CN102220298A - Ferulic acid esterase FaeI as well as coding gene and application thereof - Google Patents

Abstract

The invention discloses ferulic acid esterase FaeI as well as coding gene and application thereof. The protein is: (a) protein consisting of the amino acid sequences shown in sequence 1 in a sequence table, or (b) protein obtained by substituting and/or losing and/or adding one or multiple amino acid residues of the amino acid sequence of the sequence 1, having ferulic acid esterase activity and derived from the sequence 1. The ferulic acid esterase disclosed by the invention can obviously improve the released amount of reducing sugar in the enzymolysis process of byproducts of agriculture-forest crops such as pasturage, straw, wheat bran, corncob and the like as well as the released amount of phenolic acid such as ferulic acid, coumaric acid and the like, and has important application value in the industries of biotransformation, feed, pharmacy, papermaking, cosmetics and food. The ferulic acid esterase has important application values in the industries of animal feed, papermaking, food, bioenergy, cosmetics and pharmacy.

Description

Phenolic acid esterase FaeI and encoding gene thereof and application

Technical field

The present invention relates to phenolic acid esterase FaeI and encoding gene thereof and application.

Background technology

The plant cell wall composition is the maximum renewable resources of content on the earth.It mainly is made up of Mierocrystalline cellulose, hemicellulose, xylogen and pectin.Mierocrystalline cellulose is the plant cell wall major ingredients, and it is the polymkeric substance that is formed by β-1,4 key by glucosyl residue.Hemicellulose is the second abundant composition, and the structural difference of the xylan of different sources is very big, but they all contain a skeleton, promptly forms main chain by β-1,4 wood sugar, and the side substitution group includes pectinose, acetate, forulic acid, glucuronic acid etc.

Araboxylan is main hemicellulose, and the pectinose of side substitution group forms ester bond with forulic acid or coumaric acid (p-Coumaric Acid) again usually, and forulic acid or coumaric acid link to each other by ester bond with xylogen.Thereby the Mierocrystalline cellulose in the plant cell wall and hemicellulose and xylogen be cross-linked to form a reticulated structure, hindered cellulase and hemicellulase near substrate, makes microorganism be difficult to the degrading plant cell walls, caused the huge wasting of resources like this.The forulic acid of xylan side chain, this cancellated node just, thereby the forulic acid ester bond is considered to one of main limiting factor of cell wall degradation.

Phenolic acid esterase (EC 3.1.1.73, Ferulic acid esterases, FAE) claim feruloyl esterase or styracin esterase or Chlorogenic acid esterase again, it is a kind of Procaine esterase, belong to carbohydrate esterase family, it is different from other Procaine esterases and is characterised in that the ester bond that contains the phenolic acid structure is had hydrolytic activity efficiently.Phenolic acid esterase directly acts on the forulic acid ester bond, by hydrolytic action, Mierocrystalline cellulose and hemicellulose is peeled off out, and discharges the compound that small molecules forulic acid, coumaric acid etc. contain the phenolic acid structure.Phenolic acid esterase is found in many bacteriums and the fungi.

Phenolic acid esterase has industrial application value: after handling vegetable material with phenolic acid esterase, the continuous damage of Mierocrystalline cellulose and hemicellulose and xylogen, plant cell wall become loose, and the forulic acid etc. that also discharges pharmaceutical use simultaneously contains the compound of phenolic acid structure.In fodder industry, phenolic acid esterase can significantly improve the burst size of reducing sugar in enzymolysis process such as paper pulp, wheat bran, farm crop crop straw and herbage, and is easier of fowl poultry digestibility and utilization.In paper industry, in paper pulp, add phenolic acid esterase and can help to remove xylogen, to reduce the consumption of harmful chemical substance in the pulping process, save cost, reduce environmental pollution and help the carrying out of subsequent handling.

Summary of the invention

The purpose of this invention is to provide phenolic acid esterase FaeI and encoding gene thereof and application.

Protein provided by the invention (FaeI albumen) is separated CELLULOLYTIC BACTERIUM (former Clostriciumruminocolum by name renamed Cellulosilyticum ruminicola afterwards as) available from occupying cud, is following (a) or (b):

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have a phenolic acid esterase active by sequence 1 deutero-protein.

For make (a) (b) or the FaeI albumen (c) be convenient to purifying, label as shown in table 1 on proteinic N-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table or C-terminal connect.

The sequence of table 1 label

Label	The residue number	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag?II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

But above-mentioned FaeI albumen synthetic also can synthesize its encoding gene earlier, carries out the biology expression again and obtains.The proteic encoding gene of above-mentioned FaeI can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The above-mentioned proteic gene (faeI gene) of encoding also belongs to protection scope of the present invention.

Described gene can be following 1) or 2) or 3) dna molecular:

1) dna molecular shown in the sequence 2 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization and the coding that limit have the active proteic dna molecular of phenolic acid esterase;

3) with 1) dna sequence dna that limits has 90% above homology and coding has the active proteic dna molecular of phenolic acid esterase.

Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

The recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain above arbitrary described gene all belong to protection scope of the present invention.

Described recombinant expression vector specifically can be the recombinant plasmid that the multiple clone site with described gene insertion vector pET15b obtains.

Described reorganization bacterium specifically can be described recombinant expression vector is imported the reorganization bacterium that intestinal bacteria obtain.Described intestinal bacteria are preferably e. coli bl21 (DE3).

The cell that sets out of described transgenic cell line can be prokaryotic cell prokaryocyte, yeast cell, fungal cell or vegetable cell.

Increase described full length gene or its any segmental primer to also belonging to protection scope of the present invention.

The present invention also protects a kind of method for preparing phenolic acid, is following (1) or (2):

(1) with described proteolytic degradation phenolic acid ester, obtains phenolic acid;

(2) with described proteolytic degradation corn cob, obtain phenolic acid.

In described (1) described method: described phenolic acid ester can be Ferulic acid methylester (MFA), Methyl caffeoate (MCA), coumaric acid methyl esters (MpCA) or sinapinic acid methyl esters (MSA) etc.; Described phenolic acid can be forulic acid, coffic acid, coumaric acid or sinapinic acid etc.In described (2) described method: described phenolic acid is forulic acid and/or coumaric acid.

The present invention also protects described albumen and zytase to obtain application in the reducing sugar at the degrading maize core.

The present invention also protects the arbitrary described application in following (1) to (8) of described albumen:

(1) production forulic acid, coffic acid, coumaric acid or and sinapinic acid at least a;

(2) prepare feed as fodder additives;

(3) prepare medicine as medicated premix;

(4) produce paper;

(5) produce food;

(6) produce polysaccharide;

(7) lignocellulose degradation;

(8) degrading plant material.

Described vegetable material specifically can be corn cob.

FaeI albumen (phenolic acid esterase) can be used to degraded or transforms contain Mierocrystalline cellulose or xylan or pectin material, thereby as feed additive, in order to the nutrition that improves animal-feed, the nutrition and the mouthfeel of food, improves the transformation efficiency of biomass.FaeI albumen (phenolic acid esterase) can be used to improve the cellulosic materials of vegetable material or recovery, thereby be used for paper pulp slurrying (during concrete operations, can in pulp mixture, add a certain amount of phenolic acid esterase, act on pulp mixture under certain condition, from the usage quantity of the harmful chemical substance of effective reduction, reduce cost, reduce environmental pollution).FaeI albumen (phenolic acid esterase) can be used for preparing phenolic acid such as forulic acid, coumaric acid, phenolic acid cosmetic industry as antioxidant, medical behavior as anti-infective and in food service industry as sanitas.

FaeI albumen of the present invention (phenolic acid esterase) can significantly improve the burst size of farm-forestry crop by products such as herbage, straw, wheat bran, corn cob reducing sugar burst size and phenolic acid such as forulic acid, coumaric acid in enzymolysis process; There is important use to be worth in bio-transformation, feed, pharmacy, papermaking, makeup and food service industry.Phenolic acid esterase has important use to be worth at animal-feed, papermaking, food, bioenergy, makeup and pharmaceutical industry.

Description of drawings

Fig. 1 is the 12%SDS-PAGE figure of phenolic acid esterase FaeI; M is a molecular weight standard (unit: KDa); 1 is the FaeI albumen behind the purifying.

Fig. 2 is the optimum temperuture of phenolic acid esterase FaeI.

Fig. 3 is the optimal pH of phenolic acid esterase FaeI; ◇ is Na ₂HPO ₄-Citrate (pH3-7) damping fluid; * be Tris-HCl (pH7-9) damping fluid; is Glycine-NaOH (pH9-11) damping fluid.

Fig. 4 is the thermostability of phenolic acid esterase FaeI.

Fig. 5 is the pH stability of phenolic acid esterase FaeI; ◇ is Na ₂HPO ₄-Citrate (pH3-6) damping fluid; * be Tris-HCl (pH7-8) damping fluid; is Glycine-NaOH (pH9-11) damping fluid.

Embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.Annotate: pNP (p-nitrophenyl-ester), p-nitrophenyl phenolic ester.

Escherichia coli DH5a: TransGen Biotech (Beijing Quanshijin Biotechnology Co., Ltd), catalog number (Cat.No.) CD201.E. coli bl21 (DE3): the Novagen brand of German Merck KgaA group, article No. 69387-3.Carrier pET15b: the Novagen brand of German Merck KgaA group, article No. 69257.Ferulic acid methylester (MFA): Apin ChemicalsLimited (UK), article No. 01557i.Methyl caffeoate (MCA): Apin Chemicals Limited (UK), article No. 00801c.Coumaric acid methyl esters (MpCA): Apin Chemicals Limited (UK), article No. 01425c.Sinapinic acid methyl esters (MSA): Apin Chemicals Limited (UK), article No. N03915s.Chlorogenic acid (CGA): SIGMA, catalog number (Cat.No.) C3878.Zytase: SIGMA, catalog number (Cat.No.) X2753.

DNS reagent: 6.3g DNS and 20.96g NaOH solid are added in the hot solution of Seignette salt (the 182g Seignette salt is dissolved in 500ml distilled water), add 5g re-distilled phenol and 5g S-WAT again in above-mentioned solution, stirring makes dissolving, the cooling back is settled to 1 with distilled water, 000ml stores in and preserves week back use in the brown bottle.

The discovery of embodiment 1, albumen and encoding gene thereof and name

Occupy cud and separate CELLULOLYTIC BACTERIUM (former Clostridium ruminocolum by name renamed Cellulosilyticum ruminicola afterwards as) H1CGMCC No.2125 (Chinese patent, CN 101148651A; The applying date is on September 6th, 2007, application number is 200710121453.X), abbreviation occupies cud and separates CELLULOLYTIC BACTERIUM H1, be to separate a strain from the yak cud newly to belong to novel species (in July, 2004 is by the elegant pearl in east, Cai Shichun and Zhang Kegui find, this discoverer's contact method is No. 3 Institute of Microorganism, Academia Sinica in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City), can be that the sole carbon source and the energy are grown (as corn cob with multiple natural plant fibre, clover, rye grass etc.), equally also can utilize a series of polysaccharide growths (as Mierocrystalline cellulose, xylan, mannosans and pectin etc.).

Separate and found an albumen (phenolic acid esterase) the CELLULOLYTIC BACTERIUM H1 from occupying cud: FaeI albumen.

With the albumen of albumen called after FaeI shown in the sequence 1 of sequence table (forming) by 534 amino-acid residues.With the proteic encoding gene called after of FaeI faeI gene, its open reading frame (is made up of 1605 Nucleotide shown in the sequence 2 of sequence table.

The structure of embodiment 2, recombinant plasmid and reorganization bacterium

One, construction of recombinant plasmid

1, extraction occupies the genomic dna that cud is separated CELLULOLYTIC BACTERIUM H1.

2, design faeI primer is to (being made up of faeI-F and faeI-R).

The nucleotide sequence of each primer following (5 ' → 3 '):

FaeI-F (upstream primer): CCG CATATGGCAATTACGCCAGTAAT (underscore is the NdeI restriction enzyme site);

FaeI-R (downstream primer): CG GGATCCTTATTTAAGCACTACATTAGC (underscore is the BamHI restriction enzyme site).

3, the genomic dna with step 1 is a template, to carrying out pcr amplification, obtains pcr amplification product with the faeI primer.Pcr amplification condition: 94 ℃, 4 minutes; 94 ℃, 30 seconds, 51 ℃, 30 seconds, 72 ℃, 3 minutes, 30 circulations; 72 ℃, 10 minutes.

Pcr amplification system following (25 μ L): 2.5 μ L, 10 * pfu dna polymerase buffer liquid, 1 μ L template DNA, 10 μ M upstream primers, 1 μ L, 10 μ M downstream primers, 1 μ L, 0.25 μ L pfu archaeal dna polymerase and 19.25 μ L aseptic double-distilled waters.

4,, reclaim enzyme and cut product with restriction enzyme NdeI and BamHI double digestion pcr amplification product.

5, with restriction enzyme NdeI and BamHI double digestion carrier pET15b, reclaim carrier framework (about 5696bp).

6, construction of recombinant plasmid

With pcr amplification product with after carrier framework is connected with the T4DNA ligase enzyme, transformed into escherichia coli DH5a, carry out resistance screening on LB substratum (containing 50 μ g/mL penbritins) flat board, the picking positive colony checks order, and sequencing result shows and obtained recombinant plasmid 15b-faeI.

It is as follows according to sequencing result the recombinant plasmid first to be carried out structrual description: inserted the dna molecular (faeI gene) shown in the sequence 2 of sequence table between the NdeI of carrier pET15b and BamHI restriction enzyme site.

Two, the structure of control plasmid

1, extraction occupies the genomic dna that cud is separated CELLULOLYTIC BACTERIUM H1.

2, design faeI primer is to (being made up of faeI-F1 and faeI-R).

The nucleotide sequence of each primer following (5 ' → 3 '):

FaeI-F1 (upstream primer): CCG CATATGGTAAAAAGTATGAGA (underscore is the NdeI restriction enzyme site);

FaeI-R (downstream primer): CG GGATCCTTATTTAAGCACTACATTAGC (underscore is the BamHI restriction enzyme site).

Step 3 gets 3 to 6 to 6 with step 1.

Obtained control plasmid.

It is as follows according to sequencing result control plasmid to be carried out structrual description: the sequence 4 of between the NdeI of carrier pET15b and BamHI restriction enzyme site, having inserted sequence table from the dna molecular shown in 5 ' terminal the 4th to 1701 Nucleotide (with the existing albumen of the albumen called after shown in the sequence 3 of sequence table, proteic encoding sequence shown in the sequence 3 is shown in the sequence 4 of sequence table, with the existing gene of the DNA called after shown in the sequence 4).

Three, the acquisition of reorganization bacterium

Change recombinant plasmid 15b-faeI over to e. coli bl21 (DE3), obtain the bacterium of recombinating.

Four, the acquisition of contrast fungus beetle

Change carrier pET15b over to e. coli bl21 (DE3), obtain contrasting fungus beetle.

Five, the acquisition of contrast bacterium second

Change control plasmid over to e. coli bl21 (DE3), obtain contrasting bacterium second.

Embodiment 3, proteic purifying and sign

Binding Buffer: by solute and solvent composition; Solvent is a 25mM Tris-HCl damping fluid (pH7.4); Solute and concentration thereof are as follows: 30mM imidazoles, 500mM sodium-chlor, 10% (volumn concentration) glycerine.

Elution Buffer: by solute and solvent composition; Solvent is a 25mM Tris-HCl damping fluid (pH7.4); Solute and concentration thereof are as follows: 500mM imidazoles, 500mM sodium-chlor, 10% (volumn concentration) glycerine.

One, the proteic purifying of FaeI

1, the reorganization bacterium mono-clonal that the step 3 of embodiment 2 is made up is inoculated in the LB liquid nutrient medium (containing 50 μ g/mL penbritins), and shaking culture (37 ℃, 200rpm, rotation radius 30mm) 16 hours obtains nutrient solution.

2, the nutrient solution that step 1 is obtained is gone in the new LB liquid nutrient medium (containing 50 μ g/mL penbritins) with 1% inoculum size (volume percent) switching, and shaking culture (37 ℃, 200rpm, rotation radius 30mm) 4 hours obtains nutrient solution (OD ₆₀₀=0.6-0.8).

3, in the nutrient solution of step 2, add inductor IPT6 to final concentration 1mM with inducible gene expression, continue to cultivate 4 hours (2-6 hour all can), obtain nutrient solution.

4, with the medium centrifugal (12000 * g, 5 minutes) of step 3, collect bacterial sediment,, be suspended in then among the Binding Buffer, obtain bacteria suspension with aseptic double-distilled water washing 2 times.

5, the bacteria suspension with step 4 carries out ultrasonic disruption (200 watts of power, ultrasonic 1 second 2 seconds at interval, the time was 45 minutes altogether) afterwards centrifugal (20 minutes, 12000 * g), draw supernatant, with 0.45 μ m aperture membrane filtration, the filtrate that obtains is soluble proteins solution.

6, the soluble proteins solution with step 5 carries out affinity chromatography

Adopt Ni with GE company ²⁺Ion affinity chromatography post HiTrap ^TM(internal diameter and length are 0.7 * 2.5cm for catalog number (Cat.No.) 17-5247-01,1mL capacity, and filler is the Ni sepharose of prepackage ^TM, average grain 34 μ m).

Behind the Binding Buffer balance affinity column with 10 times of column volumes, with sample on the soluble proteins solution; Use the foreign protein of Binding Buffer flush away non-specific binding then, absorb line until 280nm and flatten surely; Carry out linear gradient elution with the Elution Buffer of volume ratio at last from the Binding Buffer of 100%-0 and volume ratio from 0-100%, elution flow rate is 1mL/min, total time is 30 minutes, collects target protein (collected volume is carried out the elutriant that wash-out obtains than the Elution Buffer that for the Binding Buffer of 60%-73.3% and volume ratio is 26.7%-40%) according to the 280nm absorption peak.

7, the elutriant of collecting is dialysed in 25mM Tris-HCl damping fluid (pH7.4) 18 hours (changing dialyzate every 4-6 hour), obtain the FaeI protein liquid.It is frozen in-80 ℃ that the FaeI protein liquid is distributed into tubule.

Two, the proteic sign of FaeI

With the FaeI protein liquid according to the Thermo scientific BCA of company ^TMProtein Assay Kit test kit carries out quantitatively albumen, and protein concentration is 740 μ g/mL.

The FaeI protein liquid is carried out 12%SDS-PAGE, and electrophorogram is seen Fig. 1.As seen the albumen of purifying the band that specificity is very high occurs in target location (58kDa), illustrates to have obtained target protein and purity is higher.

The FaeI protein liquid is carried out the peptide mass spectroscopy,, confirm that the albumen of purifying is the product of faeI genetic expression by separating the protein peptide fingerprint database comparison of predicting in the CELLULOLYTIC BACTERIUM H1 genome with occupying cud.

Three, the acquisition of contrast liquid first

Step 1 uses the contrast fungus beetle of the step 4 structure of embodiment 2 to replace the reorganization bacterium in 6, and other is with 1 to 6 of step 1.

7, the elutriant of collecting is dialysed in 25mM Tris-HCl damping fluid (pH7.4) 18 hours (changing dialyzate every 4-6 hour), obtain contrasting the liquid first.To contrast the liquid first, to be distributed into tubule frozen in-80 ℃.

Three, the acquisition of contrast liquid second

Step 1 uses the contrast bacterium second of the step 5 structure of embodiment 2 to replace the reorganization bacterium in 6, and other is with 1 to 6 of step 1.

7, the elutriant of collecting is dialysed in 25mM Tris-HCl damping fluid (pH7.4) 18 hours (changing dialyzate every 4-6 hour), obtain contrasting liquid second.To contrast liquid second, to be distributed into tubule frozen in-80 ℃.

The proteic enzyme activity determination of embodiment 4, FaeI

One, glycosidase activity is measured

1, measures glycosidase activity by the growing amount that detects reducing sugar

Reaction system (500 μ L): by 450 μ L 25mM Tris-HCl damping fluids (pH 7.0), reaction substrate and 50 μ L solution composition to be measured; Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.Temperature of reaction is 37 ℃.The reducing sugar content that reaction back employing sometime DNS colorimetric method for determining produces.Three repetitions are established in experiment.

An enzyme activity unit (1U) is defined as the enzyme amount that per minute discharges 1 μ mol reducing sugar.

(1) circumscribed cellulase activity

Reaction substrate is Microcrystalline Cellulose (Avicel), and the starting point concentration of reaction substrate in reaction system is 0.1g/100mL, and the reaction times is 12 hours.

(2) endo cellulase activity

Reaction substrate is carboxymethyl cellulose (CMC), and the starting point concentration of reaction substrate in reaction system is 0.1g/100mL, and the reaction times is 30 minutes.

(3) xylanase activity

Reaction substrate is the oat xylan, and the starting point concentration of reaction substrate in reaction system is 0.1g/100mL, and the reaction times is 30 minutes.

(4) pectinesterase activity

Reaction substrate is a citrus pectin, and the starting point concentration of reaction substrate in reaction system is 0.1g/100mL, and the reaction times is 30 minutes.

2, measure glycosidase activity by detecting the p-NP growing amount

Reaction system (500 μ L): by the 5 μ L 10mM reaction substrate aqueous solution, 490 μ L 25mM Tris-HCl damping fluids (pH7.0) and 5 μ L solution composition to be measured; Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.Temperature of reaction is 37 ℃; React the content of p-nitrophenol that adopts colorimetric method for determining to produce after 30 minutes.Three repetitions are established in experiment.

(1) cellobiohydrolase activity: pNP-β-D-cellobioside substrate;

(2) activity of beta-glucosidase: pNP-β-D-glucopyranoside substrate;

(3) xylobiase activity: pNP-β-D-xylopyranoside substrate;

(4) α-arabinofuranosidase activity: pNP-α-L-arabinofuranoside substrate;

(5) β-glucuronidase activity: pNP-β-D-glucuronide substrate;

The reaction result of step 1 and step 2 does not all detect the generation of reducing sugar or p-NP, and FaeI albumen not degraded cellulose, hemicellulose and pectin are described.

Two, fatty acid ester enzyme assay

Reaction system (500 μ L): by the 5 μ L 10mM reaction substrate aqueous solution, 490 μ L 25mM Tris-HCl damping fluids (pH7.0) and 5 μ L solution composition to be measured; Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.Reaction substrate is respectively: pNP-acetate (C2), pNP-butyrate (C4), pNP-caproate (C6), pNP-octanoate (C8), pNP-caprate (C10), pNP-laurate (C12), pNP-myristate (C14), pNP-palmitate (C16).Temperature of reaction is 37 ℃.React the content of p-nitrophenol that adopts colorimetric method for determining to produce after 30 minutes.Three repetitions are established in experiment.

An enzyme activity unit (1U) is defined as the enzyme amount that per minute discharges 1 μ mol p-NP.

The results are shown in Table 2, FaeI albumen to short-chain aliphatic ester (≤C10) faint enzymic activity arranged, and the fatty acid ester of the long-chain of not degrading, thereby FaeI albumen is not lipase.

Table 2FaeI albumen is to the enzyme activity (U/mg) of short-chain aliphatic ester

C2	C4	C6	C8	C10
					0.16±0.01	0.29±0.01	0.15±0.03	0.07±0.01	0.03±0.01

Three, phenolic acid esterase determination of activity

Reaction system (200 μ L): by 25mM Tris-HCl damping fluid (pH7.0), substrate (starting point concentration in reaction system is 10mM) and 5 μ L solution composition to be measured.Solution to be measured is FaeI protein liquid or the contrast liquid first or the contrast liquid second of embodiment 3 preparations.Substrate adopts respectively: Ferulic acid methylester (MFA), Methyl caffeoate (MCA), coumaric acid methyl esters (MpCA), sinapinic acid methyl esters (MSA), Chlorogenic acid (CGA).40 ℃ were reacted 30 minutes behind the reaction system mixing, and ice-water bath cooling immediately is 5 minutes then; Add 20 μ L 20% (volumn concentration) aqueous formic acids then, get 20 μ L detect corresponding phenolic acid by HPLC content behind the mixing.Three repetitions are established in experiment.

The correlation parameter of HPLC detection phenolic acid is as follows: the pillar model is Agilent ZORBAX Eclipse Plus C18, and article No. is 959990-902, column length 250mm, internal diameter 4.6mm, particle mean size 5.0 μ m; Guard column core article No. is 820950-936, and length is 12.5mm, internal diameter 4.6mm, particle mean size 5.0 μ m; Flow to being made up of 45 parts by volume methyl alcohol and 55 parts by volume 10mM aqueous sodium formate solution (pH3.0), flow velocity is 1mL/min, and the 325nm wavelength detects.

An enzyme activity unit (1U) is defined as the enzyme amount that per minute discharges the corresponding phenolic acid of 1 μ mol.

The product of Ferulic acid methylester is a forulic acid; The target peak retention time is 7.2 minutes; The forulic acid standard substance that adopt are available from Chemical Reagent Co., Ltd., Sinopharm Group, and catalog number is 30089423, and typical curve is y=19926x-42686, R ²=1, y is a peak area, and x is concentration (0-1000 μ M).

Methyl caffeoate's product is a coffic acid; The target peak retention time is 5.0 minutes; The coffic acid standard substance that adopt are available from Alfa Aesar, and catalog number is A15950; Typical curve is y=19110x-15435, R ²=0.9999, y is a peak area, and x is concentration (0-1000 μ M).

The product of coumaric acid methyl esters is a coumaric acid; The target peak retention time is 6.9 minutes; The coumaric acid standard substance that adopt are available from SIGMA, and catalog number is C9008; Typical curve is y=15296x+32710, R ²=1, y is a peak area, and x is concentration (0-1000 μ M).

The product of sinapinic acid methyl esters is a sinapinic acid: the target peak retention time is 6.8 minutes; The sinapinic acid standard substance that adopt are available from Alfa Aesar, and catalog number is A15676; Typical curve is y=21563x+17272, R ²=1, y is a peak area, and x is concentration (0-1000 μ M).

The product of Chlorogenic acid is coffic acid and quinic acid, and enzyme work is calculated by coffic acid.

The results are shown in Table 3, FaeI albumen shows different hydrolytic activities to the phenolic acid ester bond of different structure.

Table 3FaeI albumen is to the enzyme activity (U/mg) of phenolic acid esterase artificial substrates

	MFA	MCA	MpCA	MSA	CGA
						The FaeI protein liquid	3.78±0.10	1.47±0.04	1.1±0.01	3.66±0.01	0
Contrast liquid first	0	0	0	0	0
						Contrast liquid second	3.05±0.09

The result shows: contrast liquid first (protein liquid that the contrast fungus beetle that the commentaries on classics empty carrier obtains obtains) does not have the phenolic acid esterase activity; Contrast liquid second (protein liquid that the contrast bacterium second that the commentaries on classics control plasmid obtains obtains) and FaeI protein liquid (protein liquid that the reorganization bacterium that commentaries on classics recombinant plasmid 15b-faeI obtains obtains) all have the phenolic acid esterase activity, but the proteic enzyme work of FaeI is significantly higher than existing albumen.

Embodiment 5, FaeI albumen are as the zymologic property of phenolic acid esterase

One, optimum temperuture

Reaction system (200 μ L): by 25mM Tris-HCl damping fluid (pH7.0), Ferulic acid methylester (starting point concentration in reaction system is 10mM) and 5 μ L solution composition to be measured.Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.A certain temperature of reaction behind the reaction system mixing (20 ℃-60 ℃ are spaced apart 5 ℃) reaction 30 minutes, ice-water bath cooling immediately is 5 minutes then; Add 20 μ L 20% (volumn concentration) aqueous formic acids then, get 20 μ L behind the mixing and detect ferulaic acid content (method is with the step 3 of embodiment 4) by HPLC.Three repetitions are established in experiment.

It (is 3.78 ± 0.10U/mg) that FaeI albumen has enzymatic activity high at 40 ℃.With enzymatic activity high is 100%, and the relative enzyme that calculates under other temperature condition is lived, and sees Fig. 2.Can keep in 30-50 ℃ 〉=80% enzyme is alive.

Two, optimal pH

Reaction system (200 μ L): by damping fluid, Ferulic acid methylester (starting point concentration in reaction system is 10mM) and 5 μ L solution composition to be measured.Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.Damping fluid adopts following several respectively: 25mM Na ₂HPO ₄-Citrate damping fluid (pH3.0), 25mM Na ₂HPO ₄-Citrate damping fluid (pH4.0), 25mM Na ₂HPO ₄-Citrate damping fluid (pH5.0), 25mM Na ₂HPO ₄-Citrate damping fluid (pH6.0), 25mMNa ₂HPO ₄-Citrate damping fluid (pH7.0), 25mM Tris-HCl damping fluid (pH7.0), 25mM Tris-HCl damping fluid (pH8.0), 25mM Tris-HCl damping fluid (pH9.0), 25mM Glycine-NaOH damping fluid (pH9.0), 25mM Glycine-NaOH damping fluid (p10.0), 25mM Glycine-NaOH damping fluid (pH11.0).40 ℃ were reacted 30 minutes behind the reaction system mixing, and ice-water bath cooling immediately is 5 minutes then; Add 20 μ L20% (volumn concentration) aqueous formic acids then, get 20 μ L behind the mixing and detect ferulaic acid content (method is with the step 3 of embodiment 4) by HPLC.Three repetitions are established in experiment.

FaeI albumen has enzymatic activity high in 25mM Tris-HCl damping fluid (pH7.0) (be 3.78 ± 0.10U/mg.With enzymatic activity high is 100%, and the relative enzyme that calculates under other pH condition is lived, and sees Fig. 3.

Three, thermostability

Reaction system (200 μ L): by 25mM Tris-HCl damping fluid (pH7.0), Ferulic acid methylester (starting point concentration in reaction system is 10mM) and 5 μ L solution composition to be measured.Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.

Reaction process: the component beyond the substrate is mixed, and (25 ℃-55 ℃ are spaced apart 5 ℃) hatches 12 hours (temperature is bathed) in differing temps; Add substrate then and obtain complete reaction system, 40 ℃ were reacted 30 minutes behind the mixing, and ice-water bath cooling immediately is 5 minutes then; Add 20 μ L20% (volumn concentration) aqueous formic acids then, get 20 μ L behind the mixing and detect ferulaic acid content (method is with the step 3 of embodiment 4) by HPLC.The reaction system that temperature bathe is handled in contrast.Three repetitions are established in experiment.

(be 3.78 ± 0.10U/mg), Fig. 4 is seen in the enzyme work under other warm bath condition as 100% in the enzyme work of contrast.FaeI albumen has been kept very high enzymic activity (〉=80%) at 40 ℃.

Four, ph stability

Reaction system (200 μ L): by damping fluid, Ferulic acid methylester (starting point concentration in reaction system is 10mM) and 5 μ L solution composition to be measured.Solution to be measured is the FaeI protein liquid of embodiment 3 preparations.

Damping fluid adopts following several respectively: 25mM Na ₂HPO ₄-Citrate damping fluid (pH3.0), 25mMNa ₂HPO ₄-Citrate damping fluid (pH4.0), 25mM Na ₂HPO ₄-Citrate damping fluid (pH5.0), 25mMNa ₂HPO ₄-Citrate damping fluid (pH6.0), 25mM Tris-HCl damping fluid (pH7.0), 25mM Tris-HCl damping fluid (pH8.0), 25mM Glycine-NaOH damping fluid (pH9.0), 25mM Glycine-NaOH damping fluid (p10.0), 25mM Glycine-NaOH damping fluid (pH11.0).

Reaction process: the component beyond the substrate is mixed, hatched 16 hours for 4 ℃; Add substrate then and obtain complete reaction system (transferring pH is 7.0), 40 ℃ were reacted 30 minutes behind the mixing, and ice-water bath cooling immediately is 5 minutes then; Add 20 μ L 20% (volumn concentration) aqueous formic acids then, get 20 μ L behind the mixing and detect ferulaic acid content (method is with the step 3 of embodiment 4) by HPLC.Damping fluid is adopted 25mM Tris-HCl damping fluid (pH7.0), and do not carry out 4 ℃ of reaction systems of hatching in contrast.Three repetitions are established in experiment.

(be 3.78 ± 0.10U/mg), Fig. 5 is seen in the enzyme work under other condition as 100% in the enzyme work of contrast.FaeI albumen is at pH3-10 (〉=80%).

Embodiment 6, FaeI albumen (phenolic acid esterase) act on corn cob

One, the preparation of substrate

(1) with corn cob in 105 ℃ of oven dry 6 hours, in historrhexis's machine, break into powdery, cross 120 mesh sieves; (2) with 25mM Tris-HCl damping fluid (pH7.0) suspended powder (final concentration is 1g/100mL), adding α-Dian Fenmei (SIGMA, article No. 10065) then, to make its final concentration be 0.1g/100mL, handled 2 hours for 37 ℃, centrifugal 10 minutes of 12,000 * g abandons supernatant; (3) with 25mM Tris-HCl damping fluid (pH7.0) precipitation (final concentration is 1g/100mL) that suspends, adding α-Dian Fenmei (SIGMA, article No. 10065) then, to make its final concentration be 0.1g/100mL, handled 2 hours for 37 ℃, centrifugal 10 minutes of 12,000 * g abandons supernatant; (4) repeating step (3); (5) with 25mMTris-HCl damping fluid (pH7.0) precipitation (final concentration is 1g/100mL) that suspends, adding papoid (Merck, article No. CB5125) then, to make its final concentration be 0.1g/100mL, handled 6 hours for 37 ℃, centrifugal 10 minutes of 12,000 * g, collecting precipitation; Clean 3 times with aseptic double-distilled water, in 60 ℃ of dry for standby, be substrate at last.

Two, FaeI albumen (phenolic acid esterase) acts on corn cob and discharges forulic acid

Reaction system (200 μ L): the faeI protein liquid (starting point concentration of FaeI albumen in reaction system is 50 μ g/mL) by 25mM Tris-HCl damping fluid (pH7.0), substrate (starting point concentration in reaction system is 40mg/mL) and embodiment 3 preparations is formed.38 ℃ were reacted 30 minutes behind the reaction system mixing, and ice-water bath cooling immediately is 5 minutes then; With centrifugal 2 minutes of reaction solution 12,000 * g, get 100 μ L supernatants, add 20 μ L 20% (volumn concentration) aqueous formic acids then, get 20 μ L behind the mixing and detect ferulaic acid content and coumaric acid content (method is with the step 3 of embodiment 4) by HPLC.Three repetitions are established in experiment.

Adopt FaeI proteolytic degradation natural substrate corn cob, after reaction finished, the coumaric acid content in the system was 0.21 ± 0.01 μ M, and ferulaic acid content is 73.71 ± 6.89 μ M.

Three, FaeI albumen (phenolic acid esterase) discharges reducing sugar with the zytase acting in conjunction in corn cob

Reaction system first (200 μ L): the FaeI protein liquid (starting point concentration of FaeI albumen in reaction system is 50 μ g/mL) by 25mM Tris-HCl damping fluid (pH7.0), substrate (starting point concentration in reaction system is 40mg/mL), zytase (starting point concentration in reaction system is 0.075mg/mL) and embodiment 3 preparations is formed.

Reaction system second (200 μ L): form by 25mM Tris-HCl damping fluid (pH7.0), substrate (starting point concentration in reaction system is 40mg/mL) and zytase (starting point concentration in reaction system is 0.075mg/mL).

Reaction system third (200 μ L): the FaeI protein liquid (starting point concentration of faeI albumen in reaction system is 50 μ g/mL) by 25mM Tris-HCl damping fluid (pH7.0), substrate (starting point concentration in reaction system is 40mg/mL) and embodiment 3 preparations is formed.

Reaction system fourth (200 μ L): by 25mM Tris-HCl damping fluid (pH7.0), corn cob (starting point concentration in reaction system is 40mg/mL)

38 ℃ of reactions were contrast with the reaction fourth after 6 hours behind the reaction system mixing, the reducing sugar content that adopts the DNS colorimetric method for determining to produce, and three repetitions are established in experiment.

Reducing sugar detection method: the reaction solution 12 that reaction is finished, centrifugal 2 minutes of 000 * g, getting 40 μ L supernatants joins in the 60 μ L DNS reagent, boiling water bath is 5 minutes behind the mixing, the cooling back is settled to 1mL with distilled water, get 200 μ L in 96 hole enzyme plates (SIGMA, article No. CLS2592), detect light absorption value under the 540nm wavelength.

Standard substance glucose is available from modern east, Beijing fine chemicals company limited; Typical curve: y=0.1241x+0.0005, R ²=0.9988, y is the light absorption value of wavelength 540nm, and x is the concentration (0-10mM) of glucose.

React after 6 hours, reducing sugar content in the reaction system first is 1.81 ± 0.14mM, reducing sugar content in the reaction system second is 1.33 ± 0.10mM, and the reducing sugar content in the reaction system third is 0mM, and FaeI albumen can promote the degraded of zytase to corn cob.

Claims (10)

1. protein is following (a) or (b):

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have a phenolic acid esterase active by sequence 1 deutero-protein.

2. coding claim 1 described proteic gene.

3. gene as claimed in claim 2 is characterized in that: it is for following 1) or 2) or 3) dna molecular:

1) dna molecular shown in the sequence 2 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization and the coding that limit have the active proteic dna molecular of phenolic acid esterase;

3) with 1) dna sequence dna that limits has 90% above homology and coding has the active proteic dna molecular of phenolic acid esterase.

4. the recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain claim 2 or 3 described genes.

5. recombinant expression vector as claimed in claim 4 is characterized in that: the recombinant plasmid that described recombinant expression vector obtains for the multiple clone site with claim 2 or 3 described gene insertion vector pET15b.

6. reorganization bacterium as claimed in claim 4 is characterized in that: described reorganization bacterium is for importing the reorganization bacterium that intestinal bacteria obtain with claim 4 or 5 described recombinant expression vectors; Described intestinal bacteria are preferably e. coli bl21 (DE3).

7. total length or its arbitrary segmental primer of amplification claim 2 or 3 described genes are right.

8. method for preparing phenolic acid is following (1) or (2):

(1) with the described proteolytic degradation phenolic acid of claim 1 ester, obtains phenolic acid;

(2) with the described proteolytic degradation corn cob of claim 1, obtain phenolic acid.

9. described albumen of claim 1 and zytase obtain application in the polysaccharide at the degrading maize core.

10. the described albumen of claim 1 arbitrary described application in following (1) to (8):

(1) production forulic acid, coffic acid, coumaric acid or and sinapinic acid at least a; (2) prepare feed as fodder additives; (3) prepare medicine as medicated premix; (4) produce paper; (5) produce food; (6) produce polysaccharide; (7) lignocellulose degradation; (8) degrading plant material.

Images