHCB3 expression of gene are regulated by the ABAR-WRKY40 signal path

One, the normal expression of LHCB3 gene needs the participation of ABA

Whether is necessary in order to detect ABA to the expression of LHCB3, utilizes ABA defective mutant aba2 to experimentize.The detection of expression method of the mRNA of LHCB3: three days aba2 seedling moves on on the substratum that does not contain or contain (1-60 μ M) ABA, and quantitative fluorescent PCR is carried out in the back sampling of two week of continued growth,

Template: the cDNA of sample; The primer of forward primer:5 '-ATGGCCGCCTCAACAATGG-3 ' reverse primer:5 '-CGGTAAGGTAGCTGGGTGAC-3 ' confidential reference items: β-Actin, confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 ';

Detecting the expression level of LHCB3, is contrast with wild-type Arabidopis thaliana (col).Every group of data all are three independently biology multiple mean values.

The result as shown in Figure 6A, as can be seen, among the ABA synthesis mutant aba2, (aba2-ABA) turned down in the expression of LHCB3, ABA can make the expression of the LHCB3 among the ABA synthesis mutant aba2 be restored (aba2+ABA) after handling, but occurs restraining effect when ABA concentration is higher than 40 μ M.

The detection method of LHCB3 protein expression: three days aba2 seedling moves on to and contains (0,1,3,5,10,20,40, and60 μ M) on the substratum of ABA, the back sampling of two week of continued growth, extract total protein, (specific antibody is available from Agrisera (Stockholm, Sweden to carry out Western blot detection; Website:www.agrisera.com; Product No.AS01002), the result is shown in Fig. 6 B, and Western blot band concentration is represented the albumen relative expression quantity.Numerical value below the band is represented the level relatively of protein expression.The LHCB protein content is 100 among the setting Col, and the LHCB protein content quantizes by comparison in the mutant.Actin is last sample contrast, tests and repeats to obtain similar result three times.

From as can be seen above-mentioned, the mRNA of LHCB3 and expressing quantity all are lower than wild-type in the aba2 mutant.The processing of ABA can recover the expression level of each LHCB member in the aba2 mutant, and (＞20or＞40 μ M handle LHCB mRNAs but the ABA of higher concentration handles;＞20 μ M handle to remove the proteic LHCB albumen of LHCB5:＞40 μ M) mRNA and the expression of protein level in mutant all begin to descend (Fig. 6 A, 6B).These experimental results show that LHCB3 is transcribing the participation that needs ABA with the normal expression of translation skill.

It should be noted that in the aba2 mutant, LHCB3 for the response of ABA protein level and mRNA level in full accord (Fig. 6 A, 6B).Yet in the aba2 mutant, the maximum concentration that stimulates LHCB to express is three times in the wild-type experimental system.

Two, the WRKY40 transcription factor combines with LHCB family member's promotor and suppresses its expression

Attempting a key that research directly acts on the ABAR downstream transcribes and suppresses son---and whether the WRKY40 transcription factor can directly combine with the promoter region of LHCB and regulate the expression of LHCB.

1, the PCR and the real-time fluorescence quantitative PCR of testing by the chromatin co-immunoprecipitation

Shown in Fig. 7 A-7D that concrete experiment is stated as follows,

Fig. 7 A be the structure of LHCB3 gene promoter: Wn (W1, W2 ...) represent the order of W-box from left to right and they position with respect to initiator codon (ATG).On behalf of CHIP, red line analyze the sequence fragment that detects in (Fig. 7 B).Arrow is represented sequence fragment used in the gel retardation assay, and same fragment is represented p1, p2 with two arrows of same color ... represent selected segmental number.

Fig. 7 B is that the promotor of WRKY40 and LHCB3 gene is done mutually:

Concrete grammar: with the N terminal specific antibody of WRKY40 (the N end of WRKY40 be the 21-131 position Nucleotide of genbank CP002684, the nucleotides sequence of WRKY40 is classified the sequence 5 of sequence table as, aminoacid sequence is the sequence 4 in the sequence table) carry out PCR electrophoresis detection result (the Saleh A that CHIP analyzes, Alvarez-Venegas R, Avramova Z (2008) An efficient chromatin immunoprecipitation (ChIP) protocol for studying histone modifications in Arabidopsis plants.Nat Protoc 3:1081-1025; Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, ZhangD-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935).

Experiment material be the wild-type Arabidopis thaliana two the week age seedling.

Active in order to detect WRKY40 with combining of LHCB promotor, with reference to (Mukhopadhyay A, Deplancke B, Walhout AJM, Tissenbaum HA (2008) .Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.Nat Protoc 3:698-709; Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935) method is that confidential reference items contrast carrying out real-time quantitative PCR detects with 3 ' the non-translational region sequence of Actin2.

Confidential reference items primer Actin2:

forward?primer：5’GGTAACATTGTGCTCAGTGGTGG?3’

reverse?primer：5’AACGACCTTAATCTTCATGCTGC?3’

The sequence of promoter fragment indicates in (Fig. 7 A).The result is shown in Fig. 7 B, and ' Input ' swimming lane: the wild-type arabidopsis thaliana genomic dna is a template, amplification PCR products; ' control ' swimming lane: the DNA that preimmune serum (deriving from antibody manufacturing company) obtains is a template, amplification PCR products; ' LHCB-p ' swimming lane: the DNA that WRKY40N terminal specific antibody precipitation obtains is a template, amplification PCR products.

pLHCB3：forward?primer：5’-GGCTACTCAGTAGCAAAGACGA-3’reverse?primer：5’-TTCTAGCGACCTCTCAAGCGG-3’

The fragment sequence that amplification obtains is a sequence 7.

As can be seen, WRKY40 combines with the promotor of LHCB3 gene.

Fig. 7 C is that the promotor of WRKY40 and LHCB3 gene is done mutually: the N terminal specific antibody with WRKY40 carries out the quantitative fluorescent PCR that CHIP analyzes;

The result is shown in 7C, and Actin promotor (Actin-p) (be with Actin2 3 ' non-translational region sequence be the product of confidential reference items contrast carrying out real-time quantitative PCR) is negative contrast.

As can be seen, the promotor of LHCB3 gene (LHCB3-p) is 22 with WRKY40 bonded combination rate.

Every group of data all are three independently biology multiple mean values.

Show that WRKY40 combines with the promotor of LHCB gene.

Fig. 7 D is the yeast one-hybrid experiment: yeast one-hybrid utilizes Clontech test kit (Matchmaker.One-Hybrid Library Construction ﹠amp; Screening Kit CATALOG No.630304) the AH109 bacterial strain that provides.

With wild-type Arabidopis thaliana plant complete genome DNA is template, carries out pcr amplification with following primer, obtains 672bp product (order-checking for the sequence 6 in the sequence table from 5 ' terminal 1-672 position Nucleotide):

LHCB3?promoter(672bp)：

forward?primer：5’-TCCCCCGGGCTAGCGACCTCTCAAGCGGAAC-3’

Reverse primer:5 '-CGACGCGTCCAAGGAATGTTGTTGGGGTAAG-3 ' cuts the 1137bp product with the SmaI/MluI enzyme, with the pHIS2 carrier (Clontech test kit (Matchmaker that cuts through same enzyme ^TMOne-Hybrid Library Construction ﹠amp; Screening Kit CATALOG No.630304) connects, obtain pHIS2-pLHCB3.

Utilize the yeast one-hybrid method of AH109 bacterial strain to carry out according to the explanation of handbook.With pHIS2 carrier that comprises target gene promoters and the prey vector (pGADT7-WRKY40 (Clontech test kit (Matchmaker that contains the WRKY40 opening code-reading frame ^TMOne-Hybrid Library Construction ﹠amp; Screening Kit CATALOG No.630304), common transformed yeast cell.

Transform empty carrier pGADT7 (Clontech test kit (Matchmaker simultaneously ^TMOne-Hybrid Library Construction ﹠amp; Screening Kit CATALOG No.630304) and pHIS2 (Clontech test kit (Matchmaker ^TMOne-Hybrid Library Construction ﹠amp; Screening Kit CATALOG No.630304) to yeast cell, as negative contrast.This tests triplicate, obtains same result.

Yeast cell after the conversion is grown on the SD-Trp-Leu substratum earlier and is confirmed that the carrier conversion enters cell, grows cell transformed then on the SD-Trp-Leu-His substratum.SD-Trp-Leu or SD-Trp-Leu-His substratum comprise 25mM 3-AT (SIGMA) (WRKY40-LHCB1-, LHCB2-or LHCB5-promoter do mutually) or 10mM (WRKY40-LHCB3 promotor or LHCB3-promotor are done mutually).The yeast flat board was 30 ℃ of growths 3 days.

The result is shown in 7D, and as seen from the figure, WRKY40 combines with the promotor of LHCB3 gene.

2, test in the body that WRKY40 and promotor are done mutually

This experimental technique is with reference to the paper (Shang Y, Yan L, the LiuZQ that have delivered, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935.

The cDNA of WRKY40 utilizes following primer to obtain (cDNA that template is wild-type Col) by pcr amplification:

5 '-CGCGGATCCATGGATCAGTACTCAT-3 ' and reverseprimer5 '-CCGCTCGAGCTATTTCTCGGTATGA-3 ', PCR product (sequence 5 in the sequence table) utilizes the BamHI/XhoI site to be connected PBI121 carrier (Shang Y, Yan L, LiuZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) CaMV 35S promoter downstream, obtain PBI121-WRKY40.

The LHCB3 promotor utilizes following primer amplification to obtain:

LHCB3：forward?primer：5’-GGGGTACCGAGAGCACTAAAGGCAAAGGACG-3’

reverse?primer：5’-TCCCCCGGGGCCAAGGAATGTTGTTGGGGTAA-3’(1073bp)。

The fragment sequence that amplification obtains is a sequence 8.

The cDNA sequence of LUC utilizes following primer with segmental pGL3-Basic carrier (the Shang Y of the cDNA that comprises LUC, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, SunHL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.PlantCell 22:1909-1935, the public can obtain from Tsing-Hua University.) obtain for template amplification: forward primer5 '-TCCCCCGGGATGGAAGACGCCAAAAAC-3

Reverseprimer 5 '-CGGGATCCTTACACGGCGATCTTTCCGC-3 ' obtains the cDNA of LUC.

The LHCB3 promotor utilizes the KpnI/SmaI site to connect pCAMBIA1300 carrier (Shang Y, Yan L, LiuZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, YuYT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell22, the public can obtain from Tsing-Hua University.), obtain pCAMBIA1300-LHCB3.

The cDNA sequence of LUC is connected the downstream of the LHCB3 promotor of pCAMBIA1300-LHCB3 by the SmaI/BamHI site, obtains pLHCB-LUC (the single commentaries on classics), change the GV3101 bacterial strain over to, obtain GV3101/pLHCB-LUC-LHCB3 (the single commentaries on classics).

Change PBI121-WRKY40 over to the GV3101 bacterial strain, obtain GV3101/PBI121-WRKY40.

GV3101/pLHCB-LUC-LHCB3 (the single commentaries on classics) is injected into tobacco N.benthamiana (the Shang Y in seven weeks of young tender while full extension with needleless injector, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, Wu FQ, Wang XF, DuSY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22, the public can obtain from Tsing-Hua University.) blade, obtain changeing the pLHCB-luc tobacco.

GV3101/pLHCB-LUC-LHCB3 (the single commentaries on classics) and GV3101/PBI121-WRKY40 mixed bacteria liquid together are injected into the N.benthamiana blade in seven weeks of young tender while full extension with needleless injector; Obtain changeing the pLHCB-luc+WRKY40 tobacco.

The experimental group carrier is identical with control group carrier (GV3101/pLHCB-LUC-LHCB3) total amount.

After the injection,, be placed on continued growth 60h under room temperature (25 degree) the condition 16h/ days illumination then with tobacco dark processing 12h.

LUC is active, and (UK) vision facilities is observed for AndoriXon, Andor by CCD.With LUC empty carrier and control group carrier GV3101/pLHCB-LUC-LHCB6 transformation of tobacco is contrast, and this experiment is independent to be repeated more than five times, and experimental result is identical.

Immunoblotting detects the expression of protein level, Actin is that last sample contrast Arabidopis thaliana total protein extracting method carries out with reference to the scheme of LHCB antibody supplier Agrisera suggestion, SDS-PAGE and immunoblotting detect with reference to Shang Y, Yan L, Liu ZQ, CaoZ, Mei C, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKYtranscription repressors to relieve ABA-responsive genes of inhibition.Plant Cell22:1909-1935.

The above results is shown in Fig. 8 C, and the numerical value in the square frame is represented proteic relative expression's level.Setting the middle LHCB protein content of Col (wild-type Arabidopis thaliana) is standard, and the LHCB protein content quantizes by comparison in the mutant.Immunoblotting assay carries out three independent biology to be repeated, and obtains similar result.Every group of data of RT-PCR are three independent biology multiple mean values.

As can be seen, in wrky40 single mutant and wrky40wrky18 double-mutant, the expression amount of LHCB3 significantly improves, and the LHCB3 expressing quantity significantly improves in the wrky40 single mutant.Yet in the wrky40wrky18 double-mutant, the LHCB3 expression amount does not have noticeable change.

In sum, above experimental result shows that WRKY40 and WRKY18 suppress LHCB genetic expression jointly.

In order to study the function that hormesis that ABA expresses LHCB depends on ABAR and WRKY40 to a certain extent, carry out following experiment:

With cch, wrky40, three days seedling of col growth moves to respectively and contains 0,1,3, the back sampling of two week of continued growth detects (real-time quantitative PCR detection wild-type Arabidopis thaliana (Col) on the substratum of 5 μ M ABA, mutant wrky40, the mRNA horizontal expression of the LHCB3 of double-mutant wrky40/18, LHCB3:forward primer:5 '-AATGATCTTTGGTATGGACCTGAC-3 ' reverse primer:5 '-CCACACGGACCCACTTTTG-3 ' confidential reference items: β-Actin, the primer of confidential reference items is forwardprimer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer5 '-AACGACCTTAATCTTCATGCTGC-3 ' (concrete detection method and important primer please be provided).Actin is last sample contrast.Experiment triplicate, unanimity as a result.

As a result shown in Fig. 8 D and the 8E,

Wherein, shown in the 8D left hand view, cch compares with the wild-type Arabidopis thaliana, and the LHCB3 of cch (' * ' marks) is in the slight rising of having only of protein level.

Shown in Fig. 8 D right part of flg, cch compares with wrky40, and the protein expression of LHCB3 is unaffected.

Concentration according to the immunoblotting band estimates expressing quantity, is standard reference (in the column diagram shown in the red arrow) not carry out expression amount in the wild-type that ABA handles.The result is shown in Fig. 8 E, and 1,3, the ABA of 5 μ M significantly is lower than in the wild-type in cch and wrky40 mutant the hormesis that LHCB3 expresses.Data are three independent biology multiple mean values.

Cch LHCB3 relative expression quantity under the ABA of 0,1,3,5 μ M handles is 40,50,50,60,

Wrky40 mutant LHCB3 relative expression quantity under the ABA of 0,1,3,5 μ M handles is 280,280,280,350,

Col LHCB3 relative expression quantity under the ABA of 0,1,3,5 μ M handles is 100,300,280,135,

Three, the mutant of ABAR and WRKY40 influences the regulation and control that ABA expresses LHCB

With abar-3 mutant (the allelic simple point mutation body of ABAR, Shang Y, Yan L, LiuZQ, Cao Z, MeiC, Xin Q, Wu FQ, Wang XF, Du SY, Jiang T, Zhang XF, Zhao R, Sun HL, Liu R, Yu YT, Zhang D-P (2010) The Mg-chelatase H subunit antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.Plant Cell 22:1909-1935, the public can obtain from Tsing-Hua University.) take a sample and detect the expression of (detection method is the same) LHCB gene mRNA and protein level by quantitative fluorescent PCR and immunoblotting, immunoblotting is last sample contrast with Actin.Numerical value under the protein band in the square frame is represented the proteic relative expression quantity of LHCB.With the Actin band is standard.Immunoblotting three secondary pollutants are learned and are repeated, as a result unanimity.Each numerical value all is three independent biology multiple mean values.

The result as shown in Figure 9, the LHCB3 gene mRNA relative expression quantity of col is 1.0;

The LHCB3 gene mRNA relative expression quantity of abar-3 mutant is 0.8;

In conjunction with above-mentioned LHCB family member's protein level at lower concentration ABA (1,3 or 5 μ M) handling down, expression amount improves, but LHCB3 in cch and wrky40 mutant, the result that the ability of LHCB4 and LHCB3 response ABA descends significantly shows: ABA promotes the expression of LHCB by the signal path of ABAR-WRKY40 mediation.

Four, the double-mutant of ABAR and LHCB gene has the phenotype to the ABA desensitization, and expressing the LHCB3 gene can partly recover its desensitization phenotype to ABA excessively in the cch mutant

With double-mutant lhcb1 lhcb3, lhcb1 lhcb6, lhcb1 cch, lhcb3 cch, lhcb4 cch, lhcb6 cch (double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb3 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation; Double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the lhcb6 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation; Double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the cch or not blooming, on the lhcb1 pistil stigma, rub, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation) and wild-type Col extraction RNA and protein, by the expression of quantitative fluorescent PCR and immunoblotting detection (detection method is the same) LHCB gene mRNA and protein level, immunoblotting is last sample contrast with Actin.Numerical value under the protein band in the square frame is represented the proteic relative expression quantity of LHCB.The result is as shown in figure 10: Figure 10 A is double-mutant lhcb1 lhcb3, Different L HCB expression of gene among the lhcb1 lhcb6, and Figure 10 B is a Different L HCB expression of gene among double-mutant lhcb1 cch, lhcb3 cch, lhcb4 cch, the lhcb6 cch.

Fluorescence quantitative PCR detection (Figure 10 A, the column diagram among the 10B) is passed through in the expression of mRNA level,

Protein level is expressed by immunoblotting and is detected, and Actin is last sample contrast.The proteic relative expression quantity of numeric representation LHCB among Figure 10 A below the protein band is that standard compares quantification with the wild-type.(10A detects in 10B) for be expressed in cch mutant (Figure 10 B) and all double-mutants of six LHCB (LHCB1-LHCB6).Three independent biology of immunoblotting assay repeat, and the result is similar.Each numerical value of quantitative fluorescent PCR all is three independent biology multiple mean values.

In order to study ABAR and the LHCBs gene concerns in genetic upstream and downstream, with cch-lhcbs double-mutant lhcb1cch, lhcb3 cch, lhcb4 cch and lhcb6 cch are the phenotype that object is studied its response ABA.In the cch mutant, LHCB gene expression amount significantly descend (Figure 10 B).Yet double-mutant and cch single mutant that the mutant (lhcb1, lhcb4, or lhcb6) of single LHCB downward modulation obtains after hybridizing with cch are compared, and LHCB family gene content is significantly downward modulation not, has promoted other LHCB family members' expression on the contrary.LHCB3 knocks out in the double-mutant that obtains after mutant and the hybridization of cch mutant, and the LHCB3 gene is knocked out, but LHCB2, LHCB4, the mRNA of LHCB6 gene is raised, and the LHCB4 protein level is expressed and is raised (Figure 10 B).These data declarations have the complicated feedback regulation mechanism of a cover to keep the stability of LHCB gene family integral body in double-mutant.

Five, turn down or knock out stable state and the gene of a series of participation ABA signal paths and the expression of gene of response ABA of LHCB effect gene active oxygen

1, influences the stable state of active oxygen

As everyone knows, active oxygen (ROS) participates in ABA signal transduction process (Pei et al, 2000; Murata et al, 2001; Mustilli et al, 2002; Kwak et al, 2006; Miao et al, 2006; Zhang et al, 2009), and ROS mainly results from (Kwak et al, 2006 in the chloroplast(id) in vegetable cell; Nott et al, 2006; Galvez-Valdivieso and Mullineaux, 2010).In the chloroplast(id), the generation of ROS is main relevant with photoabsorption and electron transport, and LHCB also in these two processes, play an important role (Jansson, 1994,1999; Galvez-Valdivieso and Mullineaux, 2010).

Therefore, detect the content of ROS in the LHCB3 mutant.

Blade is taken from the soil wild-type Arabidopis thaliana plant in three weeks of growth, and at 50mMKCl, 10mMMes-Tris (pH 6.15) also contains in the damping fluid of ABA of different concns, places 200umol m ^-2Sec ^-1Pre-treatment 1h under the illumination.Then with add 0.1mg/mL NBT (being dissolved in the 100mM potassium phosphate solution) in the damping fluid and vacuumize infiltration make leaf dyeing (Amresco, Solon, OH, USA).Sample moves into 80% ethanol then at the dark 2h. that places of room temperature, and boiling water bath is handled 10min, to remove chlorophyllous interference.

The detection of ROS content utilizes H2DCF-DA (SIGMA among the guard cell, D6883) contaminate the blade table leather strap that peels off, method is with reference to Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C, Song CP (2006) An Arabidopsis glutathione peroxidase functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses.Plant Cell 18:2749-2766.Pre-treatment epidermis bar in containing 0 (equal volume ethanol in contrast) or 5 μ M (±)-ABAMES-Tris damping fluid (with above) promotes stomatal opening.Then the epidermis bar was immersed in the damping fluid that 50mMTris-KCl (pH 7.2) comprises 50mM H2DCF-DA dark processing 20 minutes.Utilize MES-Tris damping fluid rinsing sample, remove unnecessary dyestuff.Utilize fluorescence microscopy (Olympus, BX51, Japan) fluorescence in the detection epidermis bar.ROS contaminates fluorescence and clicks the parameter observation: exciting light, 488nm; Transmitted light, 525nm.

Experimental result as shown in figure 11, Figure 11 A is that NBT dyeing detects the generation that different concns ABA (wild-type col 0-50 μ M, 0-10 μ M in the LHCB3 mutant) handles ROS behind wild-type and the lhcbs mutant blade.The experiment triplicate obtains similar result.

Figure 11 B is the quantification that ROS produces among Figure 11 A.Estimate that by scanning dyeing brightness the dyeing concentration of ROS in the wild-type is decided to be 100%, and other quantize by comparison.

The result is 180%, 45%, 48% for the ROS amount of LHCB3 under 0,5,10,50 μ MABA handle;

The ROS amount of col under 0,5,10,50 μ MABA handle is 100%, 150%, 100%, 50%;

Figure 11 C is the epidermis bar that 5 μ M ABA handle wild-type and different lhcb mutant, passes through H ₂The ROS production among the guard cell is observed in DCF-DA dyeing.Test and repeat to obtain similar result three times.

Figure 11 D is the expression that real-time quantitative PCR detects a series of ABA responsive genes in the lhcbs mutant.Every group of data all are three independent biology multiple mean values.

From as can be seen above-mentioned, the content of ROS is higher than the wild-type plant in the lhcb mutant, and this all has embodiment (Figure 11 A to C) in blade and guard cell.Find to handle the generation that blade can promote ROS with the ABA of low concentration (1 to 5 μ M).This and former result of study consistent (Pei et al, 2000; Murata et al, 2001; Mustilli et al, 2002; Kwak et al, 2006; Miao et al, 2006; Zhang et al, 2009); And handle the content (50 μ M) (Figure 11 A) that just no longer includes accelerating effect even can reduce ROS with the ABA of higher concentration (10 μ M).Yet in the lhcb mutant, handle plant with low concentration ABA, and though be complete blade (1 to 10 μ M ABA, Figure 11 A and Figure 11 B) still in the guard cell ROS content of (5 μ M ABA handle, Figure 11 C) all descend.These experimental results show that turning down or knock out the LHCB gene all will influence the stable state of ROS in the vegetable cell and the ROS response to ABA.

2, turn down or knock out the gene of a series of participation of LHCB effect gene ABA signal path and the expression of gene of response ABA

Adopt fluorescent quantitation to detect the following expression that participates in ABA signal path gene and ABA responsive genes among the lhcb mutant 1-6: ABF1, ABF2/AREB1, ABF3, ABF4/AREB2 (Choi et al, 2000; Uno et al, 2000), ABI1 (Leunget al, 1994; Meyer et al, 1994; Gosti et al, 1999), ABI2 (Leung et al, 1997), ABI3 (Giraudat et al, 1992), ABI4 (Finkelstein et al, 1998), ABI5 (Finkelstein and Lynch, 2000), ERD10 (Kiyosue et al, 1994), KIN1 and KIN2 (Kurkela and Borg-Franck, 1992), MYB2 and MYC2 (Abe et al, 2003), OST1 (Mustilli et al, 2002), RAB18 (Lang and Palva, 1992), RD29A (Yamaguchi-Shinozaki and Shinozaki, 1994).

Primer is as follows:

ABF1(At1g49720)：

forward?primer：5’-TCAACAACTTAGGCGGCGATAC-3’

reverse?primer：5’-GCAACCGAAGATGTAGTAGTCA-3’

ABF2(At1g45249)：

forward?primer：5’-TTGGGGAATGAGCCACCAGGAG-3’

reverse?primer：5’-GACCCAAAATCTTTCCCTACAC-3’

ABF3(At4g34000)：

forward?primer：5’-CTTTGTTGATGGTGTGAGTGAG-3’

reverse?primer：5’-GTGTTTCCACTATTACCATTGC-3’

ABF4(At3g19290)：

forward?primer：5’-AACAACTTAGGAGGTGGTGGTC-3’

reverse?primer：5’-CTTCAGGAGTTCATCCATGTTC-3’

ABI1(At4g26080)：

forward?primer：5’-AGAGTGTGCCTTTGTATGGTTTTA-3’

reverse?primer：5’-CATCCTCTCTCTACAATAGTTCGCT-3’

ABI2(At5g57050)：

forward?primer：5’-GATGGAAGATTCTGTCTCAACGATT-3’

reverse?primer：5’-GTTTCTCCTTCACTATCTCCTCCG-3’

ABI3(At3g24650)：

forward?primer：5’-TCCATTAGACAGCAGTCAAGGTTT-3’

reverse?primer：5’-GGTGTCAAAGAACTCGTTGCTATC-3’

ABI4(At2g40220)：

forward?primer：5’-GGGCAGGAACAAGGAGGAAGTG-3’

reverse?primer：5’-ACGGCGGTGGATGAGTTATTGAT-3’

ABI5(At2g36270)：

forward?primer：5’-CAATAAGAGAGGGATAGCGAACGAG-3’

reverse?primer：5’-CGTCCATTGCTGTCTCCTCCA-3’

ERD10(At1g20450)：

forward?primer：5’-TCTCTGAACCAGAGTCGTTT-3’

reverse?primer：5’-CTTCTTCTCACCGTCTTCAC-3’

KIN1(At5g15960)：

forward?primer：5’-ACCAACAAGAATGCCTTCCA-3’

reverse?primer：5’-CCGCATCCGATACACTCTTT-3’

KIN2(At5g15970)：

forward?primer：5’-ACCAACAAGAATGCCTTCCA-3’

reverse?primer ：5’-ACTGCCGCATCCGATATACT-3’

MYB2(At2g47190)：

forward?primer：5’-TGCTCGTTGGAACCACATCG-3’

reverse?primer：5’-ACCACCTATTGCCCCAAAGAGA-3’

MYC2(At1g32640)：

forward?primer：5’-TCATACGACGGTTGCCAGAA-3’

reverse?primer：5’-AGCAACGTTTACAAGCTTTGATTG-3’

OST1(At4g33950)：

forward?primer：5’-TGGAGTTGCGAGATTGATGAGAG-3’

reverse?primer：5’-CCTGTGGTTGATTATCTCCCTTTTT-3’

RAB18(At5g66400)

forward?primer：5’-CAGCAGCAGTATGACGAGTA-3’

reverse?primer：5’-CAGTTCCAAAGCCTTCAGTC-3’

RD29A(At5g52310)：

forward?primer：5’-ATCACTTGGCTCCACTGTTGTTC-3’

reverse?primer：5’-ACAAAACACACATAAACATCCAAAGT-3’

The result shown in Figure 11 D, ten important function of gene: ABI4 wherein, ABI5, ERD10, KIN1, KIN2, MYB2, MYC2, OST1, RAB18 and the RD29A expression in the lhcb mutant is significantly suppressed.All these repressed genes all are just to respond the gene of ABA or the positive regulon of coding ABA signal path.Three coding important transcription factor---genes of the positive regulon of ABA signal path, ABF1, ABF4 and ABI3, at lhcb2, lhcb4 is also significantly suppressed in the lhcb5 mutant.ABF1 and the ABF4 expression in the LHCB3 mutant does not have considerable change, and being expressed in of ABI3 do not have noticeable change (Figure 11 D) yet in lhcb1 and the lhcb3 mutant.Yet these two of ABI1 and ABI2 directly act on ABA acceptor PYR/PYL/RCAR (Fujii et al, 2009) downstream, the gene of the negative regulon of coding ABA signal path, and the expression amount in the lhcb mutant does not have noticeable change (Figure 11 D).On the contrary, gene expression amount in the lhcb mutant except that lhcb5 and LHCB3 of the positive regulon of ABF2 and ABF3 these two codings ABA signal path raises, in lhcb5 and lhcb6 mutant, ABF2 and ABF3 gene expression amount do not have considerable change (Figure 11 D).These ABA signal transduction process Expression of Related Genes quantitative changeizations fundamentally illustrate the positive regulon of LHCB gene A BA signal, but this wherein has a potential complex mechanism.

Six, turn down or knock out the LHCB Gene Partial and suppress the phenotype of wrky40 mutant the ABA sensitivity

1, protein expression and sprouting speed

With wrky40lhcb1, wrky40lhcb3, wrly40lhcb6 mutant (wrky40lhcb1 double-mutant construction process: the petal that lhcb1 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky40 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation; Wrky40lhcb3 double-mutant construction process: the petal that lhcb3 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky40 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 can obtain homozygote for growth through the PCR evaluation; Wrky40lhcb6 double-mutant construction process: the petal that lhcb6 is not bloomed is removed the only surplus gynoecium of its stamen with tweezers, take off the stamen in the petal of blooming among the wrky40 or not blooming, rub peeling off on the remaining pistil stigma, make pollen fully contact column cap, this gynoecium is made marks, obtain the first familiar generation seed after the pod maturation, F1 is sowed once more for seed, F2 is for growth, can obtain homozygote through the PCR evaluation), wrky40 and wild-type Col extract RNA and protein, by the expression of quantitative fluorescent PCR and immunoblotting detection (detection method is the same) LHCB6 gene mRNA and protein level, immunoblotting is last sample contrast with Actin.72 hours sprouting speed after numerical value under the protein band in the square frame is represented the proteic relative expression quantity of LHCB and added up vernalization.With col is contrast.

The result is shown in Figure 12 A, and the sprouting speed of wrky40lhcb1 on 0,0.5,1,3 μ MABA substratum is 100%, 80%, 72%, 45%;

The sprouting speed of wrky40lhcb3 on 0,0.5,1,3 μ MABA substratum is 100%, 85%, 65%, 50%;

The sprouting speed of wrky40lhcb6 mutant on 0,0.5,1,3 μ MABA substratum is 100%, 80%, 62%, 47%;

The sprouting speed of wrky40 on 0,0.5,1,3 μ MABA substratum is 100%, 75%, 50%, 25%;

The sprouting speed of col on 0,0.5,1,3 μ MABA substratum is 100%, 100%, 90%, 59%;

As can be seen, double-mutant can significantly suppress the wrky40 mutant and suppress seed germination at ABA.

2, LHCB1, LHCB3, LHCB3 expression amount reduce make the wrky40 mutant after sprouting aspect the growth susceptibility to ABA weaken

Wrky40lhcb1, wrky40lhcb3, wrky40lhcb6 mutant, wrky40 seed are directly sowed in the result of growth after 9 days on the substratum that does not contain or contain (0.6 μ M) ABA.

The result is shown in Figure 12 B, and following column diagram showed in growth on the substratum that contains 0.6 μ M ABA after 9 days, wild-type and mutant main root extended length;

The main root extended length of wrky40lhcb1 is 0.58cm;

The main root extended length of wrky40lhcb3 is 0.58cm;

The main root extended length of wrky40lhcb6 mutant is 0.58cm;

The main root extended length of wrky40 is 0.34cm;

The main root extended length of col is 1.00cm;

3, ABA induce stomatal closure (on) and ABA suppress pore open aspect, LHCB1, LHCB3, the LHCB6 expression amount reduces does not influence the response of wrky40 mutant to ABA

Wrky40lhcb1, wrky40lhcb3, wrky40lhcb6 mutant, wrky40 seed are directly sowed in the result of growth after 9 days on the substratum that contains (0.6 μ M) ABA.

The result shown in Figure 12 C,

Wrky40lhcb1 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 6.0 μ m, 5.9 μ m, 2.5 μ m, 0.9 μ m;

Wrky40lhcb3 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 5.7 μ m, 5.9 μ m, 2.0 μ m, 1.0 μ m;

Wrky40lhcb6 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 6.0 μ m, 5.9 μ m, 2.5 μ m, 1.0 μ m;

Wrky40 handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 5.9 μ m, 5.9 μ m, 2.7 μ m, 0.8 μ m;

Col handles 0h, 0 μ M ABA processing 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h at 0 μ M ABA and induces the stomatal aperture of stomatal closure to be respectively 6.0 μ m, 6.0 μ m, 2.3 μ m, 1.0 μ m;

Wrky40lhcb1 handles 0h, 0 μ M ABA at 0 μ M ABA and handles open 0.8 μ m, 6.0 μ m, 3.0 μ m, the 1.0 μ m of 2.5h, 20 μ M ABA processing 2.5h, 30 μ MABA processing 2.5h inhibition pore;

Wrky40lhcb3 handles 0h, 0 μ M ABA at 0 μ M ABA and handles inhibition pore open 0.8 μ m, 5.8 μ m, 3.0 μ m, the 1.2 μ m that 2.5h, 20 μ M ABA handle 2.5h, 30 μ MABA processing 2.5h;

Wrky40lhcb6 handles 0h, 0 μ M ABA at 0 μ M ABA and handles inhibition pore open 0.8 μ m, 5.6 μ m, 3.0 μ m, the 1.0 μ m that 2.5h, 20 μ M ABA handle 2.5h, 30 μ MABA processing 2.5h;

Wrky40 handles 0h, 0 μ M ABA at 0 μ M ABA and handles inhibition pore open 0.6 μ m, 5.8 μ m, 2.8 μ m, the 1.2 μ m that 2.5h, 20 μ M ABA handle 2.5h, 30 μ MABA processing 2.5h;

Col handles 0h, 0 μ M ABA at 0 μ M ABA and handles inhibition pore open 0.8 μ m, 5.7 μ m, 2.9 μ m, the 1.0 μ m that 2.5h, 20 μ M ABA handle 2.5h, 30 μ MABA processing 2.5h;

Every group of data of 1-3 are three independent biology multiple mean values.

Former experimental result proof wrky40 mutant suppresses seed germination at ABA, suppress to show aspect the growth of seedling phenotype to the ABA sensitivity, do not show the phenotype that responds ABA but suppress pore at ABA inductive stomatal closure and ABA aspect open.Lhcb1, lhcb3, lhcb6 mutant are found with wrky40 mutant hybridization respectively, double-mutant can significantly suppress the wrky40 mutant ABA suppress aspect seed germination and the growth of seedling for the ABA sensitivity phenotype (Figure 12 A, 12B); But suppress the phenotype of pore aspect open for the wrky40 mutant at response ABA inductive stomatal closure and ABA and do not change (Figure 12 C).This may be because the ABA signal path that WRKY40 participates in is having the complicated mechanism of a cover to cause that the disappearance of WRKY40 function may cause the effect of ABA signal path complexity in this process aspect the adjusting stomatal movement.Yet these data provide enough genetics evidences to show that LHCB acts on the downstream of WRKY40 transcription factor, and to be that WRKY40 transcribes the direct target gene result who suppresses son consistent with the LHCB gene.

Seven, the molecule of mutant lhcb1-6 and biochemical identification

The T-DNA of Figure 13 (A-F) LHCB1-6 inserts synoptic diagram .A, lhcb1-1 (salk-134810); B, lhcb2 (salk-005614); C, lhcb3 (salk-036200); D, lhcb4 (salk-032779); E, lhcb5 (salk-139667); F, lhcb6 (salk-074622) .LP and RP identify left end primer and right-hand member primer on the genome that lhcbs uses; LBa1, T-DNA sequence left end primer; RBa1, T-DNA sequence right-hand member primer; First copy and last copy (the copy differential concatenation is inserted more than) that on behalf of the same site of insertion, T-DNA1 and T-DNAn insert respectively.

Figure 13 (A) is in LHCB1, and the T-DNA sequence of single copy is inserted into the promoter district of LHCB1 gene, concrete on position atg start codon ATG upstream-592nt and-523nt between, insert and cause 70bp to lack;

Figure 13 (B) is in LHCB2, and the T-DNA sequence is inserted into the promoter region of LHCB2 gene, concrete on position atg start codon ATG upstream-102nt and-126nt between, insert the disappearance cause 24bp;

Among Figure 13 (C) LHCB3, the T-DNA sequence is inserted into first exon district of LHCB3 gene, and concrete on position inserts the disappearance that causes 6bp between atg start codon ATG downstream 120nt and 125nt;

Among Figure 13 (D) LHCB4, the T-DNA sequence is inserted into the promoter district of LHCB4 gene in the mode of differential concatenation, concrete on position atg start codon ATG upstream-1263nt and-1247nt between, insert the disappearance that causes 17bp;

Among Figure 13 (E) LHCB5, the T-DNA sequence is inserted into the promoter district of LHCB5 gene, concrete on position atg start codon ATG upstream-483nt and-477nt between, insert the disappearance that causes 7bp;

Among Figure 13 (F) LHCB6, the T-DNA sequence is inserted into the promoter district of LHCB6 gene, concrete on position atg start codon ATG upstream-391nt and-346nt between, insert the disappearance that causes 46bp.

LHCB's transcribes and translation skill in Figure 13 (G) RT-PCR and western blot detection mutant lhcb1～6.

It is last sample contrast that immunoblotting detects with Actin.The column diagram of real-time quantitative PCR is made as standard with the expression of corresponding gene in the wild-type, and the expression amount in the mutant is a relative value, lhcb1-1 wherein, and lhcb2, hcb4, lhcb5, lhcb6 is turned down in various degree, and lhcb3 is the gene knockout mutant.Western blot detects, and the numerical value in the square frame is represented the level relatively of protein expression.The LHCB protein content is 100 among the setting Col, and the LHCB protein content quantizes by comparison in the mutant.This tests triplicate, unanimity as a result.

(lhcb1～lhcb6) middle chlorophyll a/b content significantly is not affected Figure 13 (H) mutant.Left figure: chlorophyll a, chlorophyll b and total chlorophyll content in the different mutants.Each numerical value all is three independent biology multiple mean values.Right figure: the growth of seedling state of different mutants does not have the phenotype of chlorophyll disappearance.

Eight, endogenous aba content and dry matter content are measured in the different lhcb mutant

Analysis of material is the seedling (wild-type Arabidopis thaliana col and mutant lhcb2) in two weeks of growth

(A) ABA level.Test kit is by the ABA content (Sigma test kit, PlantGrowthRegulator Immmunoassay DETECTION Kit) in the ELISA mensuration lotus throne blade.

(B) estimate dry matter content by dry weight/fresh weight.

The result shows that ABA and the dry matter content in mutant and the wild-type do not have significant difference as shown in figure 14.

Nine, wrky40 and wrky40wrky18 mutant do not have the gun phenotype

A, with wild-type Col, cch, wrky40 single mutant, wrky40wrky18 double-mutant seed are directly broadcast and are not being contained or containing 5 μ MNF (NF:Norflurazon, it is a kind of weedicide, after it is added into substratum, the plastid of seedling is grown by havoc, and plastid sends the reverse signal of plastid-examine to nucleus; And the mutant that this process produces is not influenced by NF promptly, and the phenotype that cell nuclear energy continues the coding plastogene be and examines phenotype---the GUN phenotype of uncoupling) substratum on, vernalization was put into 100 μ molm after three days ^-2S- ¹Under the illumination, carry out continuous illumination in 24 hours, the fluorescence quantitative PCR detection of taking a sample after 6 days.The experiment triplicate obtains same result.

Primer is LHCB3: primer is LHCB3:forward primer:5 '-AATGATCTTTGGTATGGACCTGAC-3 '

reverse?primer：5’-CCACACGGACCCACTTTTG-3’

With β-Actin is that the primer of confidential reference items, confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer 5 '-AACGACCTTAATCTTCATGCTGC-3 ', the result all detects the expression less than LHCBsmRNA in wrky40 single mutant and wrkywrky18 double-mutant shown in Figure 15 A.

B, with wild-type Col, cch, wrky40 single mutant seed is directly broadcast on the substratum that does not contain or contain 5 μ MNF, vernalization was put into 100 μ molm after three days ^-2S- ¹Under the illumination, carry out continuous illumination in 24 hours, the sampling immunoblotting detects after 6 days.The experiment triplicate obtains same result.

The result shown in Figure 15 B, with the same at wild-type, wrky40 and wrkywrky18 mutant, after NF handles cch, six expression of gene of LHCBs all detect less than, shown the complicacy of GUN-type chloroplast(id) reverse signal.All these results show wrky40 and wrky40wrky18 mutant right and wrong gun mutant.

From as can be seen above-mentioned, LHCBs albumen response physiological level concentration ABA and a mode chart increasing are as shown in figure 16, the WRKY40 transcription factor suppresses the expression of LHCB, ABA promotes that WRKY40 enters tenuigenin from nucleus, promote ABAR and WRKY40 to do mutually, the expression releasing by downward modulation WRKY40 is to the restraining effect of LHCBs (LHCB1/2/3/4/5/6) gene.In the tenuigenin synthetic LHCB protein transport to chloroplast(id) keeping the proteic stable state of LHCB, the challenge that plant is conformed, the proteic stable state of LHCB is essential to the foundation of ROS stable state.

Ten, the expression of LHCB3 in different tissues

Extract the RNA of the different tissues of wild-type Arabidopis thaliana respectively, reverse transcription obtains cDNA, with forward primer:5 '-AATGATCTTTGGTATGGACCTGAC-3 ' reverse primer:5 '-CCACACGGACCCACTTTTG-3 ' is primer, confidential reference items: β-Actin, the primer of confidential reference items is forward primer:5 '-GGTAACATTGTGCTCAGTGGTGG-3 ' reverse primer5 '-AACGACCTTAATCTTCATGCTGC-3 ', fluorescence quantitative PCR detection, result such as Figure 17, LHCB2 is at the root of wild-type Arabidopis thaliana, stem, leaf, flower, mRNA relative expression quantity in angle fruit and the seed is respectively 0.05,0.40,1.80,0.25,0.20,0,00.

Claims

1. the method for a controlling plant proterties is the expression that improves LHCB3 protein coding gene in the plant that sets out, and obtains having following 1) or 2) the purpose plant of feature:

1) resistance of reverse is higher than the described plant that sets out;

2) delayed growth is in the described plant that sets out.

2. method according to claim 1 is characterized in that:

Described raising is set out, and the expression of LHCB3 protein coding gene is to carry out under hormone is coerced in the plant;

Described hormone is specially ABA;

3. method according to claim 1 and 2 is characterized in that:

Described resistance of reverse is drought-resistant property;

4. according to arbitrary described method among the claim 1-3, it is characterized in that:

Described raising is set out, and the expression of LHCB3 protein coding gene realizes by import described LHCB3 encoding gene in the plant that sets out in the plant.

5. according to arbitrary described method among the claim 1-4, it is characterized in that:

Describedly become the concentration that the length of time, ABA coerced to be lower than 200 μ M, describedly become the concentration that the length of time, ABA coerced to be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M plant plant.

6. according to arbitrary described method among the claim 1-5, it is characterized in that:

Described root growth embodies by main root length.

7. according to arbitrary described method among the claim 1-6, it is characterized in that:

The expression of described raising LHCB3 protein coding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize.

8. according to arbitrary described method among the claim 1-7, it is characterized in that:

Described activation ABAR-WRKY40 signal path is the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB3 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB3, the LHCB3 protein coding gene is expressed;

9. the method for a controlling plant proterties is the expression that reduces LHCB3 protein coding gene in the purpose plant, obtains having following 1) or 2) plant of feature:

1) resistance of reverse is lower than described purpose plant;

2) growth is faster than described purpose plant.

10. method according to claim 9 is characterized in that:

The growth of described plant is following A or B faster than the described plant that sets out:

B) growth of the root of described plant is early than described purpose plant;

Described hormone is specially ABA;

Described resistance of reverse is drought-resistant property;

Describedly become the concentration that the length of time, ABA coerced to be lower than 200 μ M, describedly become the concentration that the length of time, ABA coerced to be specially 20 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, 300 μ M plant plant;

Described root growth specifically embodies by main root length;

The expression of described reduction LHCB3 protein coding gene is to activate the ABAR-WRKY40 signal path by Exogenous ABA to realize;

Described activation ABAR-WRKY40 signal path is specially the ABA acceptor of the ABA activated plant of external source, make the ABA acceptor combine transcription factor WRKY40 with the LHCB3 promotor competition that is combined with transcription factor WRKY40, discharge the promotor of LHCB3, the LHCB3 protein coding gene is expressed;

11. a method that improves plant stress tolerance or delay plant-growth comprises the steps: with ABA plant to be coerced, and obtains having the plant of following proterties:

1) the purpose plant stress tolerance is higher than the plant that sets out;

2) delayed growth of purpose plant is in the plant that sets out;

12. method according to claim 11 is characterized in that: