CN102216771A - Gene sequences for the detection of chikungunya and dengue fever - Google Patents

Abstract

We disclose a method of detecting chikungunya and dengue nucleic acids in a biological sample, the method comprising the steps of: (a) an amplification step in which chikungunya and dengue nucleic acids are amplified by chikungunya primers and dengue primers in a nucleic acid amplification reaction; and (b) a detection step in which amplified nucleic acids from (a) are hybridised to a chikungunya nucleic acid probe and a dengue nucleic acid probe in a nucleic acid hybridisation reaction. Primer and probe sequences capable of detecting chikungunya and dengue are also disclosed.

Description

Be used to detect the gene order of chikungunya and dengue fever

Technical field

The present invention relates to medical science, cell biology, molecular biology and science of heredity field.More specifically, the present invention relates to be suitable for detecting the method for the nucleotide sequence of pathogen in the sample or its product.

Background technology

(dengue is the epidemic disease of most of torrid zone and subtropical zone DEN) to dengue fever, and (chikungunya, CHIK) heat has appeared at island, most of Indian Ocean, India, Italy to chikungunya, and appears at Malaysia and Singapore recently.

A large amount of molecular assay methods are put down in writing, and are used for detecting respectively DENV and CHIKV.Reported a kind of determination method (Dash et al., 2008) that is used for antidiastole DEN and CHIK recently.Though this determination method can detect this two kinds of infection simultaneously, this detection is to be undertaken by the running gel method of the bromination second pyridine dyeing of routine.Correspondingly, this method can not be distinguished true testing result and non-specific testing result.

The present invention is intended to solve these problems of the prior art and other problems.

Summary of the invention

According to a first aspect of the invention, the inventor provides the chikungunya in a kind of detection of biological sample and the method for dengue fever nucleic acid, the method comprising the steps of: (a) amplification step, wherein increase to chikungunya and dengue fever nucleic acid by chikungunya primer and dengue fever primer in nucleic acid amplification reaction; (b) detect step, wherein the amplification of nucleic acid in (a) in nucleic acid hybridization reaction with chikungunya nucleic acid probe and dengue fever nucleic acid probe hybridization.

The nucleic acid of described amplification can with a plurality of dengue fever nucleic acid probe hybridizations.Described dengue fever nucleic acid probe can combine with dengue fever nucleic acid not of the same race.Each of described different dengue fever nucleic acid all can characterize a kind of dengue fever strain system.This method make can the identification of organism sample in from the nucleic acid of concrete dengue fever strain system.

Described nucleic acid amplification reaction can comprise PCR (PCR).Described PCR can comprise reverse transcriptase polymerase chain reaction (RT-PCR).It can comprise double RT-PCR.

Described chikungunya and dengue fever probe can be fixed.They can be fixed on the microballoon.Described microballoon can comprise the microballoon of coding.Like this can be so that the evaluation of microballoon is demonstrated probe type fixed thereon.

The microballoon of described coding can comprise color-coded microballoon.

The nucleic acid of described amplification can be by the detectable label substance markers.This method can comprise, with detectable mark chikungunya nucleic acid primer and dengue fever nucleic acid primer.This method can be so that amplification step (a) produces the amplification of nucleic acid through mark.

Described detectable can comprise that any its existence is the material that can manifest.Detectable can be included as the signal producing method.Described signal producing method can comprise biotin.It can comprise biotin Streptavidin-phycoerythrin (biotin streptavidin-phycoerythrin) conjugate.

Described method can comprise, by detecting detectable to detect the nucleic acid of amplification.The amplification of nucleic acid that is detected can be combined on the microballoon.Described nucleic acid can be attached on the microballoon by microballoon fixing chikungunya probe and dengue fever probe.

Described method can also comprise: identify that microballoon fixes probe on it with evaluation.This method makes it possible to identify the type of the amplification of nucleic acid of combination.

The detectable that comprises biotin Streptavidin-phycoerythrin conjugate can be by first laser detection.The type of color-coded microballoon can be determined by second laser.Described first laser can have different wavelength with described second laser.

The evaluation of the detection of detectable and color coding microballoon can be carried out simultaneously, does not perhaps carry out simultaneously.The detection of detectable can be carried out synchronously with the auth type of color coding microballoon.

The chikungunya nucleic acid primer can be made up of the nucleotide sequence shown in the table D1.1.The dengue fever nucleic acid primer can be made up of the nucleotide sequence shown in the table D1.2, and perhaps above two kinds of situations occur simultaneously.

The chikungunya nucleic acid probe can be made up of the nucleotide sequence shown in the table D2.1.The dengue fever nucleic acid probe can be made up of the nucleotide sequence shown in the table D2.2.

According to the 2nd aspect of the present invention, the invention provides a kind of according to the present invention the method for the 1st aspect, what described method was used for synchronous detection biological specimen chikungunya exists situation and definite dengue fever strain system.

According to the 3rd aspect of the present invention, the inventor provides the nucleotide sequence shown in table D1.1, table D1.2, table D2.1 or the table D2.2, perhaps its variant, homolog, derivant or fragment.

According to the 4th aspect of the present invention, the invention provides two or the bond of many sequences of aforementioned aspect according to the present invention.Described bond can comprise two or many sequences listing among table D1.1 and the table D1.2, two or many sequences perhaps showing D2.1 and show to list among the D2.2, and perhaps above two kinds of situations occur simultaneously.

This bond can be by each nucleotide sequence shown in table D1.1 and the table D1.2, and perhaps its variant, homolog, derivant or fragment are formed.

This bond can be by each nucleotide sequence shown in table D2.1 and the table D2.2, and perhaps its variant, homolog, derivant or fragment are formed.

This bond can be made up of the bond of forming of above each bond.

Described nucleic acid or bond can comprise the nucleic acid through mark.Described label can comprise biotin.It can comprise biotin Streptavidin-phycoerythrin conjugate.

Described nucleic acid or bond can be in solution.It can comprise fixing nucleic acid.Described nucleic acid can be fixed on the microballoon.It can be fixed on the array.Described array can comprise microarray.

According to the 5th aspect of the present invention, the inventor provides the bond of being made up of following nucleotide sequence: each nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D1.1 and the table D1.2; (b) each nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D2.1 and the table D2.2; Wherein the nucleic acid of (a) is in solution and nucleic acid (b) is fixed on the microballoon.

In aspect the 6th, the invention provides a kind of kit that is used for detecting patient's chikungunya disease or dengue fever, described kit comprises nucleic acid listed above or bond, and operation instructions.

In aspect the of the present invention the 7th, the invention provides nucleotide sequence listed above or bond, as the purposes of the nucleic acid amplification primer of chikungunya or dengue fever gene, perhaps as the purposes of the dna hybrid probe of chikungunya or dengue fever gene.

According to the 8th aspect of the present invention, the inventor provides a kind of method of diagnosing chikungunya disease in the individuality or dengue fever, and described method comprises and obtains biological specimen and by method detection listed above chikungunya or dengue fever nucleic acid wherein from described individuality.

According to the 9th aspect of the present invention, the inventor provides the method for chikungunya disease in a kind of treatment or the prevention individuality or dengue fever, described method comprises chikungunya disease or the dengue fever in the 8th aspect detection individuality according to the present invention, and gives suitable treatment and prevention to described individuality.

Unless stated otherwise, enforcement of the present invention will be adopted conventional chemistry, molecular biology, microbiology, recombinant DNA and immunologic routine techniques, and these technology are in those of ordinary skills' limit of power.Referring to for example J.Sambrook, E.F.Fritsch, and T.Maniatis, 1989, Molecular Cloning:A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F.M.et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch.9,13, and 16, John Wiley ﹠amp; Sons, New York, N.Y.); B.Roe, J.Crabtree, and A.Kahn, 1996, DNA Isolation and Sequencing:Essential Techniques, John Wiley ﹠amp; Sons; J.M.Polak and James O ' D.McGee, 1990, In Situ Hybridization:Principles and Practice; Oxford University Press; M.J.Gait (Editor), 1984, Oligonucleotide Synthesis:A Practical Approach, Irl Press; D.M.J.Lilley and J.E.Dahlberg, 1992, Methods of Enzymology:DNA Structure Part A:Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies:A Laboratory Manual:Portable Protocol NO.I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0-87969-544-7); Antibodies:A Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-314-2), 1855.Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B.Fernandes (2001, New York, NY, Marcel Dekker, ISBN 0-8247-0562-9); And Lab Ref:A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3.Each of these general documents piece all by reference mode is included this paper in.

Description of drawings

The sensitivity that synchronous CHIK of Fig. 1 and DENV measure.

Fig. 2 is with this result that mensuration, single CHIKV-Taqman measure and single DEN SYBR mensuration obtains from clinical sample synchronously.

The synoptic diagram of Fig. 3 has shown chikungunya and the dengue fever primer arrangement position in the pipe that is used for the mensuration purpose that embodiment lists.

The schematic flow sheet of Fig. 4 has shown lists detection scheme among the embodiment.

Embodiment

The inventor provides nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D1.1, table D1.2, table D2.1 and the table D2.2.The bond of two or many sequences also is provided.Described nucleotide sequence or bond can be used to detect chikungunya and dengue fever, perhaps distinguish different dengue fever strains to be, or the both can.

Chikungunya sequence and dengue fever sequence

The inventor has put down in writing many gene orders.These sequences can be used in any method that nucleotide sequence is fit to.For simplicity, the nucleotide sequence of the theme of present disclosure can be called " chikungunya sequence " and " dengue fever sequence ".

" chikungunya sequence " and " dengue fever sequence " can comprise the sequence corresponding to the part of chikungunya nucleotide sequence and dengue fever nucleotide sequence.For example, the chikungunya sequence can comprise the chikungunya gene.Similarly, the dengue fever sequence can comprise the dengue fever gene.

The chikungunya gene can comprise arbitrary gene of stemming from CHIK or arbitrary gene of CHIK.The dengue fever gene can comprise the gene that stems from dengue fever virus or the gene of dengue fever virus.Described sequence can also comprise other nucleic acid residues that do not have this corresponding relation.

The chikungunya sequence can comprise the sequence of listing among table D1.1 or the table D1.2.Described dengue fever sequence can comprise the sequence of listing among table D2.1 or the table D2.2.Described chikungunya or dengue fever sequence comprise variant, homolog, derivant or the fragment of arbitrary this class sequence.

CHIK can comprise that arbitrary strain of CHIK is.CHIK comprises IND-63-WB1 strain system (Gen Bank accession number EF027140).CHIK can comprise following any: NC004162:D570/06 (Africa), EU244823:ITA07-RA1 (Italy), EU037962:Wuerzburg (Germany), EF012359:D570/06 (the littoral island country of Mauritius/the African continent seashore); EF210157:DRDEHydISW06 (India), EF452493:AF15561 (Bangkok), AF369024:S27-Africa prototype (Africa), DQ443544:LR2006OPY1 (tourist (Travelers Returning from Indian Ocean Islands) that island, the Indian Ocean are returned) and AF490259: Luo Si (Luo Si/Scotland).

Dengue fever virus can comprise that arbitrary strain of dengue fever disease is.Described dengue fever virus can comprise that the 1 type strain of DEN virus is D1/SG/06K2290DK1/2006 (EU081281).It can comprise among EU081281, EU081276, EU081261, NC_001477, AY762084 and the M87512 any one or more.

Dengue fever virus can comprise that 2 type strains are D2/SG/05K3295DK1/2005 (EU081177).It can comprise among EU081177, NC_001474, AF169680, M20558, AY858036 and the AB122022 any one or more.

Dengue fever virus can comprise 3 type Singapore strain systems (AY662691).It can comprise among EU081225, EU081221, EU081197, NC_001475, AY66269 and the EU081214 any one or more.

Dengue fever virus can comprise that 4 type strains are ThD4_0734_00 (AY618993).It can comprise among AY762085, AY947539, NC_002640, AY618993, AY152120 and the AY762085 any one or more.

CHIK or dengue fever virus can comprise people's CHIK or dengue fever virus or animal CHIK or dengue fever virus.

The chikungunya gene can comprise the E1 gene.The dengue fever gene can comprise that 5NS holds 3 ' NTR end coding and noncoding region.Locate it is evident that at use term " gene " gene can comprise coding region, non-coding region or comprise both.

Chikungunya described herein and dengue fever sequence can be strand or two strands.

As the case may be, chikungunya described herein can be incorporated on relevant chikungunya or the dengue fever gene particularly with the dengue fever sequence.Described chikungunya or dengue fever gene can comprise DNA, RNA, mRNA, cDNA etc., perhaps its part.Described chikungunya or dengue fever gene can comprise E1 gene (chikungunya) or 5NS to 3 ' NTR coding and noncoding region (dengue fever), perhaps above-mentioned existence either way.As the part of this process, can detect other genes.

Described sequence can be used to detect the situation that exists of chikungunya in the sample or dengue fever nucleic acid.They can be used to detect the situation that exists of chikungunya in the sample or dengue fever virus or its product.They can be used to detect in the sample situation that exists of the chikungunya of concrete strain system or dengue fever virus.They can be used to distinguish these strain systems.

Chikungunya described herein and dengue fever sequence particularly can with the relevant chikungunya or the combination of dengue fever gene of chikungunya or dengue fever strain system.For example, the dengue fever sequence can be distinguished different dengue fever strain systems.

Therefore, the dengue fever sequence particularly can with the multiple variant combination that is derived from different dengue fever strains system.The dengue fever sequence can be can be in conjunction with certain genetic mutation not in conjunction with other variants.The dengue fever sequence can only can be in conjunction with a kind of genetic mutation.

Therefore, the inventor disclose comprise can with the dengue fever sequence of the nucleotide sequence of different 5NS to 3 ' NTR code area or the combination of noncoding region variant.

The disclosed dengue fever sequence of the inventor comprises the nucleotide sequence that can combine with 5NS to 3 ' the NTR coding or the noncoding region variant of dengue fever virus 1 type strain system.For example, the dengue fever sequence can comprise being 5NS to 3 ' the NTR coding of D1/SG/06K2290DK1/2006 (EU081281) or the nucleotide sequence that the noncoding region variant combines with dengue fever virus 1 type strain.

The disclosed dengue fever sequence of the inventor comprises the nucleotide sequence that can combine with 5NS to 3 ' the NTR coding or the noncoding region variant of dengue fever virus 1 type strain system.For example, the dengue fever sequence can comprise being 5NS to 3 ' the NTR coding of D2/SG/05K3295DK1/2005 (EU081177) or the nucleotide sequence that the noncoding region variant combines with dengue fever virus 2 type strains.

The disclosed dengue fever sequence of the inventor comprises the nucleotide sequence that can combine with 5NS to 3 ' the NTR coding or the noncoding region variant of dengue fever virus 1 type strain system.For example, the dengue fever sequence can comprise the nucleotide sequence that can combine with 5NS to 3 ' the NTR coding or the noncoding region variant of dengue fever virus 3 type Singapore strain systems (AY662691).

The disclosed dengue fever sequence of the inventor comprises the nucleotide sequence that can combine with 5NS to 3 ' the NTR coding or the noncoding region variant of dengue fever virus 1 type strain system.For example, the dengue fever sequence can comprise being 5NS to 3 ' the NTR coding of ThD4_0734_00 (AY618993) or the nucleotide sequence that the noncoding region variant combines with dengue fever virus 4 type strains.

The dengue fever sequence can be used for distinguishing different dengue fever virus strain systems.For example, they can be used to distinguish that the dengue fever virus strain is 1, the dengue fever virus strain is 2, the dengue fever virus strain be 3 and the dengue fever virus strain be 4.

Chikungunya and dengue fever sequence can be with in any methods that nucleotide sequence is fit to usually therein.For example, as indicated above, they can be particularly as the primer or the probe that detect chikungunya and dengue fever.

Chikungunya and dengue fever sequence can be used as nucleic acid primer.Described primer can be included in one or more chikungunyas and the dengue fever sequence of listing among table D1.1 and the table D2.1.

Described primer can be used for any known process amplification of nucleic acid by this area.For example, can adopt PCR (PCR).Again for example, can adopt RT-PCR (reverse transcription-PCR).Moreover, can adopt dual RT-PCR.Can also use other amplification methods, for example LCR (ligase chain reaction), dePCR (digitizing PCR), Long PCR, quantitative terminal point PCR, quantitatively real-time PCT, the rapid amplifying (RACE) of cDNA end, TMA, NASBA etc.These methods are well known in the art, and being used for the method that chikungunya and dengue fever sequence are used in these methods is known to those skilled in the art.

Chikungunya and dengue fever sequence can be used as bond to be provided.For example, the inventor discloses the bond of any two or more sequences of listing among table D1.1, table D1.2, table D2.1 and the table D2.2.As show to list among D1.1 or the table D2.1, described bond can comprise two sequences corresponding to forward primer and reverse primer.The bond of two sequences can comprise the forward primer of concrete gene and the reverse primer of this gene.The bond of the paired bond of this class also is provided.

Chikungunya and dengue fever sequence can be used as probe.Described probe can comprise one or more chikungunyas and the dengue fever sequence of listing among table D1.2 and the table D2.2.

Mark

Amplification or hybridization reaction can be included in the combination between chikungunya or dengue fever sequence and the target.For this purpose, can carry out mark to primer or probe.Amplification of nucleic acid as the amplified reaction product can be labeled.

Mark can comprise the entity of any generation signal.Described label can comprise radioactively labelled substance, for example ³²P.Described label can comprise the non-radioactive marker, for example diogixgenin (digoxigenin).Label can comprise light emitting tool.Described label can comprise any suitable dyestuff, for example fluorescent dye.Described label can comprise phycoerythrin.

Described label can be connected to probe, nucleic acid or primer by any suitable manner.Described connection can be temporary transient, moment, semipermanent or permanent.Described connection can be covalently bound, ion connect, by hydrogen bonding, by the Van der Waals force connection etc.Described connection can be that natural chemistry connects.It can be directly or by intermediate to mediate.Suitable bond can be connected to entity to be marked for example probe, nucleic acid, primer etc.The binding partners (binding partner) that has described label can be connected on the entity to be marked by being incorporated into described bond.For example, biotin moiety can be connected on the entity to be marked, and the Streptavidin (strepavin) that is incorporated on the label also can be connected on it.The nucleic acid that nucleic acid to be marked for example increases can have for this purpose and be connected to biotin on it by suitable through biotin labeled primer, and this makes described biotin moiety be integrated in the nucleic acid of described amplification as the part of amplified reaction.

Probe, primer, nucleic acid etc. can be bonded to biotin and be attached to Streptavidin-phycoerythrin on the described biotin, so that the phycoerythrin mark is connected to probe, primer, nucleic acid etc.As the first step, biotin labeled primer can be used to produce biotin labeled amplification of nucleic acid.Second step can comprise described biotin labeled amplification of nucleic acid is exposed to Streptavidin-phycoerythrin.The combination of Streptavidin and biotin can be effectively with the nucleic acid of the described amplification of phycoerythrin label mark.

Can detect described signal by any proper method known in the art.For example, fluorescein-labelled thing can detect by the optical excitation with suitable excitation wavelength, transmits and can detect by several different methods, for example by range estimation, scintillation counting, microscopy, film or digital imagery art, photodetector etc.(for example output or the process in order to follow the trail of described reaction) can be by the quantitative described signal of several different methods known in the art if desired.

Chikungunya and dengue fever sequence can be used in solution to be used to carry out conventional nucleic acid hybridization.Described hybridization can be carried out under stringent hybridization condition or low stringency hybridization condition.The example of stringent hybridization condition has 65 ℃ of 0.1 * SSC (1 * SSC=0.15M NaCl, 0.015M trisodium citrate pH7.0) down.Another embodiment of hybridization conditions is the 48mM phosphate buffer, a kind of probe of 1742.4mM NaCl, 0.24% soil temperature 20,4.8 * step on Ha Teshi solution (Denhardt ' s solution), 2.4nM or multiple probe (for example 3 kinds of probes)---phosphate buffer comprises 12.96mM potassium chloride and 657.6mM sodium chloride.

Use the method for this nucleotide sequence probe in detecting target nucleic acid sequence to be well known in the art, for example be recorded among the Maniatis et al.

Hybridization can be used in the solution or fixing chikungunya and dengue fever sequence and carry out.Chikungunya and dengue fever sequence can be fixed, for example by being attached on the substrate.

Substrate can comprise silicon matrix.Chikungunya and dengue fever sequence can provide with the space conformation of rule, for example with the form of array.Described array can comprise microarray.The method that produces nucleic acid array is well known in the art.

Described array can comprise one or more chikungunyas and the dengue fever sequence of listing among table D1.1, table D1.2, table D2.1 and the table D2.2.Described array can comprise a plurality of these class sequences.Described array can comprise 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61 etc. these class sequences.Described array can comprise one or more control sequence.

Chikungunya can be fixed on the different entities with the dengue fever sequence, perhaps on same entity.

Microballoon

Chikungunya and dengue fever sequence can be fixed in particulate for example on the globule.Chikungunya and dengue fever sequence can be fixed on microballon or the microballoon.This class globule, microballon, microballoon etc. are well known in the art, commercially available acquisition, and the detailed document and hereinafter of being documented in.

Described globule, microballon, microballoon etc. are called " microballoon " for the sake of simplicity at this paper remainder.They can be labeled, and purpose is to make that they can be tracked.The type of labeling method and label is according to character of microballoon etc. and change, but the general principle of describing in its elsewhere of this paper and the document will help the selection of microballoon.

The microballoon that chikungunya and dengue fever sequence can be fixed thereon can comprise any suitable particles of virtually any size.For example, microballoon can comprise agarose beads, polyacrylamide microbead, silica gel globule etc.

Can encode to described microballoon and be used for identifying.Any coding or Mk system can adopt, as long as its feasible decoding and the evaluation that can carry out concrete microballoon.Coding can perhaps utilize other feature by the mode of physical markings, for example features such as optics, physics, chemistry.Mark or coding can comprise color coding.Thereby two kinds of beads in different in any concrete group can pass through color differentiating.Described color coding can by any suitable manner for example laser decode.

Identical or different chikungunyas and dengue fever sequence can be fixed on the beads in different.For example, first sequence can be fixed on first globule, and second sequence can be fixed on second globule, and these two kinds of globules have differentiable feature for example mark or coding.

For example, microballoon can comprise Luminex xMAP microballoon, as describing among the www.luminexcorp.com/technology/index.html.This class microballoon has typical 5.6 microns sizes, comprises that combination dyestuff thereon provides color coding.Can identify single microballoon to the color-coded decoding of microballoon is feasible, therefore can determine the probe type of combination on it.In this way, can know be incorporated into probe or with the type of the nucleotide sequence of probe hybridization.

The Luminex website provides as follows to the description of Luminex xMAP microballoon technology:

" at first, the small pearl that is known as microballoon is color coded to 100 different groups with Luminex.Each globule group pack quilt that is specifically designed to concrete biologicall test, the feasible specific analyte that can catch and detect from sample.In Luminex slimline analyser, the dye inside of each microsphere particles is identified in laser excitation, and any reporting dyes of catching in the mensuration process.Each globule group is produced a lot of readings, further verify these results.By this way, the xMAP technology makes and can also reach 100 times the multiple assay of mensuration separately fast exactly simultaneously in single sample.”

Microballoons etc. comprise that those are used for the microballoon of gel chromatography art, the example gel filter medium.

Example comprises glucosan (Sephadex), the glucosan G-10 of bead size 40-120 μ m (Sigma Aldrich catalog number (Cat.No.) 27 for example, 103-9), the glucosan G-15 of bead size 40-120 μ m (Sigma Aldrich catalog number (Cat.No.) 27,104-7), the glucosan G-25 of bead size 20-50 μ m (Sigma Aldrich catalog number (Cat.No.) 27,106-3), the glucosan G-25 of bead size 20-80 μ m (Sigma Aldrich catalog number (Cat.No.) 27,107-1), the glucosan G-25 of bead size 50-150 μ m (Sigma Aldrich catalog number (Cat.No.) 27,109-8), the glucosan G-25 of bead size 100-300 μ m (Sigma Aldrich catalog number (Cat.No.) 27,110-1), the glucosan G-50 of bead size 20-50 μ m (Sigma Aldrich catalog number (Cat.No.) 27,112-8), the glucosan G-50 of bead size 20-80 μ m (Sigma Aldrich catalog number (Cat.No.) 27,113-6), the glucosan G-50 of bead size 50-150 μ m (Sigma Aldrich catalog number (Cat.No.) 27,114-4), the glucosan G-50 of bead size 100-300 μ m (Sigma Aldrich catalog number (Cat.No.) 27,115-2), the glucosan G-75 of bead size 20-50 μ m (Sigma Aldrich catalog number (Cat.No.) 27,116-0), the glucosan G-75 of bead size 40-120 μ m (Sigma Aldrich catalog number (Cat.No.) 27,117-9), the glucosan G-100 of bead size 20-50 μ m (Sigma Aldrich catalog number (Cat.No.) 27,118-7), the glucosan G-100 of bead size 40-120 μ m (Sigma Aldrich catalog number (Cat.No.) 27,119-5), the glucosan G-150 of bead size 40-120 μ m (Sigma Aldrich catalog number (Cat.No.) 27,121-7) and the glucosan G-200 of bead size 40-120 μ m (Sigma Aldrich catalog number (Cat.No.) 27,123-3).

Can also use agarose beads, the agarose beads of for example in liquid phase chromatography, using.Example has Q-agarose, S-agarose and SP-agarose beads, for example Q agarose XL (catalog number (Cat.No.) 17-5072-01), Q agarose XL (catalog number (Cat.No.) 17-5072-04), Q agarose XL (catalog number (Cat.No.) 17-5072-60), SP agarose XL (catalog number (Cat.No.) 17-5073-01), SP agarose XL (catalog number (Cat.No.) 17-5073-04) and the SP agarose XL (catalog number (Cat.No.) 17-5073-60) etc. of the sale of Amersham Biosciences Europe GmbH (Freiburg, Germany) company.

Chikungunya and dengue fever sequence

289	CHI226U	CTGYCAAATAGCAACAAACCCGGTAA
			290	CHI226L	CATCGAATGCACCGCACACTT

Table D1.1. chikungunya primer

284	DEN1U1	GCATGGGGTAGCAGACTAGTGGTTA
			317	DEN2U2	AGCCTGTAGCTCCACCTGAGAAGGTGTAAAA
316	DEN3U4	ACTGTCAGGCCACCTTAAGCCACAGTA
			307	DEN4U3	GCCAATAATGGGAGGCGTAA
288	DEN-L	GATCTCTGGTCTYTCCCAGCGTCAATA

Table D1.2. dengue fever primer

?293

CHIKV226P

CCCTACGGCGCAGTTCAYCGCTCTTACCGGG

Table D2.1. chikungunya probe

315	DEN1P3	GCTTCCCCTGGTGTTGGGCCCCGCT
			332	DEN2P2	ATCTCACCTTGGGCCCCCRTTGTTGCTGCGA
310	DEN3P2	CGGTTTGCTCAAACCGTGGCTTTGGGGCCT
			299	DEN4P2	CAGCTTCCGTGGCGCATGGCCTCCCTGGG

Table D2.2. dengue fever probe

Table D1.1 can comprise the instantiation that is listed in the chikungunya primer of listing in following (1).Therefore, mentioning that table can comprise during D1.1 mentions and above shows the sequence listed in sequence that D1.1 shows and following (1).

(1) CHIK (CHIKV)

289：CHI226U：(5′-3′)：/5Bio/CTGYCAAATAGCAACAAACCCGGTAA，Y(C/T)

290：CHI226L：(5′-3′)：CATCGAATGCACCGCACACTT

The instantiation of the dengue fever primer of listing in (2) below table D1.2 can comprise.Therefore, mentioning that table can comprise during D1.2 mentions and above shows the sequence listed in sequence shown in the D1.2 and following (2).

(2) dengue fever virus (DENV)

284：DEN1U1：(5′-3′)：/5Bio/GCATGGGGTAGCAGACTAGTGGTTA

317：DEN2U2：(5′-3′)：/5Bio/AGCCTGTAGCTCCACCTGAGAAGGTGTAAAA

316：DEN3U4：(5′-3′)：/5Bio/ACTGTCAGGCCACCTTAAGCCACAGTA

307：DEN4U3：(5′-3′)：/5Bio/GCCAATAATGGGAGGCGTAA

288：DEN-L：(5′-3′)：GATCTCTGGTCTYTCCCAGCGTCAATA，Y(C/T)

Table D2.1 can comprise the instantiation that is listed in the chikungunya probe of listing in following (3).Therefore, mention that table can comprise during D2.1 to mention and above show sequence shown in the D2.1, and the sequence of listing in following (3).

(3) CHIKV probe

293：CHIKV226P：(5′-3′)：/5H2N-C6/CCCTACGGCGCAGTTCAYCGCTCTTACCGGG，Y(C/T)

The instantiation of the dengue fever probe of listing in (4) below table D2.2 can comprise.Therefore, mention that table can comprise during D2.2 to mention and above show sequence shown in the D2.2, and the sequence of listing in following (4).

(4) DENV probe

315：DEN1P3：(5′-3′)：/5H2N-C6-/GCTTCCCCTGGTGTTGGGCCCCGCT

332：DEN2P2：(5′-3′)：/5H2N-C6-/ATCTCACCTTGGGCCCCCRTTGTTGCTGCGA，R(A/G)

310：DEN3P2：(5′-3′)：/5H2N-C6-/CGGTTTGCTCAAACCGTGGCTTTGGGGCCT

299：DEN4P2：(5′-3′)：/5H2N-C6-/CAGCTTCCGTGGCGCATGGCCTCCCTGGG

Chikungunya and dengue fever nucleotide sequence

Chikungunya and dengue fever sequence can comprise polynucleotide.If context allows, term " chikungunya sequence " and " dengue fever sequence " should be used for comprising any concrete sequence disclosed herein, the sequence of for example showing D1.1 or showing to list among the D2.1, the sequence of perhaps showing D1.2 or showing to list among the D2.2, and any variant, fragment, derivant and the homolog of the concrete nucleotide sequence of this class.

Term used herein " polynucleotide ", " nucleotide " and nucleic acid are intended to synonym each other." polynucleotide " typically refer to any polyribonucleotide or polydeoxyribonucleotide, and it can be RNA or the DNA or the modified RNA or the DNA of unmodified." polynucleotide " comprise and are not limited to the RNA that DNA, single stranded RNA, double-stranded RNA, strand and double stranded region that single stranded DNA, double-stranded DNA, strand and double stranded region mix mix, the hybrid molecule that comprises DNA and RNA, described DNA and RNA can be strands, perhaps more generally are mixtures double-stranded or strand and double stranded region.In addition, " polynucleotide " can refer to comprise three sequences of RNA or DNA or RNA and DNA.The term polynucleotide also comprise DNA or the RNA that contains one or more modified bases, and have for stability or other reasons and the DNA or the RNA of the main chain of modifying." modification " base comprises for example tritylation base and uncommon base such as inosine.DNA and RNA have had multiple modification; Therefore, " polynucleotide " comprise the modified forms through chemistry, enzyme or metabolism of the polynucleotide of general natural appearance, also comprise virus and the DNA of cell and the chemical species of RNA feature." polynucleotide " also comprise short relatively polynucleotide, so-called oligonucleotides.

It will be understood by those skilled in the art that a large amount of different polynucleotide and the nucleic acid identical polypeptide of can encoding, this is the result of genetic codon degeneracy.Should understand in addition, those skilled in the art can use routine techniques not influence nucleotide subsitution by polynucleotide encoded polypeptide sequence described herein, to reflect the codon operating position of any concrete host living beings that described polypeptide will be expressed therein.

Chikungunya and dengue fever sequence and variant, fragment, derivant and homolog can comprise DNA or RNA.They can be strand or two strands.They also can be the polynucleotide that wherein contain synthetic nucleotide or modified nucleotide.A large amount of different modifying types to oligonucleotides are well known in the art.These comprise methyl acid phosphateization and D2EHDTPA main chain, described molecule 3 ' end and/or 5 ' end add acridine or poly-D-lysine chain.Purpose for this paper should be understood that polynucleotide can be by any method modification available in this area.Carrying out these modifications is in order to improve polynucleotide interested activity or the lifetime in vivo.

Term " variant ", " homolog " or " derivant " that relates to nucleotide sequence comprises any one (or a plurality of) amino acid replacement, variation, modification to described sequence, substitutes, and adds from any one (or a plurality of) amino acid deletions of described sequence or to any one (or a plurality of) amino acid of described sequence.Can the encode polypeptide of biologically active of described variant, homolog or derivant.

As above-mentioned pointed,, can have at least 50% or 75% with sequence shown in the sequence table of this paper, for example at least 85% or at least 90% homology for sequence homology.Can have at least 95%, for example at least 98% homology.Nucleotide homology relatively can carry out according to above-described.Operable sequence comparison program can comprise above-described GCG Wisconsion Bestfit program.The default matrix of keeping the score has 10 coupling score value to each identical nucleotide, and-9 coupling score value is arranged for each mispairing.To each nucleotide, it is-50 that default room forms point penalty, and it is-3 that point penalty is extended in the room.

The nucleotide sequence that the inventor further describes can be hybridized with sequence mentioned in this article or its any variant, fragment or derivatives selectively, perhaps with above-mentioned any complementary series selective cross.The length of nucleotide sequence can be at least 15 nucleotide, and for example length is at least 20,30,40 or 50 nucleotide.

Term used herein " hybridization " can comprise " process that nucleic acid chains connects by base pairing and complementary strand " and the amplification procedure that carries out in polymerase chain reaction technology.

Can be listed at least 20 with the corresponding nucleotides sequence that this paper occurs usually with the nucleotide sequence of this paper appearance or the polynucleotide of its complementary strand selective cross, for example at least 25 or 30, for example at least 40,60,100 or more a plurality of continuous nucleotides zone on generally should have at least 70%, for example at least 80% or 90%, at least 95% or 98% homology for example.

Term " interfertile " can comprise " alternative hybridization ", promptly target polynucleotide be found can with as the polynucleotide of probe with under the condition of background level hybridization, use described polynucleotide.For example because background hybridization may take place in other polynucleotide that exist in cDNA to be screened or genome dna library.In this incident, background is meant the signal level that interacts and produce between the non-specific DNA in probe and the library, and this signal is lower than 10 times that use the observed specificity interaction strength of target DNA, for example is lower than 100 times.Interaction strength can by radio-labeled for example (for example with ³²The P mark) described probe is measured.

Hybridization conditions is based on the melting temperature (Tm) of nucleic acid in conjunction with complex, this is at Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol 152, Academic Press, San Diego CA) in instruction is arranged, and provide as hereinafter explaining " the strict degree " of definition.

Maximum strict degree generally appears at about Tm-5 ℃ (Tm than probe hangs down 5 ℃); High strict degree is than the low about 5-10 of Tm ℃; In strict degree than the low about 10-20 of Tm ℃; Low about 20-25 ℃ of the low Tm of low strict degree.Those skilled in the art's technology should be understood that maximum strict degree hybridization can be used for identifying or detecting identical polynucleotide sequence, and in (or low) strict degree hybridization can be used for identifying or detecting similar or relevant polynucleotide sequence.

The inventor has described under stringent condition the nucleotide sequence that (for example 65 ℃ and 0.1 * SSC{1 * SSC=0.15M NaCl, 0.015M trisodium citrate pH 7.0) can hybridize to chikungunya disclosed herein and dengue fever nucleic acid, fragment, variant, homolog or derivant.

At polynucleotide is under the situation of two strands, and method and composition described herein comprises separately or two chains of the described two strands of combining form.At polynucleotide is under the situation of strand, is interpreted as also comprising the complementary series of these polynucleotide.

With non-100% homology of chikungunya disclosed herein or dengue fever sequence but the polynucleotide that fall in the disclosure scope can obtain in several ways.Other variants of this sequence can for example obtain in the following manner: survey the DNA library that is made by a series of individualities (individuality that for example comes from different population).For example, chikungunya and dengue fever homolog can be identified individual or other species from other.Reorganization chikungunya in addition and dengue fever sequence variants nucleic acid and polypeptide can produce in the following manner: identify the correspondence position of homolog, and according to describe synthetic of its elsewhere of this paper or produce described molecule.

In addition, can obtain other the virus/bacteriums or the cell homolog of chikungunya and dengue fever sequence, particularly in the mammalian cell (the cell homolog that occurs as rat, mouse, ox and primate cell, and this class homolog or its fragment usually can with chikungunya and dengue fever sequencing nucleic acid selective cross.This class homolog can be used to design chikungunya and dengue fever sequencing nucleic acid, fragment, variant and homolog.May carry out mutagenesis to produce other mutation by method as known in the art.

The sequence of chikungunya and dengue fever sequence homolog can obtain in the following manner: survey cDNA library or genome dna library, described cDNA library or genome dna library make from other animals or for example viral kind of non-animal species, microbial species or fungi kind, under the height stringent condition, survey this class library with all or part of probe of other fragments that comprises any chikungunya and dengue fever sequencing nucleic acid, fragment, variant and homolog or chikungunya and dengue fever sequencing nucleic acid.

Similarly Consideration is applicable to species homolog and the allele variant that obtains polypeptide disclosed herein or nucleotide sequence.

Variant and strain system/species homolog also can use degenerate pcr to obtain, and degenerate pcr is designed for the primer of following sequence in described variant of target and the homolog, the conserved amino acid sequence in promptly described sequential coding chikungunya and the dengue fever sequencing nucleic acid with use.Conserved sequence can be by for example comparing a plurality of variants/homolog amino acid sequence to predict.The sequence contrast can use computer software as known in the art to carry out.For example, GCG Wisconsin PiIeUp program is widely used.

The primer that uses in the degenerate pcr will comprise one or more degeneracys position, and be lower than those in strict degree condition and use under the employed strict degree condition with simple sequence primer cloned sequence from known array.It will be understood by a person skilled in the art that, overall nucleotide homology between the sibship biosome sequence far away may be very low, thereby method selected is a degenerate pcr in these cases, rather than screens the library with the labeled fragment of chikungunya or dengue fever sequence.

In addition, homologous sequence can for example the BLAST component searches nucleotide and/or the Protein Data Bank of program be identified by using searching algorithm.

Perhaps, these class polynucleotide can obtain by the direct mutagenesis to characteristic sequence (for example chikungunya or dengue fever sequencing nucleic acid or its variant, homolog, derivant or fragment).This may be useful under following situation: for example need that sequence is carried out reticent codon and change, to optimize codon preference for the concrete host cell of wherein expressing described nucleotide sequence.May need other sequences to change, purpose is in order to introduce the Restriction Enzyme recognition site or in order to change character or the function by the polypeptide of described polynucleotide encoding.

Polynucleotide described herein can be used for producing for example primer of PCR primer, variable amplified reaction (alternative amplification reaction) of primer; Probe for example passes through to use the probe of radioactively labelled substance or non-radioactive marker's classic method with the show tags substance markers, perhaps described polynucleotide can be cloned on the carrier.The length of this class primer, probe and other fragments should be at least 8,9,10 or 15, and for example at least 20, at least 25,30 or 40 nucleotide for example, and also contained by term used herein " polynucleotide ".

Polynucleotide for example DNA polynucleotide and probe can or can obtain any way by those skilled in the art with recombination method, synthetic method and produce.They can also be cloned by standard technique.

Usually, primer produces by synthesis mode, relates to every next nucleotide and prepares required nucleotide sequence step by step.The technology of using automatic technique to finish this point is easy to obtain in the art.

Longer polynucleotide use recombination form to produce usually, for example use PCR (PCR) clone technology.This relates to preparation and is positioned at the primer of the lipid targeted sequence area flank that needs clone to (as about 15-30 nucleotide), described primer is contacted with the mRNA or the cDNA that obtain from human or animal's cell, under the condition that can increase, carry out the PCR to required zone, the fragment (for example by the described reaction mixture of purifying on Ago-Gel) of separating amplification, and the DNA that reclaims amplification.Described primer can be designed to comprise suitable Restriction Enzyme recognition site, makes the DNA of amplification can be cloned in the suitable cloning vector.

Polynucleotide or primer can carry the show tags thing.Suitable label comprises that radioactive isotope for example ³²P or ³⁵S, enzyme labeling thing or other protein markers such as biotin.This class label can be added in polynucleotide or the primer, and can use known technology to detect.Can be used for test by those skilled in the art through mark or unlabelled polynucleotide or its primer or fragment based on nucleic acid, be used to detect or the human or animal body that checks order in polynucleotide.

This class testing that is used to detect generally includes, and the biological specimen that contains DNA or RNA is contacted under suitable hybridization conditions with the probe that contains polynucleotide or primer, and detects any disome that forms between the nucleic acid in described probe and the sample.This class detection can be used such as the technology of PCR or finish in the following manner: described probe stationary at solid carrier, is removed the nucleic acid that does not hybridize in the sample on the probe, detect the nucleic acid that has hybridized on the described probe then.Perhaps, sample nucleic acid can be fixed on the solid carrier, can detect the amount that is attached to the probe on this class carrier.This or other forms of suitable assay method can see for example WO89/03891 and WO90/13667.

Be used for sequencing nucleic acid for example the test of chikungunya or dengue fever sequencing nucleic acid comprise that the biological specimen that will contain target DNA or RNA contacts under hybridization conditions with the probe that comprises polynucleotide or primer, and determine sequence by for example Sanger dideoxy-chain terminating method (seeing Sambrook et al.).

These class methods generally include, and exist under the suitable reagent situation, by chain elongation primer synthetic and described target DNA or RNA complementation, and optionally stop extension at one or more A, C, G or T/U residue place; Make chain extension and cessation reaction take place; Separate the sequence that selectivity termination nucleotide takes place to measure according to the size of described extension products.Suitable reagent comprises archaeal dna polymerase; Deoxynucleotide dATP, dCTP, dGTP and dTTP; Damping fluid; And ATP.Deoxynucleotide is used to selectivity and stops.

Chikungunya or dengue fever sequence variants peptide sequence can be used as therapeutic agent with the form that arbitrary form for example separates.Term " separation " is meant that sequence is free on natural and described sequence at least basically and connects or naturally occurring at least a other components.On the one hand, described sequence can be the form of purifying.Term " purifying " is meant that sequence is the state that is in relative purifying---for example at least about 90% purity, and the purity at least about 95% or at least about 98% purity.

Detect the method for chikungunya and dengue fever

Said chikungunya of this paper and dengue fever sequence can be used for detecting chikungunya or the dengue fever virus (or its nucleic acid) in the sample.Example is as follows.

Testing process can comprise one two step method.

In first step, increase.In this article, chikungunya and dengue fever nucleic acid can increase by chikungunya primer and dengue fever primer in nucleic acid amplification reaction.Amplified reaction for example can comprise PCR (PCR) for example reverse transcriptase polymerase chain reaction (RT-PCR) or dual RT-PCR.

Can handle to extract nucleic acid, for example mRNA sample.The mRNA reverse transcription can be become cDNA.Use chikungunya and dengue fever sequence as primer, cDNA can increase.Paired primer bond be can use, the forward primer and the reverse primer that are used for concrete genetic mutation for example comprised.The sequence that table D1.1 and table are listed among the D1.2 can be used for the chikungunya and the dengue fever gene order that exist in a large amount of amplified sample.

The nucleic acid of amplification can be carried out mark with detectable label.As indicated above, this can be by realizing with detectable label mark chikungunya nucleic acid primer and dengue fever nucleic acid primer.By this way, amplification step can produce the amplification of nucleic acid through mark.Label can comprise biotin or biotin Streptavidin-phycoerythrin conjugate.

In second step, detect.In this article, from the amplification of nucleic acid of amplified reaction in nucleic acid hybridization reaction with chikungunya nucleic acid probe and dengue fever nucleic acid probe hybridization.

Can detect the nucleic acid of amplification as the solution hybridization of probe by using one or more chikungunyas and dengue fever sequence.The situation that exists that combines between detected chikungunya and dengue fever probe sequence and its target (i.e. Kuo Zeng chikungunya and dengue fever gene or nucleic acid or its part) in hybridization can be used as the indicant that there are situation in chikungunya and dengue fever in the sample.

Therefore, the specificity strain system of chikungunya and dengue fever strain system is detected and can be undertaken by for example detecting combining between concrete chikungunya and dengue fever probe sequence and its target.This can be by for example carrying out independent hybridization, and detect the combination of some probe sequences and other probe sequences not in conjunction with finishing.In addition or in addition, can be in the array that for example space separates with chikungunya and dengue fever sequence probe stationary, to help detecting and distinguish specificity combination to some probe sequence.This class is put nucleic acid, hybridization array and combination detection on array method is well known in the art.On the microballoon stationary probe and to it in conjunction with or the detection of sequence of hybridization also be as known in the art.

Chikungunya and dengue fever probe can be fixed on the encoded microballoon, and feasible evaluation to microballoon can show probe type fixed thereon.Coding can comprise color coding.Therefore, can be fixed on the different microballoons and (microballoon can be encoded) being attached to every kind of nucleic acid probe on the different nucleic acid that all characterize concrete Strain.For example, can use a large amount of dengue fever nucleic acid probes that can be attached on the different dengue fever nucleic acid, every kind of described dengue fever nucleic acid all characterizes a kind of dengue fever strain system.

Described method can comprise, detects detectable label and is attached to fixing chikungunya of microballoon and the amplification of nucleic acid on the dengue fever probe with detection.Moreover, owing to, can identify described microballoon and can show the probe type that is fixed thereon to the detection of coding is feasible with the microballoon coding.Therefore, can obtain being incorporated into the type of the amplifying nucleic acid sequence on the described probe.

Among the embodiment that provides hereinafter, will comprise that in the following manner the detectable of phycoerythrin is incorporated in the nucleic acid of described amplification: biotin labeling chikungunya primer also makes the nucleic acid product of described amplification combine with Streptavidin-phycoerythrin.Then, make described amplification nucleic acid hybridization and be incorporated into the probe that is fixed on the color coding microballoon.

The different probe that will characterize different dengue fever strain systems (and can be attached to from these nucleic acid that homophyletic is) is fixed on the microballoon of encoding with different colours.Make described amplification of nucleic acid and described fixing probe hybridization through mark.

The situation that exists of amplification of nucleic acid is to transmit by laser excitation phycoerythrin and detection to detect.The coding of microballoon is to detect in conjunction with the dyestuff on it (as the part of color coding step) and the type of determined globule by laser excitation.The character that is connected the probe on the microballoon is by determining with reference to concrete microballoon.Can detect there is situation and determines its type of amplification of nucleic acid to the detection of two signals (can be simultaneously or successively).For synchronous detection, two kinds of wavelength that transmit can be different, and correspondingly two kinds of Wavelength of Laser also can be different.

Detect chikungunya and dengue infection

Method described herein can be used for detecting the chikungunya and the dengue infection of individuality.From described individual the sampling originally, and the situation that exists of testing chikungunya and dengue fever nucleic acid according to the description of its elsewhere of this paper.The existence of this class nucleic acid can be determined the existence of virus in the sample, and shows chikungunya and dengue virus infection.The existence that concrete strain is in the sample can show the infection of this strain system.

Should be appreciated that it is not strictly necessary having complete chikungunya and dengue fever virus in the sample.Detecting necessary only is to have detectable (for example can increase) chikungunya and dengue fever nucleic acid in the sample.

Method described herein comprises methods of treatment and prevention method.These class methods comprise detection chikungunya and dengue infection, randomly detect strain system simultaneously.Described method also comprises based on the knowledge that exists situation or concrete strain system to infect that infects, perhaps simultaneously based on aforementioned both select suitable therapy.As known in the art, suitable therapy comprises antivirotic, chikungunya vaccine, dengue vaccine etc.

Use RT-PCR is to chikungunya and dengue fever detects and the exemplary determination method of branch hypotype (subtype)

The inventor has listed the example that detects the determination method of chikungunya and dengue fever in the sample.This example comprises that a step reverse transcription-pcr is measured and detects the dengue fever virus that CHIK and dengue fever serotype are confirmed.

The inventor's mensuration has used gene specific to confirm probe, is special therefore and can produces DEN serotype information.Therefore, control in crucial those countries for case control and disease in the detection to these cause of diseases, this mensuration will have commercial application potential.

Need to prove that this example is nonrestrictive, the additive method that uses sequence disclosed herein to detect chikungunya and dengue fever also is feasible.

A dual one step RT-PCR method

A dual one step RT-PCR method is that (for example Eppendorf Mastercycle-ep-gradient-S (Hamburg, Germany)) go up to use the one step RT-PCR kit (catalog number (Cat.No.) 210210) of QIAGEN containing in the 25 μ l reaction volumes of 5 μ l RNA samples and all above-mentioned seven kinds of primers to carry out at thermal cycler.Biotin labeled PCR product is 40 circulation generations that utilize the cycling condition of manufacturer's recommended and revise (seeing embodiment) a little.

The detection of pathogen and branch hypotype

Then, biotin labeled PCR product is transferred in the hybridization suspension, comprised above-mentioned five kinds of targets-specificity capture probe in the described hybridization suspension, i.e. CHIKV and DENV (DEN1,2,3 and 4)

These probes are covalently bound on one group of concrete color coding microballoon.

DNA hybridization is carried out under stringent condition, and biotin labeled PCR product is caught by the probe of described globule combination, strictly washs subsequently to remove unconjugated PCR product.

Streptavidin-phycoerythrin conjugate be used for fluorescence add to by described microballoon catch through biotin labeled PCR product.

In detecting step, each globule all utilizes a kind of laser and its color coding to identify.Second kind of laser detection dyestuff have a situation, and when detecting this concrete microballoon, produce signal.

This technology is known as the xMAP technology, by Luminex Corporation (TX, USA) exploitation.

Embodiment

Hereinafter the specific embodiments of embodiment 5-7 description comprises RT-PCR Assay Kit to Detect Chikungunya virus (CHIKV) ﹠amp; Dengue Virus (DENV) with DENV Serotype Confirmation by Probe-Beads.This is a kind of RT-PCR Based Detection Kit with Confirmation Pro bes:100 Reactions/Kit, Lot CD-3-6.

Embodiment 1. materials and method

Selection of primers

In inside, the primer of the CHIK virus of Institute of Molecular and Cell Biology (IMCB) and probe are by using IND-63-WB1 strain (Gen Bank registration number EF027140) sequence to select.Select the E1 coding region to be used for primer and probe.

The IMCB primer of DEN virus and probe are to be that D1/SG/06K2290DK1/2006 (EU081281), 2 type strains are D2/SG/05K3295DK1/2005 (EU081177) by using the 1 type strain of sequence D EN virus respectively, and 3 type Singapore strain systems (AY662691) and 4 type strains are that ThD4_0734_00 (AY618993) sequence is selected.Select 5NS to 3 ' NTR coding and non-coding region.

The extraction of viral RNA

All viral RNAs all pass through to use the QIAGEN little extraction reagent kit of QIAamp viral RNA (QIAGEN, Germany) to extract from serum part or viral cultures supernatant according to manufacturer's scheme.RNA from some patients serums is to use EasyMag instrument (bioMerieux, France) extraction automatically.

The viral DNA reference material

The CHIK and the DEN RNA of 10 times of serial dilutions of preparation from the culture of the local clinical separation strain C6/36 and Vero clone, cultivated respectively.

Embodiment 2. is based on the DNA hybridization assays of fluid microballon

5 μ l are transferred to 96 orifice plates that contain 45 μ l hybridization suspension through biotin labeled PCR product, and described hybridization suspension is made up of 40 μ l hybridization solutions (3M TMAC, 0.1%Sarkosyl, 50mM Tris HCl, pH8.0,4mM EDTA) and 5 μ l probe-globule potpourris (microballons of 2000 probe couplings of each target).

Probe-globule potpourri contains five kinds of target specificity capture probes (CHIK, DEN 1,2,3 and 4), and described probe is conjugated on the concrete color coding microballoon.Then, 96 orifice plates being heated to 95 ℃ kept 10 minutes so that the DNA sex change is followed and descended to continue 40 minutes crossover process by target DNA and described specific probe at 60 ℃.By being centrifuged into precipitation, the post-hybridization washing that continues 10 minutes under 54 ℃ is to remove unconjugated PCR product then with described reactant.

Streptavidin-phycoerythrin (SAPE) conjugate be used for fluorescence add to by described microballon catch through biotin labeled PCR product.Then, at Qiagen

(Hilden carries out signal measurement in Germany).Microballon and the laser excitation that is attached to described SAPE on biotin labeling PCR product are produced fluorescence signal, and this makes can classify with quantitative based on the DNA hybridization assays of fluid microballon.

(cutoffvalue) is used to indicate positive reaction with such boundary value, and be promptly high more than 2 times than the background fluorescence that comprises the sample of all components except that target.

The sensitivity of embodiment 3. 1 one step RT-PCRs and measure based on the CHIK of fluid microballon and DEN

The detectability of this mensuration is determined according to PFU.This is to carry out with the kind virus of 10 times of dilutions, and described kind virus has formed by plaque and measured quantitatively.

Depend on serotype, the detection threshold that DEN virus is measured reacts 0.001 to 0.1PFU for each, and the detection threshold of CHIK virus is each reaction 0.025PFU.

The results are shown among Fig. 1.People's (2007) such as DEN result's sensitivity and Lai YL result is suitable.See Fig. 1 (continuing).

The result of embodiment 4. clinical samples

Measure clinical sample with this detection method, and result and the result who obtains with two independent single mensuration are compared.The mensuration based on CHIK-Taqman that is used for CHIK virus is the modification of Pastorino (2005), and the mensuration based on Pan DEN SYBR Green that is used for all 4 kinds of serotype DEN viruses is the modification of Barkham (2006).

Consistent with the result who obtains with single mensuration with this mensuration from the result that clinical sample obtains.They are shown among Fig. 2.

Embodiment 5.RT-PCR chikungunya and dengue fever detection kit-product description

Prepared this kit with the situation that exists, and used the serotype specificity probe of dengue fever virus to come dengue fever virus branch hypotype by an one step RT-PCR (reverse transcriptase polymerase chain reaction) method detection CHIK and dengue fever virus.

This kit comprises four pipe primer mixtures:

1) CHIKV-U: CHIK upstream primer

2) CHIKV-L: CHIK downstream primer

3) DENV-U: dengue fever virus 1,2,3,4 upstream primers

4) DENV-L: dengue fever virus 1,2,3,4 downstream primers

Optimize this primer kit, detect CHIK and dengue fever virus simultaneously in the reaction volume design of 25 μ l, to use 5 μ l viral RNA samples to utilize a multiple one step RT-PCR to measure.

Agarose gel electrophoresis by using bromination second pyridine dyeing and/or be used for that serotype analyzes

Detection platform obtains the result.

Recommendation is with Qiagen One Step RT-PCR Kit[catalog number (Cat.No.) 210210 or 210212] and this kit use together.

Embodiment 6.RT-PCR chikungunya and dengue fever detection kit-component

1. primer pipe.CHIKV-U CHIKV-L DENV-U DENV-L sees Fig. 1.Condition of storage (short-term, long-term): 4 ℃ ,-20 ℃.

2.Luminex detection kit

-hybridization buffer, 8ml

-probe-globule potpourri, 500ul (5ul/rxn)

-lavation buffer solution, 30ml

-Streptavidin, R-phycoerythrin conjugate solution (SA-PA)

Please all reagent preservation under 4 ℃ always that Luminex detects will be used for.

Embodiment 7.RT-PCR chikungunya and dengue fever detection kit-scheme, an one step RT-PCR

1. main potpourri preparation

In not containing the thin-walled PCR pipe (0.5ml) of RNase, every pipe adds following reagent/every reaction.Recommendation is with Qiagen One Step RT-PCR Kit[catalog number (Cat.No.) 210210 or 210212] and this kit use together.

1) adds tRNA here as required to avoid non-specific PCR product.The final concentration of tRNA in the reaction mixture is 50ng/rxn.

2) internal contrast (IC) RNA molecule is by the primer amplification that comprises in this kit, to produce the amplicon (amplicon) of 100bp.End-product is detected by EtBr Ago-Gel or the gene-specific probe that is conjugated on the Luminex globule (be included in).

* must comprise positive and negative control is verified the result.

2. thermal cycle conditions

Detect

Fig. 2 shows the process flow diagram of detection scheme.

Step 1: sample preparation

Contain mixing 5 μ l samples in the hole of porous titer plate, 40 μ l hybridization buffers (1 * TMAC) (1) and 5 μ l globule potpourris (every probe contains 2000 globules) (2) from PCR (3).Seal with Parafilm.Not rotation.

The sex change of step 2:DNA and hybridization

Use well heater such as ABI GeneAmp9700, under 95 ℃, hatched 10 minutes, under 60 ℃, hatched 40 minutes then.

At room temperature centrifugal 5 minutes with 1000G.By flicking twice, and on paper, rap twice and remove supernatant.

Step 3: post-hybridization washing (repeating 2 times)

Under temperature T, wash 10 minutes (for CHIKV and DENV detection kit, T=54 ℃) with 100 μ l lavation buffer solution-PBS, 0.01% soil temperature 20.Centrifugal 10 minutes.Remove supernatant.

Step 4: signal produces

The 1/500SA-AP that adds 70 μ l in lavation buffer solution-PBS, 0.01% soil temperature 20; Under 52 ℃, hatched 5 minutes.

Step 5: signal measurement

Read by Luminex

Each confirms that probe uses following globule number.

CHIKV：29、DEN1：88、DEN2：89、DEN3：90、DEN4：72

List of references

1.Lai，Y.L.，Y.K.Chung，et?al.(2007).″Cost-effective?real-time?reverse?transcriptase?PCR(RT-PCR)to?screen?for?Dengue?virus?followed?by?rapid?single-tube?multiplex?RT-PCR?for?serotyping?of?the?virus.″J?Clin?Microbiol?45(3)：935-41.

2.Dash，P.K.，M.Parida，et?al.(2008).″Development?and?evaluation?of?a?1-step?duplex?reverse?transcription?polymerase?chain?reaction?for?differential?diagnosis?of?chikungunya?and?dengue?infection.″Diagn?Microbiol?Infect?Dis?Available?online?25?June?2008.

Barkham，T.M.，Y.K.Chung，et?al.(2006).″The?performance?of?RT-PCR?compared?with?a?rapid?serological?assay?for?acute?dengue?fever?in?a?diagnostic?laboratory.″ Trans?R?Soc? Trop?Med?Hyg?100(2)：142-8.

Pastorino，B.，M.Bessaud，et?al.(2005).″Development?ofa?TaqMan?RT-PCR?assay?without?RNA?extraction?step?for?the?detection?and?quantification?of?A?frican?Chikungunya?viruses.″ J?Virol?Methods?124(1-2)：65-71.

Apply for and patent for every piece that mentions in the present specification, quote in above-mentioned every piece of application and the patent or every piece of file (comprising (" file that application is quoted ") in every piece of application and the patent examination process) of reference, and in every piece of application and patent and in any file that application is quoted, quote or any manufacturers instruction or the catalogue of any products mentioned, include this paper in view of the above by reference in.Moreover, quote in the file that the All Files of quoting herein, this paper are quoted or the All Files of reference, and this paper quotes or any manufacturers instruction or the catalogue of any products mentioned, includes this paper in view of the above by reference in.

Only otherwise depart from the scope and spirit of the present invention, the numerous modifications and variations of the method for the invention and system will be conspicuous for a person skilled in the art.Though the present invention describes in conjunction with concrete embodiment preferred, should understand invention required for protection and should be confined to this specific embodiment inadequately.In fact, be used to realize that to described the multiple modification of pattern of the present invention is intended to be included in the scope of claim, described modification is conspicuous concerning molecular biology or those skilled in the relevant art.

Claims (17)

1. the chikungunya in the detection of biological sample and the method for dengue fever nucleic acid, described method comprises step:

(a) amplification step, wherein by chikungunya primer and dengue fever primer chikungunya and dengue fever nucleic acid are increased in nucleic acid amplification reaction, described nucleic acid amplification reaction comprises that for example PCR (PCR) is as reverse transcriptase polymerase chain reaction (RT-PCR) or double RT-PCR; With

(b) detect step, wherein the amplification of nucleic acid in (a) in nucleic acid hybridization reaction with chikungunya nucleic acid probe and dengue fever nucleic acid probe hybridization, preferred wherein said amplification of nucleic acid with can with a plurality of dengue fever nucleic acid probe hybridizations of different dengue fever nucleic acid combination, each of described different dengue fever nucleic acid all characterizes dengue fever strain system, with the nucleic acid of concrete dengue fever strain system in can the identification of organism sample.

2. the process of claim 1 wherein described chikungunya and dengue fever probe stationary on the microballoon of coding, feasible evaluation to microballoon can show probe type fixed thereon, and the microballoon of preferred wherein said coding comprises color-coded microballoon.

3. claim 1 or 2 method, the nucleic acid of wherein said amplification is by the detectable label substance markers, preferably by come mark chikungunya nucleic acid primer and dengue fever nucleic acid primer with detectable, make amplification step (a) generate amplification of nucleic acid through mark, described detectable preferably includes biotin or biotin Streptavidin-phycoerythrin conjugate, or therein.

4. claim 1,2 or 3 each methods, wherein said method comprises, detect detectable and be bonded to fixing chikungunya of microballoon and the amplification of nucleic acid on the dengue fever probe with detection, described method preferably also comprises identifies that microballoon is to identify probe fixed thereon and therefore to identify the type of the amplification of nucleic acid of combination.

5. each method of aforementioned right, comprising the detectable of biotin Streptavidin-phycoerythrin conjugate by first laser detection, the type of described color coding microballoon is by second laser determination of different wave length, and the evaluation of the detection of preferred wherein said detectable and described color coding microballoon is carried out synchronously.

6. each method of aforementioned claim, wherein:

(a) described chikungunya nucleic acid primer is made up of the nucleotide sequence shown in the table D1.1, and perhaps wherein said dengue fever nucleic acid primer is made up of the nucleotide sequence shown in the table D1.2, and perhaps above condition satisfies simultaneously; Perhaps

(b) described chikungunya nucleic acid probe is made up of the nucleotide sequence shown in the table D2.1, and perhaps described dengue fever nucleic acid probe is made up of the nucleotide sequence shown in the table D2.2, and perhaps above condition satisfies simultaneously.

7. each method of aforementioned right is used for the strain system that has situation and definite dengue fever of the chikungunya of detection of biological sample simultaneously.

8. show nucleotide sequence or its variant, homolog, derivant or the fragment shown in D1.1, table D1.2, table D2.1 or the D2.2.

9. bond, the combination of two or more sequences that described bond is a claim 15, preferably comprise two or more sequences of listing among table D1.1 and the table D1.2, two or more sequences of perhaps showing D2.1 and showing to list among the D2.2, perhaps above two kinds of situations occur simultaneously.

10. the bond of claim 9, wherein said bond composed as follows:

(a) each nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D1.1 and the table D1.2;

(b) each nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D2.1 and the table D2.2; Or

(c) by above (a) and the bond (b) formed.

11. claim 8,9 or 10 nucleic acid or bond comprise the nucleic acid through mark, wherein said label comprises biological example element or biotin Streptavidin-phycoerythrin conjugate.

12. each nucleic acid or bond of claim 8-11 comprises fixing nucleic acid, preferred wherein said nucleic acid is fixed in microballoon or array for example on the microarray.

13. a bond is composed as follows: (a) each nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D1.1 and the table D1.2; (b) each nucleotide sequence or its variant, homolog, derivant or the fragment shown in table D2.1 and the table D2.2; Wherein the nucleic acid of (a) is in solution, and nucleic acid (b) is fixed on the microballoon.

14. a kit that is used for detecting patient's chikungunya disease or dengue fever, described kit comprise each nucleic acid or bond of claim 8-13, and operation instructions.

15. each nucleotide sequence or bond be as the purposes of the nucleic acid amplification primer of chikungunya or dengue fever gene among the claim 8-14, or as the purposes of the dna hybrid probe of chikungunya or dengue fever gene.

16. a method of diagnosing chikungunya disease in the individuality or dengue fever, described method comprise from the described individual biological specimen that obtains, and detects wherein chikungunya and dengue fever nucleic acid by each method among the claim 1-7.

Detect chikungunya disease in the individuality and dengue fever and give suitable treatment or prevention 17. the method for chikungunya disease and dengue fever in treatment or the prevention individuality, described method comprise according to claim 16 described individuality.

Images