CN102212544B - Controllable expression vector for pseudomonas bacteria, application and method for controlling generation of target protein product or messenger RNA (mRNA) - Google Patents
Controllable expression vector for pseudomonas bacteria, application and method for controlling generation of target protein product or messenger RNA (mRNA) Download PDFInfo
- Publication number
- CN102212544B CN102212544B CN201010143481.3A CN201010143481A CN102212544B CN 102212544 B CN102212544 B CN 102212544B CN 201010143481 A CN201010143481 A CN 201010143481A CN 102212544 B CN102212544 B CN 102212544B
- Authority
- CN
- China
- Prior art keywords
- fragment
- czccba
- pseudomonas aeruginosa
- ply
- gene cluster
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a controllable expression vector for pseudomonas bacteria, application and a method for controlling generation of a target protein product or messenger RNA (mRNA), in particular to a phenomenon that the expression of czcCBA is controlled by zinc or copper ions in pseudomonas aeruginosa PAO1, a controllable expression vector constructed on the basis of the regulation mechanism and used for pseudomonas bacteria and a method for controlling generation of a target gene product or mRNA in the pseudomonas bacteria by using the expression vector. The method solves the technical problem that the conventional protein expression vector is only expressed but not controlled, and has strong practicability.
Description
Technical field
The invention belongs to biological technical field, the expression that is specifically related to czcCBA in Pseudomonas aeruginosa PAO1 is subject to the phenomenon of zinc, cupric ion regulation and control, the controlled expression carrier for Rhodopseudomonas bacterium building based on this regulation mechanism, and apply the method that this expression vector is controlled goal gene product or mRNA generation in Rhodopseudomonas bacterium.
Background technology
Rhodopseudomonas bacterium, is widespread in nature, and animal and plant are also had to certain hazardness, can cause various diseases and corps diseases (Microbiol Rev, 1996,60:539-74.J Bacteriol, 2008,190 (8): 2858-2870.); But simultaneously, Rhodopseudomonas bacterium has been applied to field (the Biosensors & bioelectronics such as biological diagnosis, bioreediation and albumen suitability for industrialized production, 2001,16:337-353.J IndMicrobiol Biotrchnol, 2005,32 (4): 148-154.Annu Rev Phytopathol, 2005,43:337-59.).Pseudomonas aeruginosa is the bacterial classification that represents of Rhodopseudomonas, a class opportunistic pathogen, its harm to the mankind, day by day serious along with the enhancing of its resistance, the multi-drug resistant of bacterium increases in worldwide, is threatening the whole mankind's healthy and existence.So, to Rhodopseudomonas bacterium, the especially research of Pseudomonas aeruginosa, to understanding its protein function, resistance generation reason and direction of medication usage, and the application of other field is all significant.
Traditional protein expression vector, be generally at expression in escherichia coli, and be subject to the induction of IPTG, as expression vector pPROEX HT (Invitrogen), pMAL-PEA Procaryon secreted expression carrier (PLA's medical journal, 2004,29 (2): 156-8.) etc.Also have some expression vectors can express in pseudomonas, but its expression formula is uncontrollable, as pYMB03 (application and environmental organism journal, 2008,14 (4): 528-33).Therefore, under self environment, study some protein functions and also have this some inconvenience, as determining of housekeeping gene, the controlled expression of fusion rotein etc.So, build a kind of expression vector controlled in Pseudomonas aeruginosa, to addressing these problems, play an important role.
Summary of the invention
In order to solve existing protein expression vector, only express uncontrollable technical problem, the invention provides a kind of zinc that utilizes, the metal ions such as copper are to expressing and have switch and regulating and controlling effect with Pseudomonas aeruginosa PAO1 gene cluster czcCBA in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA and Rhodopseudomonas, built the expression vector of working in a set of Rhodopseudomonas bacterium, by controlling zinc, the concentration of cupric ion, reach the object of controlling destination gene expression amount, comprise the housekeeping gene of determining Rhodopseudomonas bacterium, mrna expression, complementary assay etc.
Technical solution of the present invention:
For a controlled expression carrier for Rhodopseudomonas bacterium, its special character is: described carrier adopts following methods preparation:
1] adding terminator in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with before the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, obtain transition vector 4, the sequence 1 of getting one section of promoter region that comprises gene cluster czcCBA and terminator from transition vector 4;
2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2; Sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas bacterium, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY.
Above-mentioned in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with before the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, to add the method for terminator be being connected into plasmid pMS402 with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas or being connected into plasmid pHP45-omega with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas.
Be used for the controlled expression carrier of Rhodopseudomonas bacterium in the application of purifying.
Be used for the controlled expression carrier of Rhodopseudomonas bacterium in the application of fermentation or heavy metal concentration detection.
Control the method that target protein product or mRNA produce, its special character is: it comprises the following steps:
1] get in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas and the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA;
2] set up and take the carrier A that is core element with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas;
3] carrier A proceeded to the Rhodopseudomonas bacterium being grown in substratum or be integrated on the karyomit(e) of the Rhodopseudomonas bacterium being grown in substratum;
4] in step 3] described in substratum in add divalent zinc ion or bivalent cupric ion, control the generation of target protein product or the generation of mRNA.
The concrete steps that it is the carrier A of core element with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas that above-mentioned establishment be take:
2.1] adding terminator in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with before the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, obtain transition vector 4, from transition vector 4, get one section of promoter region that comprises Pseudomonas aeruginosa PAO1 gene cluster czcCBA and the sequence 1 of terminator;
2.2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2; Sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
2.3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
2.4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas bacterium, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY;
2.5] choose insertion not containing the goal gene fragment of ribosome bind site (RBS) after multiple clone site, can make in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with Pseudomonas aeruginosa PAO1 gene cluster czcCBA homologous gene initiator codon is in the controlled expression carrier (pLY-A, pLY-B, pLY-C) of 3 integral multiple to the base number of goal gene initiator codon; Be not connected into the multiple clone site of this carrier of choosing containing the goal gene fragment of ribosome bind site (RBS), form Second support E;
Above-mentioned divalent zinc ion or the bivalent cupric ion of adding in substratum, control the generation of protein product of goal gene or the concrete steps of the generation of mRNA:
In substratum, add divalent zinc ion or bivalent cupric ion, control the generation of protein product or the generation of mRNA of goal gene; Described divalent zinc ion concentration range is 10 μ M～7mM, and bivalent cupric ion concentration range is 10 μ M～30mM.
The carrier D that it is core element with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas that above-mentioned establishment be take specifically can also comprise the following steps:
2.1] adding terminator in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with before the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, obtain transition vector 4, the sequence 1 of getting one section of promoter region that comprises gene cluster czcCBA and terminator from transition vector 4;
2.2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2; Sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
2.3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
2.4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY;
2.5] appoint one that gets in controlled expression carrier pLY, the goal gene fragment that contains ribosome bind site (RBS), be connected into the multiple clone site of this carrier, form the 3rd carrier F;
Above-mentioned in step 3] substratum in add divalent zinc ion or bivalent cupric ion, control the generation of protein product of goal gene or the concrete steps of the generation of mRNA:
In substratum, add divalent zinc ion or bivalent cupric ion, by adding the difference of ionic concn, control the difference of destination gene expression amount, and then control the generation of target protein product or the generation of mRNA; Described divalent zinc ion concentration range is 10 μ M～7mM, and bivalent cupric ion concentration range is 10 μ M～30mM.
Control the method that target protein product or mRNA produce, it comprises the following steps:
1] in the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 or Rhodopseudomonas bacterium with the homogenic promoter region of the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 after, be connected into one section of goal gene, obtain being grown in the recombinant bacterial strain in substratum;
2] in growth has the substratum of recombinant bacterial strain, add divalent zinc ion or cupric ion, control the generation of protein product or the generation of mRNA of goal gene.
Above-mentioned steps 1] be in the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 and Rhodopseudomonas bacterium with the homogenic promoter region of the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 after, directly be connected into one section of goal gene that contains ribosome bind site RBS, obtain being grown in the recombinant bacterial strain F in substratum.
Above-mentioned steps 1] be that the position of choosing in the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 or Rhodopseudomonas bacterium with the homogenic initiator codon of the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 the integral multiple that is 3 is connected into not containing the goal gene of ribosome bind site (RBS) to the base number of goal gene initiator codon, obtain being grown in the recombinant bacterial strain G in substratum.
The beneficial effect that the present invention has:
The invention provides a kind of metal ions such as zinc, copper that utilize to expressing and have switch and regulating and controlling effect with Pseudomonas aeruginosa PAO1 gene cluster czcCBA in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas, built the expression vector of working in a set of Rhodopseudomonas bacterium, by controlling the concentration of zinc, cupric ion, reach the object of controlling destination gene expression amount, practical.
Accompanying drawing explanation
Fig. 1 is the expression curve of beta-galactosidase enzymes test, lacZ is inserted on Pseudomonas aeruginosa PAO1 karyomit(e), in the middle of the czcC of gene cluster czcCBA, zine ion concentration in substratum is 500 μ M (rhombus), 400 μ M (asterisk), 300 μ M (square), 200 μ M (cross), 100 μ M (circle) and 0 μ M (triangle);
Fig. 2 is the expression curve of Pseudomonas aeruginosa PAO1 (pKD-czc) while containing different concns zine ion in BHI substratum, and zine ion concentration in substratum is 500 μ M (rhombus), 250 μ M (square) and 0 μ M (triangle);
Fig. 3 is the collection of illustrative plates of controlled expression carrier pLY-A, and pLY-B has compared a base g many before restriction enzyme site BamHI with pLY-A, and pLY-C has compared two each and every one base g many before restriction enzyme site BamHI with pLY-A;
Fig. 4 is the luminous situation of Pseudomonas aeruginosa PAO1 (pLY-B-LuxABCDE) on the broth culture that contains Different Zinc ionic concn (LB) solid plate: a figure is white light picture, and b figure is chemoluminescence sheet figure;
Fig. 5 is the growing state photo of Pseudomonas aeruginosa PAO1 (pLY-C-SacB): in brain heart infusion (BHI) substratum solid plate, all contain 10% sucrose, in a figure, in solid plate, contain 0 μ M zinc, in b figure, in solid plate, contain 200 μ M zinc, in c figure, in solid plate, contain 400 μ M zinc.
Embodiment
For a controlled expression carrier for Rhodopseudomonas bacterium, carrier adopts following methods preparation:
1] being connected into terminator in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with before the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, obtain transition vector 4, the sequence 1 of getting one section of promoter region that comprises gene cluster czcCBA and terminator from transition vector 4; That for example at the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, be connected into that plasmid pMS402 obtains is the sub-pKD-czc of report, and the promoter region that the sequence 1 obtaining from it contains gene cluster czcCBA, card are received mycin resistance (KAN
r) gene and terminator.The promoter region of the gene cluster czcCBA in pseudomonas putida KT2440, be connected on plasmid pHP45-omega (Gene 29,303-313,1984), obtain transition vector 4, from transition vector 4, get one section of sequence that comprises gene cluster czcCBA promoter region and terminator 1.
2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2, sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas bacterium, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY;
Control the method that target protein product or mRNA produce, have two kinds of methods
First method, comprises the following steps:
1] get in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas and the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA;
2] set up and take the carrier A that is core element with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas, specifically comprise the following steps:
That 2.1] promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA is connected into plasmid pMS402 obtains is the sub-pKD-czc of report, from reporting that sub-pKD-czc gets one section of promoter region that comprises Pseudomonas aeruginosa PAO1 gene cluster czcCBA, card and receives mycin resistance (KAN
r) sequence 1 of gene and terminator;
2.2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2; Sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
2.3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
2.4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas bacterium, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY;
2.5] choose goal gene is connected into after multiple clone site, the initiator codon that can make Pseudomonas aeruginosa PAO1 gene cluster czcCBA is in the controlled expression carrier (pLY-A, pLY-B, pLY-C) of 3 integral multiple to the base number of goal gene initiator codon; Be not connected into the multiple clone site of this carrier of choosing containing the goal gene fragment of ribosome bind site (RBS), form Second support E;
3] Second support E is proceeded to the Pseudomonas aeruginosa being grown in substratum and belong to bacterium;
4] in substratum, add divalent zinc ion or cupric ion, control the generation of protein product or the generation of mRNA of goal gene; Described divalent zinc ion concentration range is 10 μ M～7mM, and bivalent cupric ion concentration range is 10 μ M～30mM.
Second method:
1] get in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas and the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA;
2] set up and take the carrier D that is core element with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas; Specifically comprise the following steps:
2.1] in Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas with before the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA, add terminator, obtain transition vector 4, from transition vector 4 get one section of promoter region that comprises gene cluster czcCBA, card is received mycin resistance (KAN
r) sequence 1 of gene and terminator;
2.2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2; Sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
2.3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
2.4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY;
2.5] appoint one that gets in controlled expression carrier pLY, the goal gene fragment that contains ribosome bind site (RBS), be connected into the multiple clone site of this carrier, form the 3rd carrier F;
3] the 3rd carrier F is proceeded in the Rhodopseudomonas bacterium being grown in substratum.
4] described divalent zinc ion or the cupric ion of adding in substratum, control the generation of protein product of goal gene or the concrete steps of the generation of mRNA:
In substratum, add divalent zinc ion or cupric ion, by adding the difference of ionic concn, control the difference of destination gene expression amount, control the generation of target protein product or the generation of mRNA; Described divalent zinc ion concentration range is 10 μ M～7mM, and bivalent cupric ion concentration range is 10 μ M～30mM.
Control the method that target protein product or mRNA produce, comprise the following steps:
1] in the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 or Rhodopseudomonas bacterium with the homogenic promoter region of the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 after, be connected into one section of goal gene, obtain being grown in the recombinant bacterial strain G in substratum;
For step 1] there are two kinds of situations:
A kind of is to be connected into goal gene to contain ribosome bind site RBS:
In the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 and Rhodopseudomonas bacterium with the homogenic promoter region of the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 after, directly be connected into one section of goal gene that contains ribosome bind site RBS, obtain being grown in the recombinant bacterial strain F in substratum;
A kind of is to be connected into goal gene not contain ribosome bind site RBS:
The position that to choose in the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 or Rhodopseudomonas bacterium with the homogenic initiator codon of the chromosomal gene cluster czcCBA of Pseudomonas aeruginosa PAO1 be 3 to the base number of goal gene initiator codon is connected into not containing the goal gene of ribosome bind site RBS, obtains being grown in the recombinant bacterial strain G in substratum.
2] in growth has the substratum of recombinant bacterial strain F or G, add divalent zinc ion or cupric ion, control the generation of protein product or the generation of mRNA of goal gene.
In Pseudomonas aeruginosa, gene cluster czcCBA is metal ion resistance related gene (J Bacteriol, 1997,179:6871-9; Gene, 1999,238:417-25; J Biol Chem, 2004,279:8761-8).The present invention is by gene fragment lacZ being inserted in Pseudomonas aeruginosa PAO1 gene czcC, and with beta-galactosidase enzymes test confirmation, divalent zinc ion has switch and regulating and controlling effect (Fig. 1) to the expression of gene cluster czcCBA.Subsequently gene cluster czcCBA promoter region is increased out by the method for PCR, (Mol Microbiol 2003,50:1477-91), is built into the sub-pKD-czc of report to be connected into plasmid pMS402, after being transferred in Pseudomonas aeruginosa PAO1, also confirmed this Regulation Mechanism (Fig. 2).From Pseudomonas aeruginosa PAO1, gene cluster czcCBA promotor is subject to zinc, cupric ion to regulate phenomenon this point, utilize the part-structure of plasmid pMS02, pUCP26 and pPROEX HT system, built a set of low background, expression system controlled, that work in Rhodopseudomonas bacterium.
From Pseudomonas aeruginosa PAO1, gene cluster czcCBA expresses the feature that is subject to the strict regulation and control of the divalent-metal ions such as zinc, copper, utilizes plasmid pMS402, pUCP26 and pPROEX HT to be built into one group of Pseudomonas aeruginosa and belongs to the controlled protein expression vector pLY-A of bacterium, pLY-B and pLY-C.
Growing state by PAO1 in different culture media, determines that zine ion effective concentration in broth culture LB is 500 μ M and does not affect growth, is 600 μ M and does not affect growth in BHI substratum.As the present invention is applied to the cellular lysate in fermentative production, can strengthen zinc ion concentration.The effective concentration scope not affecting in broth culture (LB) under growing state is 50 μ M～500 μ M, and its induction effect reaches peak value when concentration is 500 ± 50 μ M, and this is optimal inhibition concentration; And 50 μ g/ml are decided to be available minimum induced concentration; In brain heart infusion (BHI) substratum, do not affect the effective concentration scope 100 μ M～600 μ M under growing state, its induction effect reaches peak value when concentration is 600 ± 50 μ M, and this is optimal inhibition concentration; And 100 μ g/ml are decided to be available minimum induced concentration.When zinc ion concentration reaches 6～7mM, thalline can be grown.
Be below several design processes:
(1) plasmid pMS402 be with disappearance promotor reporter gene luxCDABE carrier (Mol Microbiol, 2003,50:1477-1491).The promoter region of gene cluster czcCBA comprises RBS site through pcr amplification, and template is PAO1 chromosomal DNA, and primer is according to PAO1 genome sequence (Nature, 2000,406:959-964) design.Gene cluster czcCBA promotor, upstream primer TCT
cTCGAGgTTGCCGAAGTGTAAC; Downstream primer CA
gGATCCgAAGTATCGGCATG.Underscore is XhoI and the restriction enzyme site of BamHI for cloning.Archaeal dna polymerase is used high-fidelity Pfu DNA polymerase (Invitrogen).PCR is used Eppendorf Mastercycler Gradient PCR instrument, reaction conditions: 95 ℃, and 2 minutes; 95 ℃, 40 seconds; 52 ℃, 40 seconds; 72 ℃, 1 minute; 30 circulations; 72 ℃, 10 minutes.PCR product detects with 1.0% agarose gel electrophoresis.
(2) above-mentioned PCR product is cloned into plasmid pMS402 above by XhoI and BamHI restriction enzyme site, obtains reporting sub-pKD-czc, and proceeds in Pseudomonas aeruginosa PAO1.Select different concns zine ion to add respectively in porous plate, the sub-pKD-czc of measurement report sends out light intensity, detect its activity, find that its luminous intensity raises and increases with zinc ion concentration, there is no zine ion, gene cluster czcCBA promotor is not expressed, and as shown in Figure 2, this result and Fig. 1 result match.
(3) to report sub-pKD-czc primers, upstream primer TCCCGTGACAGGTCATTCAG; Downstream primer CAGGATCCGAAGTATCGGCATG.Archaeal dna polymerase is used high-fidelity Pfu DNA polymerase (Invitrogen).Reaction conditions: 95 ℃, 2 minutes; 95 ℃, 40 seconds; 61 ℃, 40 seconds; 72 ℃, 2 minutes; 30 circulations; 72 ℃, 10 minutes.PCR product detects with 1.0% agarose gel electrophoresis.Product comprises that the card of czcCBA gene promoter and its upstream receives mycin resistant gene and terminator.
(4) plasmid pUCP26 (J Bacteriol.1982 Apr; 150 (1): 60-9.), with SfiI and AflIII enzyme, cut, with T4D A polymerase (NEB), product end is carried out to smoothing, obtain product and be connected with above-mentioned PCR product, obtain plasmid with EcoRV authentication to, form plasmid pUCP27.
(5) with pPROEX primers, upstream primer GAAACAGACCATGTCGTAC; Downstream primer GAGTAAACTTGGTCTGACAG.Take respectively HTa, HTb, HTc is template.Archaeal dna polymerase is used high-fidelity Pfu DNA polymerase (Invitrogen).Reaction conditions: 95 ℃, 2 minutes; 95 ℃, 40 seconds; 61 ℃, 40 seconds; 72 ℃, 2 minutes; 30 circulations; 72 ℃, 10 minutes.PCR product detects with 1.0% agarose gel electrophoresis.
(6) the plasmid pUCP27 obtaining in (4) is cut to end smoothing with BamHI enzyme.The product obtaining is connected with the PCR product obtaining in (5) respectively, with EcoRV authentication to.Build up controlled expression carrier pLY-A, pLY-B and pLY-C.Fig. 3 is shown in by pLY-A collection of illustrative plates.
With the product that the upstream primer TCTCTCGAGGTTGCCGAAGTGTAAC primer pair of gene cluster czcCBA promotor obtains, check order respectively.
Determining of zinc ion concentration:
For measuring the effective concentration scope of zine ion, in porous plate, do 1/2 concentration gradient test, determine the consumption of zine ion.Report system PAO1 (pKD-czc) and PAO1 (pLY-B-LuxABCDE) for two, in different culture media, measure the minimum induced concentration of zine ion and minimum inhibition concentration.Use containing suitable antibiotic LB and BHI liquid nutrient medium, in the porous plate of the transparent black in bottom, test.Report system PAO1 (pKD-czc) and PAO1 (pLY-B-LuxABCDE) incubated overnight bacterium liquid, be seeded in porous plate after switching, dilution.Then every hole adds the zine ion of different concns, and covers with the mineral oil after sterile filtration or aseptic transparent plastic film.Porous plate is on multiple labeling analyser Wallac Victor 1420, and intermittently concussion, measures its growth (OD every half an hour
600) and luminous value (counts per second, CPS).If gene cluster czcCBA promotor is had to induction, luminous value can obviously raise.
Embodiment 1
Take and report that sub-pKD-czc is as example, the 10mM zinc sulfate of take is made a series of gradient dilutions as initial concentration, the zine ion that obtains different concns presents inducing action in various degree to gene cluster czcCBA promotor, the effective concentration scope not affecting in LB substratum under growing state is 50 μ M～500 μ M, its induction effect reaches peak value when concentration is 500 μ M, and this is optimal inhibition concentration; And 50 μ g/ml are decided to be available minimum inhibitory concentration; The effective concentration scope not affecting in BHI substratum under growing state is 200 μ M～600 μ M, and its induction effect reaches peak value when concentration is 600 μ M, and this is optimal inhibition concentration; And 200 μ g/ml are decided to be available minimum inhibitory concentration.
With solid plate, constructed screening system his-and-hers watches are reached the validity check of target protein:
With whether normally not working containing RBS site luxABCDE checking expression vector pLY.
With KpnI digested plasmid pUCP-Not-LuxABCDE, obtain not having the luxABCDE fragment in RBS site; Base number as calculated, selects pLY-B, by same enzyme, cuts after processing, is connected with luxABCDE fragment, obtain product use NotI authentication to.The plasmid pLY-B-LuxABCDE being built into.
The method that above-mentioned plasmid electricity consumption is transformed proceeds to wild-type Pseudomonas aeruginosa PAO1, uses the LB solid plate screening positive clone that contains tsiklomitsin (Tc, 100 μ g/ml).
The checking of the controllability of expressing quantity (chemoluminescence), is used tsiklomitsin (Tc100 μ g/ml) in LB solid medium, mixes respectively 0 μ M, 300 μ M, 600 μ M zinc sulfate, shakes up and is down flat plate.After flat board solidifies and dries, flat board is divided into 6 equal regions, with report system PAO1 (pLY-B-LuxABCDE), in each district, rule, incubated overnight at 37 ℃.Imaging in fluorescence/chemoluminescence imaging analysis system LAS-3000, observational data luminous intensity and variation thereof.Fig. 5 is that different concns zine ion is grown and luminous impact on report system PAO1 (pLY-B-LuxABCDE) on solid medium.Under the same conditions, these divalent zinc ion concentration are on the basic not impact of PAO1 (pLY-B-LuxABCDE) growth.But, containing the bacterium growing on 0 μ M zinc sulfate flat board, do not have luminously, and that the bacterium growing on containing 300 μ M zinc sulfate and 600 μ M flat boards has is luminous, but does not have obvious gradient to increase.This result shows: whether the protein expression of the upper luxABCDE of zine ion regulation and control plasmid pLY-B-LuxABCDE, but there is no obvious regulating and controlling effect.Fig. 4 a is the white light photo of experimental group and control group; Fig. 4 b is chemoluminescence photo.Fig. 4 shows that pLY-B-LuxABCDE has switching characteristic.On the flat board that contains zine ion, reporter luminous quantity does not have obvious graded, illustrates that this group reporter does not have obvious regulating and controlling effect.But, in this individual system liquid medium within, with multiple labeling analyser Wallac Victor 1420, can not detect luminously, although illustrate that this promotor is subject to the adjusting of zine ion, be a weak promoter.
Embodiment 2
With containing RBS site sacB checking expression vector pLY, whether can normally work.
With upstream primer 5 '-CGC
gGATCCgGAGACATGAACGATGAACA-3 ' (underscore is BamHI restriction enzyme site) and downstream primer 5 '-CT
gGAATTcGGCATTTTCTTTTGCG-3 ' (underscore is EcoRI restriction enzyme site) amplification.Archaeal dna polymerase is used high-fidelity Pfu DNA polymerase (Invitrogen), with plasmid pEX18-Tc (Mol Microbiol, 1992,6:1195-204) be template.Reaction conditions: 95 ℃, 2 minutes; 95 ℃, 40 seconds; 58 ℃, 40 seconds; 72 ℃, 1 minute; 30 circulations; 72 ℃, 10 minutes.PCR product detects with 1.0% agarose gel electrophoresis.Amplification obtains the sacB fragment that contains RBS site, carries out enzyme cut with BamHI and EcoRI, and is connected with the pLY-C of same enzyme processing.The plasmid called after pLYC-SacB being built into.
The method that above-mentioned plasmid electricity consumption is transformed proceeds to wild-type Pseudomonas aeruginosa PAO1, uses the LB solid plate screening positive clone that contains tsiklomitsin (Tc, 100 μ g/ml).The checking of the controllability of expressing quantity (upgrowth situation), is used BHI solid medium (containing the Tc of 100 μ g/ml), adds respectively zinc sulfate 0 μ M, 200 μ M and 400 μ M in substratum.Shake up and be down flat plate.After flat board solidifies and dries, flat board is divided into 3 equal regions, with report bacterial strain PAO1 (pLY-C-SacB), wild-type PAO1 and control strain PAO1 (pLY-C) rule in each district, incubated overnight at 37 ℃.Observe its growing state.
If there is no zine ion in substratum, report bacterial strain and control strain are all grown, but wild-type PAO1 does not grow; If there is zine ion in substratum, report bacterial strain is not grown or is long bad, illustrates that this histone expression system has on-off action; If thalli growth situation, along with zinc ion concentration raises and degenerates, illustrates that this histone expression system is controlled.Fig. 5 shows that pLY-C-SacB has switch and modulating properties.
Embodiment 3
Report that the phenomenon (Fig. 2) that sub-pKD-czc is regulated by zinc in Pseudomonas aeruginosa proves, utilize this promotor, can reach and control the characteristic of expressing mRNA, can be used for the tests such as gene silencing.Meanwhile, this report is not expressed in intestinal bacteria, not regulated by the induction of zinc.So the expression vector of structure can only be worked in Pseudomonas aeruginosa and Rhodopseudomonas bacterium.
Embodiment 4
Gene lacZ is inserted in Pseudomonas aeruginosa after gene cluster czcCBA promotor, and the phenomenon (Fig. 1) that regulated by zinc prove, utilizes this promotor, can reach the characteristic of controlling expression mRNA, can be used for the tests such as gene silencing.
Embodiment 5
Utilize clone to have this expression system of bacteriolysis gene, in utilizing Rhodopseudomonas fermentation using bacteria production process, the release link of thalline inclusion, adds a large amount of zine ions, impels the expression of bacteriolyze gene, reaches the object that discharges cell content.PLY expression system, is a strict expression system of controlling, and the concentration of zinc, cupric ion, to being cloned into the gene in described carrier, has strict regulating and controlling effect in the expression amount process of mRNA, albumen in Rhodopseudomonas bacterium.
Application:
For will not being connected into the multiple clone site of the carrier of the present invention of choosing containing the goal gene fragment of ribosome bind site (RBS), and the initiator codon that guarantees to be connected into rear czcCBA is 3 integral multiple to the base number between goal gene initiator codon, formation Second support E.Express goal gene obtain product contain one histidine-tagged, therefore can utilize (nickel post) protein purification test kit to carry out purifying; Also can be for fermentation, in carrier, be connected into lysozyme gene, proceed in Rhodopseudomonas bacterium or be incorporated on the karyomit(e) of Rhodopseudomonas bacterium, at Rhodopseudomonas fermentation using bacteria, produce the later stage, in substratum, add suitable concn zinc or cupric ion, induction lysozyme gene is expressed, and causes cellular lysate, discharges inclusion; Also can be used in detection, namely in carrier, be connected into lux gene or other reporter genes, proceed in Rhodopseudomonas bacterium and grow in the substratum that contains proper ratio environmental sample, by heavy metal concentration in luminous degree detecting environment, extrapolate the concentration of heavy metal ion in environment.
For the goal gene fragment that contains ribosome bind site (RBS), be connected into the multiple clone site of this carrier, form the 3rd carrier F.This can detect for the concentration of fermentation and heavy metal ion.
For be connected into one section containing the goal gene of ribosome bind site (RBS) after the gene cluster czcCBA promotor at Pseudomonas aeruginosa PAO1 or in Rhodopseudomonas bacterium with after the gene promoter of the gene cluster czcCBA homology of Pseudomonas aeruginosa PAO1, form recombinant bacterial strain F; Also can be after the gene cluster czcCBA of Pseudomonas aeruginosa PAO1 promotor or in Rhodopseudomonas bacterium with the gene promoter of the gene cluster czcCBA homology of Pseudomonas aeruginosa PAO1 after be connected into one section not containing the goal gene of ribosome bind site (RBS), and the initiator codon that guarantees to be connected into rear czcCBA is 3 integral multiple to the base number between goal gene initiator codon, the recombinant bacterial strain G forming, all can and detect for fermentation.
Claims (1)
1. for a controlled expression carrier for Rhodopseudomonas bacterium, it is characterized in that: described carrier adopts following methods preparation:
1] being connected into plasmid pMS402 with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas, obtain transition vector 4; Or being connected into plasmid pHP45-omega with the homogenic promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA in the promoter region of Pseudomonas aeruginosa PAO1 gene cluster czcCBA or Rhodopseudomonas, obtain transition vector 4;
The sequence 1 of getting one section of promoter region that comprises gene cluster czcCBA and terminator from transition vector 4;
2] remove multiple clone site and the promotor PLac region in plasmid pUCP26, obtain intermediate segment 2; Sequence 1 and intermediate segment 2 are connected into intermediate carrier 3;
3] with pcr amplification, from the pPROEX HTa of expression vector pPROEX HT, obtain the first fragment D1, from pPROEX HTb, obtain the second fragment D2, from pPROEX HTc, obtain the 3rd fragment D3, described the first fragment D1, the second fragment D2, the 3rd fragment D3 comprise respectively multiple clone site and poly histidine-tagged;
4] described the first fragment D1, the second fragment D2, the 3rd fragment D3 are connected into respectively to intermediate carrier 3, obtain the controlled expression carrier pLY for Rhodopseudomonas bacterium, corresponding pLY-A, pLY-B, the pLY-C of comprising of described controlled expression carrier pLY.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010143481.3A CN102212544B (en) | 2010-04-09 | 2010-04-09 | Controllable expression vector for pseudomonas bacteria, application and method for controlling generation of target protein product or messenger RNA (mRNA) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010143481.3A CN102212544B (en) | 2010-04-09 | 2010-04-09 | Controllable expression vector for pseudomonas bacteria, application and method for controlling generation of target protein product or messenger RNA (mRNA) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102212544A CN102212544A (en) | 2011-10-12 |
| CN102212544B true CN102212544B (en) | 2014-07-23 |
Family
ID=44744077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010143481.3A Expired - Fee Related CN102212544B (en) | 2010-04-09 | 2010-04-09 | Controllable expression vector for pseudomonas bacteria, application and method for controlling generation of target protein product or messenger RNA (mRNA) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102212544B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662950B (en) * | 2020-06-30 | 2023-03-28 | 陕西省微生物研究所 | Application of recombinant pseudomonas aeruginosa PAO1-lux in medical material bacteria adhesion detection |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182560A (en) * | 2007-11-29 | 2008-05-21 | 湖南大学 | Method for enhancing yield of rhamnolipid produced by copper green pseudomonas |
-
2010
- 2010-04-09 CN CN201010143481.3A patent/CN102212544B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182560A (en) * | 2007-11-29 | 2008-05-21 | 湖南大学 | Method for enhancing yield of rhamnolipid produced by copper green pseudomonas |
Non-Patent Citations (4)
| Title |
|---|
| C Rensing et al.New function for the three subunits of the czcCBA cation proton antiporter.《Journal of Bacteriology》.1997,全文. * |
| 季秀玲等.细菌锌离子抗性机制研究进展.《生命科学》.2010,全文. * |
| 杨亮.铜绿假单胞菌czcCBA主动外排泵的基因调节及PA4489的功能研究.《中国优秀硕士学位论文全文数据库》.2007,全文. |
| 铜绿假单胞菌czcCBA主动外排泵的基因调节及PA4489的功能研究;杨亮;《中国优秀硕士学位论文全文数据库》;20071015;正文讨论部分，结果第3.1.1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102212544A (en) | 2011-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cheong et al. | Isolation and identification of indigenous quorum quenching bacteria, Pseudomonas sp. 1A1, for biofouling control in MBR | |
| Almeida et al. | Contribution of rpfB to cell-to-cell signal synthesis, virulence, and vector transmission of Xylella fastidiosa | |
| CN101528918A (en) | Beta-alanine/alpha-ketoglutarate aminotransferase for 3-hydroxypropionic acid production | |
| CN112501193B (en) | Nicotinic acid and nicotinamide biosensing system | |
| KR101481142B1 (en) | Synthetic Promoter for Expressing Corynebacteria | |
| CN111117942B (en) | Genetic engineering bacterium for producing lincomycin and construction method and application thereof | |
| Montgomery | Light-dependent governance of cell shape dimensions in cyanobacteria | |
| US20240011001A1 (en) | Gdsl lipase, genetically-engineered bacteria and application thereof | |
| CN111004785A (en) | Tyrosinase protein sequence and application thereof in preparation of tyrosinase | |
| CN102212544B (en) | Controllable expression vector for pseudomonas bacteria, application and method for controlling generation of target protein product or messenger RNA (mRNA) | |
| CN112175982B (en) | Gamma-PGA polymerase gene recombinant strain and construction method and application thereof | |
| CN113151136A (en) | Strain for producing gamma-DL-PGA and method for synthesizing gamma-PGA with different D/L monomer ratios by using same | |
| CN116333067B (en) | Antibacterial peptide mutant Sub168-QC/R, recombinant strain and application thereof | |
| CN114891806B (en) | Citrobacter welchii yqjH gene knockout mutant strain and application thereof | |
| CN109929854A (en) | One plant is overexpressed the engineering bacteria and its construction method that catabolite controls albumin A encoding gene | |
| Liu et al. | Pseudomonas chlororaphis L5 and Enterobacter asburiae L95 biocontrol Dickeya soft rot diseases by quenching virulence factor modulating quorum sensing signal | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| CN115160416A (en) | AraC mutant for inducing submarine metal ion Cd (II), constructed submerged microorganism detection sensor and application thereof | |
| CN104046635A (en) | Application and usage method of nfiS gene for specific response of adversity signal | |
| Matsui et al. | Interference expression at levels of the transcript and protein among group 1, 2, and 3 sigma factor genes in a cyanobacterium | |
| US20180051293A1 (en) | Genetic control of cell size | |
| KR102520671B1 (en) | Novel lactose oxidase from Pseudomonas and method for producing lactobionic acid using the same | |
| CN110129377A (en) | A method of biological flocculant is prepared using the engineering bacteria for being overexpressed nitrogen metabolism regulatory protein gene | |
| KR101547333B1 (en) | Novel Cellulase from Metagenomic Resources | |
| Kanzaki et al. | Improved bioassay method for plant transformation inhibitors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140723 Termination date: 20170409 |