CN102212618A - Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application - Google Patents
Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application Download PDFInfo
- Publication number
- CN102212618A CN102212618A CN2011101321788A CN201110132178A CN102212618A CN 102212618 A CN102212618 A CN 102212618A CN 2011101321788 A CN2011101321788 A CN 2011101321788A CN 201110132178 A CN201110132178 A CN 201110132178A CN 102212618 A CN102212618 A CN 102212618A
- Authority
- CN
- China
- Prior art keywords
- group
- vibrio cholerae
- standard substance
- vibrio
- shigellae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit composed of a quantitative PCR reaction solution, a salmonella standard product, a shigella standard product, a vibrio cholera O1 group standard product, a vibrio cholera O139 group standard product, a comparison product and a kit body. The kit body is provided with container holes for respectively placing a quantitative PCR reaction solution tube, a salmonella standard product tube, a shigella standard product tube, a vibrio cholera O1 group standard product tube, a vibrio cholera O139 group standard product tube, a positive comparison product tube and a negative comparison product tube. The fluorescence quantitative PCR reaction solution contains a PCR reaction buffer solution, specific primers of four kinds of bacteria and four fluorescent probes. By means of the method disclosed by the invention, four kinds of bacteria including salmonella, shigella, vibrio cholera O1 group and vibrio cholera O139 group can be simultaneously detected from a sample through a PCR reaction by using the specific primers of the four kinds of bacteria and the specific fluorescent probes. The method disclosed by the invention is simple, convenient, rapid and accurate in operation. Furthermore, real-time and accurate and quantitation is realized.
Description
Technical field
The invention belongs to biological technical field, relate to quantitative PCR detection kit, be specifically related to a kind of quadruple (four kinds of probes) real-time fluorescence quantitative PCR detection kit, Salmonellas, Shigellae, vibrio cholerae 01 and 0139 group of nucleic acid in the ight soil, vomitus sample of gastro-enteritis diarrhea patient be can in same reaction tubes, detect simultaneously, Salmonellas, Shigellae, vibrio cholerae 01 and 0139 group of emergent detection in the laboratory that causes to break out epidemic situation can be applicable to.
Background technology
It is popular wide for the enteric infection cause of disease, the sickness rate height, and become the important diseases of harm people's health.According to World Health Organization's statistics, the whole world has 1,000,000,000 people to suffer from diarrhoea every year, and wherein 500,000,000 people occur in the third world, causes annual 500 ten thousand children's's death.The enteric infection disease pathogen is numerous, comprises virus, bacterium, fungi, protozoon etc., but domestic report occupies the majority with bacillary and viral diarrhea.The pathogenic agent that causes bacterial diarrhea comprises that mainly Salmonellas, Shigellae, vibrio cholerae, diarrheagenic E. coli, campylobacter jejuni, yersinia entero-colitica, Aeromonas hydrophila, Plesiomonas shigelloides and other cause rushing down property vibrios, and wherein Salmonellas, Shigellae and three kinds of pathogenic bacterias harm of vibrio cholerae are maximum.
Salmonella (
Salmonella) be the former bacterium of a kind of common, important Amphixenosis, can not only cause Animal diseases such as white dysentery, necrotic enteritis, miscarriage, can also make human typhoid fever, paratyphoid, septicemia, gastro-enteritis and the food poisoning of taking place.In food poisoning all over the world, salmonellal poisoning case accounts for the first place.Typhoid fever, paratyphoid then are the Category B notifiable disease of " People's Republic of China's law on the prevention and control of infectious diseases " regulation, and its infectivity is strong, the course of disease long, easily recur, complication is many, the disease burden is heavier.According to the report of the World Health Organization, since 1985, worldwide, significantly increased by the salmonellal human number of patients of having made a definite diagnosis, increased more than five times in some European countries.In China hinterland, rank first repeatly by salmonellal food poisoning.
Shigellae (
Shigella) be the pathogenic bacterium of bacillary dysentery (abbreviation bacillary dysentery).Bacillary dysentery is a kind of acute infectious intestinal disease, also is the Category B notifiable disease of " People's Republic of China's law on the prevention and control of infectious diseases " regulation.Main clinical manifestation is heating, stomachache, diarrhoea, tenesmus, sanguinopurulent stool, with heating.During the toxic type acute attack, high heat can occur and the septic shock symptom occur, occur cerebral edema and respiratory insufficiency sometimes.Patient and carrier are the main contagium of bacillary dysentery, and the route of transmission is mainly fecal-oral transmission, and the crowd is to the general susceptible of bacillary dysentery, after being ill the immunizing power time length shorter, do not have cross immunity between the different type bacterial strains, also may infect once more in the short period of time.This disease is throughout the year distributes, and the autumn in summer sees more, is one of frequently-occurring disease of China.
Vibrio cholerae (
Vibrio cholerae) be the pathogenic bacteria of cholera.Cholera is popular at least thousand in the South Asia region.Since 1817, seven worlds took place and were very popular in cholera.Someone thinks, present eight pandemic high-risk phases of Shang Zaidi.Cholera is that what to be caught people's attention is the deadly infectious disease of cardinal symptom with diarrhoea, its propagate fast, morbidity is anxious, involve that scope is wide, case fatality rate is high, is listed in category A infectious disease in China.Vibrio cholerae can be divided into 0l serogroups, 0139 serogroups and non-0l, non-0139 serogroups according to 0 antigenic specificity, thinks at present and has only the above two can cause that cholera is popular.
In view of comprising that salmonella, Shigellae and the vibrio cholerae importance in public health grows with each passing day, thereby in gastro-enteritis and food poisoning monitoring, to carry out the detection of multiple diarrhoea bacterium, waste time and energy and waste clinical samples and reagent.Conventional sense is based on traditional cultural method, not only complex operation, length consuming time but also pollute easily.
Along with the develop rapidly of Protocols in Molecular Biology and the widespread use in medical research thereof, the fluorescent quantitative PCR technique that rises recent years particularly, this method has characteristics such as accuracy height, favorable reproducibility, has been widely used in numerous areas such as gene expression research, pathogen detection, snp analysis and gene type.This method adopts complete stopped pipe to detect, and has saved the product postprocessing to PCR, has avoided crossed contamination, and result's judgement is finished by computer, has simplified operation steps, and has strengthened result's reliability.Development along with fluorescent quantitation technology, instrument and Materials science, the fluorescent quantitation technology is its advantage of performance on quantitatively not only, and different fluorescence dye (FAM, HEX etc.) technology can be carried out aspect researchs such as gene type, detection in Gene Mutation and snp analysis on the 5` end mark of utilization TaqMan or TaqMan-MGB probe.Therefore, set up about the multiple fluorescence quantitative PCR of salmonella, Shigellae, vibrio cholerae 01 group and 0139 group fast, accurately, sensitive, special gene diagnosis molecular biology method and diagnostic kit be particularly important.
Summary of the invention
The object of the invention provides a kind of quadruple fluorescent quantificationally PCR detecting kit, form by quantitative PCR reaction solution, Salmonellas standard substance, Shigellae standard substance, vibrio cholerae 01 group standard substance, vibrio cholerae 01 39 groups of standard substance, reference substance, box bodys, box body is provided with container hole, places quantitative PCR reaction solution, Salmonellas standard substance, Shigellae standard substance, vibrio cholerae 01 group standard substance, 39 groups of standard substance of vibrio cholerae 01, positive reference substance, negative control product respectively.
Wherein the PCR reaction buffer contains the Auele Specific Primer pipe (the upstream and downstream primer is with the pipe dress) of magnesium chloride and triphosphate deoxyribose nucleotide mixture, heat-resisting Taq archaeal dna polymerase, four kinds of bacteriums, corresponding four kinds of fluorescent probe pipes.
It is as follows that fluorescence quantitative PCR detection is used upstream primer and downstream primer and corresponding specific probe sequence in the described test kit:
Upstream primer salmonella-F:5 '-TGTCACCGTGGTCCAGTTTAT-3 '
Downstream primer salmonella-R:5 '-TGTTTACCGGGCATACCATCCAGA-3 '
Specific probe salmonella-P:5 '-FAM-AAAGGTTCAGAACGCGTCGCGGAAGTCGCG-BHQ1-3 '
Upstream primer shigella-F:5 '-TTTCGATAATGATACCGGCGCTCTGC-3 '
Downstream primer shigella-R:5 '-TGACTTTATCCCGGGCAATGTCCTC-3 '
Specific probe shigella-P:5 '-HEX-TCCCTGGGCAGGGAAATGTTCCGCCTCGAABHQ1-3 '
Upstream primer 01 group cholera vibrio-FP:5 '-AAACTCAAAATTCGGAAGTAAGG-3 '
Downstream primer 01 group cholera vibrio-RP:5 '-CCATTAATATCCTGCGTTGCTTTA-3 '
Specific probe 01 group cholera vibrio-P:5 '-ROX-TTATTCATCCATTATCATCCGCTGAACA-BHQ2-3 '
Upstream primer 0139 group cholera vibrio-FP:5 '-GTTATAAAGATGCCGAAGACTAT-3 '
Downstream primer 0139 group cholera vibrio-RP:5 '-CAGCTACACGTGATATACTCTCTTG-3 '
Specific probe 0139 group cholera vibrio-P:5 '-CY5-CTAATGTTCCTGAAATATTGTTGCGTTATAGG-BHQ3-3 '
Standard substance comprise Salmonellas, Shigellae, vibrio cholerae 01 group and 39 groups of standard substance of vibrio cholerae 01 in the described test kit, and its sequence is as follows:
Salmonellas standard substance sequence is:
ATAGCCTGGC?GGTGGGTTTT?GTTGTCTTCT?CTATTGTCAC?CGTGGTCCAG?TTTATCGTTA TTACCAAAGG?TTCAGAACGC?GTCGCGGAAG? TCGCGGCCCG?ATTTTCTCTG?GATGGTATGC?CCGGTAAACA?GATGAGTATT?GATGCCGATT?TGAAGGCCGG TATTATTGAT GCGGATGC
Shigellae standard substance sequence is:
AAAACCCTCC?TGGTCCATCA?GGCATCAGAA?GGCCTTTTCG?ATAATGATAC?CGGCGCTCTG?CTCTCCCTGG?GCAGGGAAAT?GTTCCGCCTC?GAAATTCTGG?AGGACATTGC CCGGGATAAA GTCAGAACTC TCCATTTTGT GG
Vibrio cholerae 01 group standard substance sequence is:
TTGATGAGAT?TTTTAACATA?ATAAACTCAA?AATTCGGAAG?TAAGGCATAT?TTTATTCATC CATTATCATC CGCTGAACAT CCTGAGTTTA ATAAAGCAAC?GCAGGATATT AATGGGAATA TCTGTTTTAA ATATGTATC
39 groups of standard substance sequences of vibrio cholerae 01 are:
AAATATAAAA?TTAATTATGA?TTTAGGTTAT?AAAGATGCCG?AAGACTATAA?ATTTTGGGTC?GATTTTTCAA?AATATACACT?TTTTTCTAAT?GTTCCTGAAA?TATTGTTGCG?TTATAGGTAT?CATCAAGAGA?GTATATCACG?TGTAGCTGAT?AATAAAGAAA ATAA
Negative control is a DEPC(diethylpyrocarbonate behind the high pressure of autoclave sterilization) treating water, positive control is the positive plasmid sample of 39 groups of Salmonellas, Shigellae, vibrio cholerae 01 group and vibrio cholerae 01s.
Quantification kit provided by the invention is stored in-20 ℃, reduces multigelation as far as possible.
Another object of the present invention provides the application of described a kind of quadruple fluorescent quantificationally PCR detecting kit in detecting 39 groups of Salmonellas, Shigellae, vibrio cholerae 01 group and vibrio cholerae 01s.
The using method of test kit of the present invention:
Each detection all should be set up positive control and negative control.Standard substance are 1 * 10 with the aseptic deionized water dilution
2-1 * 10
7Copy/ml.
The faecal samples nucleic acid DNA extracts:Get 0.2 gram or 200ul fecal sample and be added in the EP pipe, adopt QIAamp DNA Stool Mini Kit or other test kit of German QIAGEN company, extract according to the test kit specification sheets, getting the extractive testing sample nucleic acid DNA of 2ul is template.
The detection of nucleic acid:Getting the extractive testing sample nucleic acid DNA of 2ul is template, and the PCR damping fluid is a single stage method PCR damping fluid, its final concentration is 1 * and, be meant that the final concentration of each component of damping fluid in reaction system is identical with each component concentrations in 1 * PCR damping fluid.Usually adopt 2 * PCR damping fluid of reaction system 1/2 volume.The composition of 1 * PCR Master Mix damping fluid is numbered Code:HR-RT01-50 referring to the qPCR Master Mix of the farsighted bio tech ltd of Shanghai brightness.
The reaction cumulative volume is 50 ml, 2 * qPCR Master Mix, 25 ml wherein, and each 1ml of four kinds of primers (20 μ mol/L), four kinds of probes (20 μ mol/L), 1 ml, template DNA 2-3ml, DEPC water is supplied 50 ml.Detect on four look quantitative real time PCR Instruments, reaction parameter is: 95 ℃ of 10min warm starts, and 95 ℃ of 10s then, 55 ℃ of 45s carry out the quadruple fluoroscopic examination at 55 ℃, carry out 40 circulations altogether.
Fluorescent quantitation result report:1. Salmonellas, Shigellae, 39 groups of probes of vibrio cholerae 01 group and vibrio cholerae 01 are CT value (threshold cycle separately, the cycle number that fluorescent signal in each reaction tubes is experienced when reaching the thresholding of setting) it is negative to be equal to 40.0 sample, 2. Salmonellas, Shigellae, the sample of 39 groups of each probe CT value≤35 of vibrio cholerae 01 group and vibrio cholerae 01, detected result is corresponding positive for bacteria, then testing sample contains Salmonellas, Shigellae, 39 groups of vibrio cholerae 01 group and vibrio cholerae 01s, the fluoroscopic examination result occurs as one of them and be positive, contain the target bacteria of positive fluorescence correspondence in the sample then to be checked.3. the CT value is ash value zone between 35～40, and the back of reforming is negative greater than 37 values.According to the typical curve that is obtained, calculate sample to be measured and respectively remove from office blue positive and negative bacterium value (copy number/ml).
Usefulness of the present invention is: utilization real-time fluorescence quantitative PCR technology, adopt four kinds of bacteriums (39 groups of Salmonellas, Shigellae, vibrio cholerae 01 group and vibrio cholerae 01s) special primer and specific fluorescence probe, develop and be used for Salmonellas, Shigellae, vibrio cholerae 01 group and 39 groups of bacterium quadruples of vibrio cholerae 01 fluorescence quantitative detection kit.This invention is by a PCR reaction, can from sample, detect the existence of Salmonellas, Shigellae, vibrio cholerae 01 group and 39 groups of bacteriums of vibrio cholerae 01, easier than traditional regular-PCR and substance fluorescence quantifying PCR method, quick and accurate, and the bacterium that detects is carried out accurately quantitative in real time.Test kit provided by the invention can be distinguished the titre quantity levels of infectation of bacteria and infection, for the detection of infectation of bacteria provides fast and convenient instrument.Thereby be to realize clinical early diagnosis and in time formulate treatment plan, minimizing mortality ratio and sequela becoming possibility.
Description of drawings
Fig. 1 is the test kit structural representation.
Fig. 2 is that four samples mix the example that carries out quadruple PCR detection simultaneously.
Fig. 3 detects the sensitivity of Salmonellas for the fluorescent PCR method; From 1 to 7 (from left to right) be followed successively by 100000000,10000000,1000000,100000,10000,1000,100copy.
Fig. 4 is a Salmonellas standard substance quantitative fluorescent PCR typical curve.
Fig. 5 is that the fluorescent PCR method detects the sensitivity of Shigellae, from 1 to 6(from left to right) be followed successively by 10000000,1000000,100000,10000,1000,100copy.
Fig. 6 is a Shigellae standard substance quantitative fluorescent PCR typical curve.
Fig. 7 detects vibrio cholerae 01 group's sensitivity for the fluorescent PCR method; From 1 to 6 (from left to right) be followed successively by 10000000,1000000,100000,10000,1000,100copy.
Fig. 8 vibrio cholerae 01 group standard substance quantitative fluorescent PCR typical curve.
Fig. 9 detects the sensitivity of 39 groups of vibrio cholerae 01s for the fluorescent PCR method; From 1 to 6 (from left to right) be followed successively by 10000000,1000000,100000,10000,1000,100copy.
39 groups of standard substance quantitative fluorescent PCRs of Figure 10 vibrio cholerae 01 typical curve.
Embodiment
Below in conjunction with the drawings and specific embodiments the present invention is further specified, but protection scope of the present invention is not limited in this.
Referring to Fig. 1, a kind of quadruple real-time fluorescence quantitative PCR detection kit, by quantitative PCR reaction solution 1, Salmonellas standard substance 2, Shigellae standard substance 3, vibrio cholerae 01 group standard substance 4,39 groups of standard substance 5 of vibrio cholerae 01, positive reference substance 6, negative control product 7, box body 8 is formed, box body 8 is provided with container hole, place quantitative PCR reaction 1 respectively, Salmonellas standard substance 2, Shigellae standard substance 3, vibrio cholerae 01 standard substance 4,39 groups of gene standard substance 5 of vibrio cholerae 01, positive reference substance 6 and negative control product 7, wherein quantitative PCR reaction solution single tube packing, arranged, fluorescence quantitative PCR reaction solution contain the PCR reaction buffer and (contain magnesium chloride and triphosphate deoxyribose nucleotide mixture, heat-resisting Taq archaeal dna polymerases etc.) 4 pipes (are labeled as
), the Auele Specific Primer of four kinds of bacteriums (the upstream and downstream primer is with the pipe dress) is that 4 pipes (are labeled as
), corresponding four kinds of fluorescent probes be 4 the pipe (be labeled as
).
1 materials and methods
1.1 bacterial strain and clinical samples:
The positive nucleic acid (all identifying by gene sequencing) of Salmonellas, Shigellae, vibrio cholerae 01 and 0139 group derives from Zhejiang University Medical College The First Affiliated Hospital.Clinical sample derives from patient's stool sample, and band ice is transported to the laboratory after the sample collection.
1.2 primer and probe
Salmonellas all over the world, Shigellae, vibrio cholerae 01 and 39 groups of gene orders of vibrio cholerae 01 have been downloaded from the NCBI gene pool of the U.S..It has been carried out homology relatively, and at the conservative gene district of corresponding bacterial genomes design Auele Specific Primer and Taqman probe, sequence is as follows:
Upstream primer salmonella-F:5 '-TGTCACCGTGGTCCAGTTTAT-3 '
Downstream primer salmonella-R:5 '-TGTTTACCGGGCATACCATCCAGA-3 '
Specific probe salmonella-P:5 '
-FAM-AAAGGTTCAGAACGCGTCGCGGAAGTCGCG-
BHQ1-3 '
Upstream primer shigella-F:5 '-TTTCGATAATGATACCGGCGCTCTGC-3 '
Downstream primer shigella-R:5 '-TGACTTTATCCCGGGCAATGTCCTC-3 '
Specific probe shigella-P:5 '-
HEX-TCCCTGGGCAGGGAAATGTTCCGCCTCGAA-
BHQ1-3 '
Upstream primer 01 group cholera vibrio-FP:5 '-AAACTCAAAATTCGGAAGTAAGG-3 '
Downstream primer 01 group cholera vibrio-RP:5 '-CCATTAATATCCTGCGTTGCTTTA-3 '
Specific probe 01 group cholera vibrio-P:5 '-
ROX-TTATTCATCCATTATCATCCGCTGAACA-
BHQ2-3 '
Upstream primer 0139 group cholera vibrio-FP:5 '-GTTATAAAGATGCCGAAGACTAT-3 '
Downstream primer 0139 group cholera vibrio-RP:5 '-CAGCTACACGTGATATACTCTCTTG-3 '
Specific probe 0139 group cholera vibrio-P:5 '
-CY5-CTAATGTTCCTGAAATATTGTTGCGTTATAGG
-BHQ3-3 '
Primer and probe entrust brightness farsighted bio tech ltd in Shanghai synthetic.
1.3 the extraction of DNA of bacteria quantitative criterion and DNA of bacteria:
The QIAamp DNA Mini Kit of German QIAGEN company is adopted in the extraction of DNA of bacteria, pressing the test kit specification sheets extracts, obtain DNA of bacteria (102ng/ μ L), utilize the concentration of NanoDrop ND-1000 Spectrophotometer, thereby the copy number of definite DNA is with standby in 260nm measurement DNA of bacteria.
1.4 the optimization of fluorescent PCR reaction system and condition:
Test kit: the qPCR Master Mix that selects the farsighted bio tech ltd of Shanghai brightness for use; Code:HR-RT01-50; the by specification operation; the reaction cumulative volume is 50 ml; 2 * qPCR Master Mix, 25 ml wherein, each 1ml of four kinds of primers (20 μ mol/L), four kinds of probes (20 μ mol/L), 1 ml; template DNA 2-3ml, DEPC water is supplied 50 ml.Reaction conditions is 95 ℃ of 10min warm starts, 95 ℃ of 10s then, 55 ℃ of 45s, carry out the quadruple fluoroscopic examination at 55 ℃, carry out 40 circulations altogether, the result judges: select fluoroscopic examination model F AM, HEX, ROX, CY5 fluorescence baseline adjustment is got 3-15 round-robin fluorescent signal mean value, threshold setting is with the vertex of threshold line just above normal negative control product, and sample is typical amplification curve, is judged as the positive.Do not have typical amplification curve, be judged as feminine gender.The optimization Test of system, be in the reaction system of template with the positive nucleic acid of same concentrations, primer concentration is from 0.10～1.00 μ M, concentration and probe concentration is from 0.10～0.50 μ M, adopt the optimum concn of preferred primer of matrix method and probe, according to minimum Ct value and high fluorescent increased value (Δ Rn) best primer of selection and concentration and probe concentration.
1.5 fluorescent PCR specificity, susceptibility and replica test
Select the positive DNA(of 39 groups of Salmonellas, Shigellae, vibrio cholerae 01 and vibrio cholerae 01s all to identify by gene sequencing) and derive from the clinical stool sample that comes from recent Zhejiang Province diarrhea patient in the recent period, above-mentioned clinical sample is extracted nucleic acid, detect the specificity of verification method with Salmonellas, Shigellae, vibrio cholerae 01 and 0139 group of multiple fluorescence PCR method; To demarcating the Salmonellas (2 * 10 of copy number (Copies/ml)
8Copies/ml), Shigellae (2 * 10
8Copies/ml), the vibrio cholerae 01 group (2 * 10
8Copies/ml) and 39 groups (2 * 10 of vibrio cholerae 01s
8Copies/ml) respectively after the dilution, parallelly carry out fluorescent PCR reaction, relatively its sensitivity.In addition, the DNA of bacteria diluent of each concentration is made 5 duplicate detection, the Ct value base of calculation that obtains is poor, the repeatability of verification method.
2 results
2.1 fluorescent PCR reaction system and condition
Select the qPCR Master Mix of the farsighted bio tech ltd of Shanghai brightness for use; Code:HR-RT01-50; the by specification operation; the reaction cumulative volume is 50 ml; 2 * qPCR Master Mix, 25 ml wherein, each 1ml of four kinds of primers (20 μ mol/L), four kinds of probes (20 μ mol/L), 1 ml; template DNA 2-3ml, DEPC water is supplied 50 ml.Detect with Biorad CF96 fluorescence detecting system, reaction parameter is: 95 ℃ of pre-sex change of 10min, and 95 ℃ of 10s then, 55 ℃ of 45s carry out the quadruple fluoroscopic examination at 55 ℃, carry out 40 circulations altogether, can obtain minimum Ct value and high fluorescent.
2.2 specificity test
The multiple fluorescence PCR method that the present invention sets up has specificity preferably to Salmonellas, Shigellae, vibrio cholerae 01 group and 39 groups of vibrio cholerae 01s, and the stool sample of the diarrhea patient of gathering also detects positive reaction in the recent period.And with equal no cross reaction such as other intestinal bacteria such as intestinal bacteria, enterobacter cloacae, campylobacter jejuni, yersinia entero-colitica, Aeromonas hydrophila, Plesiomonas shigelloides, Vibrio parahaemolyticus, vibrio fluvialis.The result is referring to Fig. 2, and A is that Salmonellas sample, B are that Shigellae sample, C are that vibrio cholerae 01 group sample, D are 39 groups of samples of vibrio cholerae 01 among the figure.
2.3 sensitivity test
To 39 groups of Salmonellas, Shigellae, vibrio cholerae 01 group and vibrio cholerae 01s, to the Salmonellas (2 * 10 of demarcating copy number
9Copies/ml), Shigellae (2 * 10
8Copies/ml), vibrio cholerae 01 (2 * 10
8Copies/ml) and vibrio cholerae 01 39(2 * 10
8Copies/ml) dilute 1000000,100000,10000,1000,100,10 times respectively after, detect with fluorescence PCR method, the fluorescence PCR method detection sensitivity reaches 2 * 100,2 * 100,2 * 100 and 2 * 100 Copies/ml(respectively and sees Fig. 2 as a result).
2.4 replica test
(final concentration is 2 * 10 to get Salmonellas respectively
7Copies/ml), Shigellae (2 * 10
7Copies/ml), vibrio cholerae 01 (2 * 10
7Copies/ml) and vibrio cholerae 01 39(2 * 10
7Copies/ml) mix the back and become 3 different concentration by 10 times of gradient dilutions, the sample of each concentration is made 5 duplicate detection, different IPs acid concentration detection Ct value standard deviation separately has better repeatability (table 1) between 0.10～0.38 as a result.
2.5 the detection of clinical sample
Adopt the diarrhoea syndrome questionnaire of the great special project of Eleventh Five-Year Plan-transmissible disease cause of disease Monitoring techniques platform, to 2000 parts of diarrhoea of outpatient service samples of collecting from Zhejiang University Medical College The First Affiliated Hospital year December in July, 2009 to 2010 (every day defecation 3 times or above and stool be rare just, watery stool, sticking purulence just or proterties such as pus and blood stool change) detect.From the diarrhoea clinical sample of collecting, directly extract DNA of bacteria, with fluorescence PCR method testing goal pathogenic bacteria of the present invention; Adopt conventional cultural method to carry out parallel test simultaneously.Fluorescence PCR method detects positive 39 parts (20 parts of Salmonellass, 18 parts of Shigellaes, 1 part of the vibrio cholerae 01 group) of bacterial nucleic acid as a result, general culture method separation of bacterial 25 strains (Salmonellas 14 strains, Shigellae 10 strains, vibrio cholerae 01 group 1 strain), fluorescence PCR method of the present invention detects the positive rate height than general culture method.Fluorescence PCR method of the present invention is used for the checking of clinical sample detection to carry out 4 parallel laboratory test chambers, has all obtained satisfied result.
＜110〉Zhejiang University
＜120〉quadruple fluorescent quantificationally PCR detecting kit and purposes
<160>?16
<210>?1
<211>
<212>?DNA
＜213〉artificial sequence
<220>?21
＜223〉PCR according to Salmonellas invA gene design detects the upstream primer sequence
<400>?1
TGTCACCGTGGTCCAGTTTAT?21
<210>?2
<211>?24
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to Salmonellas invA gene design detects the downstream primer sequence
<400>?2
TGTTTACCGGGCATACCATCCAGA?24
<210>?3
<211>?30
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the TaqMan fluorescent quantitation detection probes sequence of Salmonellas invA gene design
<400>?3
AAAGGTTCAGAACGCGTCGCGGAAGTCGCG?30
<210>?4
<211>?184
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the fluorescent quantitation examination criteria product sequence of Salmonellas invA gene design
<400>?4
ATAGCCTGGC?GGTGGGTTTT?GTTGTCTTCT?CTATTGTCAC?CGTGGTCCAG?TTTATCGTTA TTACCAAAGG?TTCAGAACGC?GTCGCGGAAG?TCGCGGCCCG?ATTTTCTCTG?GATGGTATGC?CCGGTAAACA?GATGAGTATT?GATGCCGATT?TGAAGGCCGG TATTATTGAT GCGGATGCTG CGCG 184
<210>?5
<211>?26
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to Shigellae ipaH gene design detects the upstream primer sequence
<400>?5
TTTCGATAATGATACCGGCGCTCTGC?26
<210>?6
<211>?25
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to Shigellae ipaH gene design detects the downstream primer sequence
<400>?6
TGACTTTATCCCGGGCAATGTCCTC?25
<210>?7
<211>?30
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the TaqMan fluorescent quantitation detection probes sequence of Shigellae ipaH gene design
<400>?7
TCCCTGGGCAGGGAAATGTTCCGCCTCGAA?30
<210>?8
<211>?142
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the fluorescent quantitation examination criteria product sequence of Shigellae ipaH gene design
<400>?8
AAAACCCTCC?TGGTCCATCA?GGCATCAGAA?GGCCTTTTCG?ATAATGATAC?CGGCGCTCTG?CTCTCCCTGG?GCAGGGAAAT?GTTCCGCCTC?GAAATTCTGG?AGGACATTGC CCGGGATAAA GTCAGAACTC TCCATTTTGT GG 142
<210>?9
<211>?23
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to O1 group cholera vibrio O antigen encoding rfb gene design detects the upstream primer sequence
<400>?9
AAACTCAAAATTCGGAAGTAAGG?23
<210>?10
<211>?24
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to O1 group cholera vibrio O antigen encoding rfb gene design detects the downstream primer sequence
<400>?10
CCATTAATATCCTGCGTTGCTTTA?24
<210>?11
<211>?28
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the TaqMan fluorescent quantitation detection probes sequence of O1 group cholera vibrio O antigen encoding rfb gene design
<400>?11
<210>?12
<211>?139
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉according to the fluorescent quantitation examination criteria product sequence of O1 group cholera vibrio O antigen encoding rfb gene design
<400>?12
TTGATGAGAT?TTTTAACATA?ATAAACTCAA?AATTCGGAAG?TAAGGCATAT?TTTATTCATC CATTATCATC CGCTGAACAT CCTGAGTTTA ATAAAGCAAC?GCAGGATATT AATGGGAATA TCTGTTTTAA ATATGTATC 139
<210>?13
<211>?23
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to the design of vibrio cholerae O 139 group glycosyltransferase gene detects the upstream primer sequence
<400>?13
GTTATAAAGATGCCGAAGACTAT?23
<210>?14
<211>?25
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉PCR according to the design of vibrio cholerae O 139 group glycosyltransferase gene detects the downstream primer sequence
<400>?14
CAGCTACACGTGATATACTCTCTTG?25
<210>?15
<211>?32
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉the TaqMan fluorescent quantitation detection probes sequence that designs according to the vibrio cholerae O 139 group glycosyltransferase gene
<400>?15
CTAATGTTCCTGAAATATTGTTGCGTTATAGG?32
<210>?16
<211>?164
<212>?DNA
＜213〉artificial sequence
<220>
＜223〉the fluorescent quantitation examination criteria product sequence that designs according to the vibrio cholerae O 139 group glycosyltransferase gene
<400>?16
AAATATAAAA?TTAATTATGA?TTTAGGTTAT?AAAGATGCCG?AAGACTATAA?ATTTTGGGTC?GATTTTTCAA?AATATACACT?TTTTTCTAAT?GTTCCTGAAA?TATTGTTGCG?TTATAGGTAT?CATCAAGAGA?GTATATCACG?TGTAGCTGAT?AATAAAGAAA ATAA 164
Claims (4)
1. quadruple fluorescent quantificationally PCR detecting kit, it is characterized in that, by quantitative PCR reaction solution (1), Salmonellas standard substance (2), Shigellae standard substance (3), vibrio cholerae O 1 group standard substance (4), vibrio cholerae O 139 group standard substance (5), positive reference substance (6), negative control product (7), box body (8) is formed, box body (8) is provided with container hole, place quantitative PCR reaction (1) respectively, Salmonellas standard substance (2), Shigellae standard substance (3), vibrio cholerae O 1 standard substance (4), vibrio cholerae O 139 group gene standard substance (5), positive reference substance (6) and negative control product (7), wherein quantitative PCR reaction solution single tube packing, arranged, fluorescence quantitative PCR reaction solution contain the PCR reaction buffer, the Auele Specific Primer of four kinds of bacteriums, four kinds of fluorescent probes;
Described PCR reaction buffer contains magnesium chloride and triphosphate deoxyribose nucleotide mixture, heat-resisting Taq archaeal dna polymerase;
Described quadruple fluorescence quantitative PCR detection is with upstream primer and downstream primer and specific probe sequence is as follows accordingly:
Upstream primer salmonella-F:5 '-TGTCACCGTGGTCCAGTTTAT-3 '
Downstream primer salmonella-R:5 '-TGTTTACCGGGCATACCATCCAGA-3 '
Specific probe salmonella-P:5 '
-FAM-AAAGGTTCAGAACGCGTCGCGGAAGTCGCG-
BHQ1-3 '
Upstream primer shigella-F:5 '-TTTCGATAATGATACCGGCGCTCTGC-3 '
Downstream primer shigella-R:5 '-TGACTTTATCCCGGGCAATGTCCTC-3 '
Specific probe shigella-P:5 '-
HEX-TCCCTGGGCAGGGAAATGTTCCGCCTCGAA
BHQ1-3 '
Upstream primer O1 group cholera vibrio-FP:5 '-AAACTCAAAATTCGGAAGTAAGG-3 '
Downstream primer O1 group cholera vibrio-RP:5 '-CCATTAATATCCTGCGTTGCTTTA-3 '
Specific probe O1 group cholera vibrio-P:5 '-
ROX-TTATTCATCCATTATCATCCGCTGAACA-
BHQ2-3 '
Upstream primer O139 group cholera vibrio-FP:5 '-GTTATAAAGATGCCGAAGACTAT-3 '
Downstream primer O139 group cholera vibrio-RP:5 '-CAGCTACACGTGATATACTCTCTTG-3 '
Specific probe O139 group cholera vibrio-P:5 '
-CY5-CTAATGTTCCTGAAATATTGTTGCGTTATAGG-BHQ3-3 '
Described Salmonellas standard substance sequence is:
ATAGCCTGGC?GGTGGGTTTT?GTTGTCTTCT?CTATTGTCAC?CGTGGTCCAG?TTTATCGTTA TTACCAAAGG?TTCAGAACGC?GTCGCGGAAG?TCGCGGCCCG?ATTTTCTCTG?GATGGTATGC?CCGGTAAACA?GATGAGTATT?GATGCCGATT?TGAAGGCCGG TATTATTGAT GCGGATGCTG CGCG
Shigellae standard substance sequence is:
AAAACCCTCC?TGGTCCATCA?GGCATCAGAA?GGCCTTTTCG?ATAATGATAC?CGGCGCTCTG?CTCTCCCTGG?GCAGGGAAAT?GTTCCGCCTC?GAAATTCTGG?AGGACATTGC CCGGGATAAA GTCAGAACTC TCCATTTTGT GG
Vibrio cholerae O 1 group standard substance sequence is:
TTGATGAGAT?TTTTAACATA?ATAAACTCAA?AATTCGGAAG?TAAGGCATAT?TTTATTCATC CATTATCATC CGCTGAACAT CCTGAGTTTA ATAAAGCAAC?GCAGGATATT AATGGGAATA TCTGTTTTAA ATATGTATC
Vibrio cholerae O 139 group standard substance sequence is:
AAATATAAAA?TTAATTATGA?TTTAGGTTAT?AAAGATGCCG?AAGACTATAA?ATTTTGGGTC?GATTTTTCAA?AATATACACT?TTTTTCTAAT?GTTCCTGAAA?TATTGTTGCG?TTATAGGTAT?CATCAAGAGA?GTATATCACG?TGTAGCTGAT?AATAAAGAAA ATAA
Described negative control is a diethylpyrocarbonate treating water behind the high pressure of autoclave sterilization, and positive control is the positive plasmid sample of Salmonellas, Shigellae, vibrio cholerae O 1 group and vibrio cholerae O 139 group.
2. a kind of quadruple fluorescent quantificationally PCR detecting kit according to claim 1 is characterized in that, the same tube packaging of upstream and downstream primer of the Auele Specific Primer of four kinds of bacteriums.
3. a kind of quadruple fluorescent quantificationally PCR detecting kit according to claim 1 is characterized in that, described test kit is stored in-20 ℃.
4. the application of quadruple fluorescent quantificationally PCR detecting kit in detecting Salmonellas, Shigellae, vibrio cholerae O 1 group and vibrio cholerae O 139 group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101321788A CN102212618B (en) | 2011-05-22 | 2011-05-22 | Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101321788A CN102212618B (en) | 2011-05-22 | 2011-05-22 | Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102212618A true CN102212618A (en) | 2011-10-12 |
| CN102212618B CN102212618B (en) | 2013-02-27 |
Family
ID=44744149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101321788A Active CN102212618B (en) | 2011-05-22 | 2011-05-22 | Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102212618B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868168A (en) * | 2017-01-09 | 2017-06-20 | 广西壮族自治区水产科学研究院 | Primer, probe and its application method for aquatic livestock derived bacterium sulfa drugs drug resistant gene triple fluorescent quantitative PCR detections |
| CN107058622A (en) * | 2017-03-30 | 2017-08-18 | 德必碁生物科技（厦门）有限公司 | A kind of kit of multiple fluorescence PCR method joint-detection respiratory pathogen |
| CN110129461A (en) * | 2019-04-19 | 2019-08-16 | 南开大学 | To the gene liquid chip and detection method of three kinds of serotype O antigens genotypings of Plesiomonas shigelloides |
| CN111471782A (en) * | 2020-05-09 | 2020-07-31 | 南开大学 | Vibrio parahaemolyticus O antigen serotype specific detection primer and multiplex PCR detection method |
| CN113373267A (en) * | 2021-07-16 | 2021-09-10 | 浙江大学 | Multiplex fluorescence quantitative RT-PCR kit for detecting blood-borne infectious viruses |
| CN113789397A (en) * | 2021-09-24 | 2021-12-14 | 珠海国际旅行卫生保健中心(拱北海关口岸门诊部) | Composition, kit and detection method for detecting vibrio cholerae O1 group and O139 group |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101487062A (en) * | 2008-10-31 | 2009-07-22 | 武汉大学 | Reagent kit for synchronously detecting hepatitis, AIDS virus and syphilis helicoid nucleic acid |
-
2011
- 2011-05-22 CN CN2011101321788A patent/CN102212618B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101487062A (en) * | 2008-10-31 | 2009-07-22 | 武汉大学 | Reagent kit for synchronously detecting hepatitis, AIDS virus and syphilis helicoid nucleic acid |
Non-Patent Citations (2)
| Title |
|---|
| 杨平等: "食品中4中致病微生物的多重PCR快速检测技术研究", 《西南大学学报（自然科学版）》 * |
| 郭洪波: "动物性食品中四种致病菌", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868168A (en) * | 2017-01-09 | 2017-06-20 | 广西壮族自治区水产科学研究院 | Primer, probe and its application method for aquatic livestock derived bacterium sulfa drugs drug resistant gene triple fluorescent quantitative PCR detections |
| CN107058622A (en) * | 2017-03-30 | 2017-08-18 | 德必碁生物科技（厦门）有限公司 | A kind of kit of multiple fluorescence PCR method joint-detection respiratory pathogen |
| CN107058622B (en) * | 2017-03-30 | 2020-03-27 | 德必碁生物科技（厦门）有限公司 | Kit for joint detection of respiratory pathogens by multiple fluorescence PCR method |
| CN110129461A (en) * | 2019-04-19 | 2019-08-16 | 南开大学 | To the gene liquid chip and detection method of three kinds of serotype O antigens genotypings of Plesiomonas shigelloides |
| CN111471782A (en) * | 2020-05-09 | 2020-07-31 | 南开大学 | Vibrio parahaemolyticus O antigen serotype specific detection primer and multiplex PCR detection method |
| CN113373267A (en) * | 2021-07-16 | 2021-09-10 | 浙江大学 | Multiplex fluorescence quantitative RT-PCR kit for detecting blood-borne infectious viruses |
| CN113373267B (en) * | 2021-07-16 | 2022-04-29 | 浙江大学 | Multiplex fluorescence quantitative RT-PCR kit for detecting blood-borne infectious viruses |
| CN113789397A (en) * | 2021-09-24 | 2021-12-14 | 珠海国际旅行卫生保健中心(拱北海关口岸门诊部) | Composition, kit and detection method for detecting vibrio cholerae O1 group and O139 group |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102212618B (en) | 2013-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102212618B (en) | Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application | |
| CN103789451B (en) | A kind of fluorescence quantitative kit detecting CA 6, A10 type | |
| CN107557493B (en) | A kind of enterovirus parting detecting reagent | |
| CN104561377A (en) | Real-time fluorescent multiplex PCR (polymerase chain reaction) based kit for rapidly detecting common respiratory pathogens | |
| CN105525031A (en) | Multiple PCR detection kit for 11 intestinal pathogen nucleic acid and application of detection kit | |
| CN105063218B (en) | The multiple quantitative PCR reagent kit of the difficult culture identification bacterium of four kinds of fast joint inspection | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN103602757A (en) | Development and application of multiple fluorescence RT-PCR detection method for foot-and-mouth disease, vesicular stomatitis and swine vesicular disease | |
| CN104862393A (en) | Nucleotide specific to Cronobacter O antigen and application thereof | |
| CN102534051B (en) | Kit for detecting enterovirus | |
| CN110241184A (en) | A kind of RPA kit and application thereof of quick detection riemerella anatipestifer | |
| CN102242216B (en) | Fluorescent PCR (polymerase chain reaction) detection kit for vibrio cholerae and systematic identification method thereof | |
| CN103320435A (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN101328507A (en) | Fluorescent quantitative RT-PCR detection reagent box and detection method of enterovirus EV71 | |
| CN103045756A (en) | Reagent kit of detecting human immunodeficiency virus type 1 by fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) | |
| CN101709331B (en) | Kit for quantitatively detecting vibrio parahaemolyticus in food and clinic sample | |
| CN103789450B (en) | A kind of fluorescence quantitative kit detecting CA 2, A5 type | |
| CN102367493B (en) | Animal Torque Teno virus rapid detection kit and detection method using loop-mediated isothermal amplification technology | |
| CN101838710A (en) | Hepatitis A virus nucleic acid fluorescence quantitative RT-PRC assay kit and using method thereof | |
| CN103451305A (en) | Primers, probe, method and kit for detecting diffusely adherent Escherichia coli | |
| CN106884056A (en) | Detect primer, kit and the method for zika virus | |
| CN101407847B (en) | Nucleic acid fluorescent quantitative RT-PCR detection kit for enterovirus Cox A16 | |
| CN102399884B (en) | Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli | |
| CN101122563A (en) | Hepatitis E virus fluorescent quantitative PCR detection method | |
| CN106244728A (en) | A kind of PEDV and TGEV dual RT PCR detection method and probe primer thereof combine and test kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |