CN111004785A

CN111004785A - Tyrosinase protein sequence and application thereof in preparation of tyrosinase

Info

Publication number: CN111004785A
Application number: CN201911291621.9A
Authority: CN
Inventors: 闫云君; 王绪霞; 张龙雨; 王磊; 李欢欢; 龚梦瑶; 袁升; 许赟
Original assignee: Huazhong University of Science and Technology
Current assignee: Huazhong University of Science and Technology
Priority date: 2019-12-16
Filing date: 2019-12-16
Publication date: 2020-04-14

Abstract

The invention discloses a tyrosinase protein sequence and application thereof in preparation of tyrosinase, belonging to the technical field of preparation of tyrosinase. The amino acid sequence of the tyrosinase protein provided by the invention is shown in SEQ ID NO.1-SEQ ID NO. 4. Furthermore, the invention discloses nucleic acid for coding the tyrosinase protein, an expression cassette, an expression vector, yeast engineering bacteria containing the nucleic acid, and application and a preparation method of the nucleic acid in preparation of tyrosinase.

Description

Tyrosinase protein sequence and application thereof in preparation of tyrosinase

Technical Field

The invention relates to a tyrosinase protein sequence and application thereof in preparation of tyrosinase, belonging to the technical field of preparation of tyrosinase.

Background

Mussels belong to mollusca and are common marine bivalve mussels, and mainly live on stone reefs impacted by sea waves. Mussel foot proteins (Mfp) have high strength, high toughness, high water resistance and extremely strong substrate adhesion performance, and simultaneously have good biocompatibility and degradability, thus being a biological adhesive with great advantages and potentials. Studies have shown that the viscosity of Mfp is related to its particular tyrosine post-translational modification product, dihydroxyphenylalanine (DOPA, commonly referred to as DOPA). Obtaining Mfp adhesive protein equivalent to native mussel byssus protein requires tyrosinase catalysis of the in vitro recombinantly expressed Mfp protein. Therefore, the establishment of the efficient preparation method of tyrosinase and the construction of the strain capable of being synergistically expressed with the mussel byssus protein have high application value. In addition, tyrosinase has multiple biological functions, and has attracted extensive attention for its application in the fields of medicine, beauty, food, environmental protection, and the like (Chenqingxi, Songkang. tyrosinase research progress [ J ]. Xiamen university report (Nature science edition), 2006, 45 (5): 731-737.). In addition, combining technologies such as immobilization and biosensors, catalytic oxidation, treatment of industrial wastewater, detection of compounds using tyrosinase, etc. have become hot spots of current domestic and foreign research in the fields of organic synthesis, environmental protection, biological detection, etc. (diauxite. microbial immobilization technology and its research progress in the field of wastewater treatment [ J ]. industrial water treatment, 2010, 30 (10): 14-16.).

Yarrowia lipolytica (Yarrowia lipolytica) is an unconventional yeast belonging to the family of the Hemiascomycetes (Hemiascomyces). The yeast has strong stress resistance, can resist high salt, low temperature and overhigh acid-base environment, and is widely distributed in nature. Yarrowia lipolytica has many unique physicochemical properties, metabolic features, and genetic structure compared to traditional s.cerevisiae (Saccharomyces cerevisiae) (Kellershohn J, Russell I.YeastBiotechnology [ M ]. Advances in Food Biotechnology.John Wiley & Sons Ltd, 2015.). Yarrowia lipolytica is approved by the U.S. FDA as a safe microorganism. Because of the advantages in environmental safety, substrate source, post-translational modifications, etc., yarrowia lipolytica was developed as a new yeast expression system in the last 90 s and successfully expressed over the hundreds of heterologous proteins (Zhao He Yun, Huang Li, Yangjia, etc.. yarrowia lipolytica expression system research progress [ J ] bioprocessing, 2008, 6 (3): 10-16.). Although some of the data disclose tyrosinase expressed in Yarrowia lipolytica, the amount of expression is very low and cannot be used in industrial production (Helun, Wang Xiaofeng, Pan Xiao Hao, et al. Yarrowia lipolytica novel expression vector construction and expression of oncogene rho therein [ J ]. microbiological notification, 2011, 38 (12): 1778-

Disclosure of Invention

The technical problem to be solved by the invention is to efficiently express tyrosinase in yarrowia lipolytica.

The invention obtains a gene and protein sequence capable of successfully expressing tyrosinase in yarrowia lipolytica by collecting and testing a series of tyrosinase genes and carrying out tyrosinase expression test in yarrowia lipolytica. Further optimizing and testing the expression strain in the nucleic acid sequence to obtain the efficient tyrosinase preparation method.

The invention provides a tyrosinase protein capable of being expressed in yarrowia lipolytica, which is characterized in that the amino acid sequence of the protein is shown in SEQ ID NO.1-SEQ ID NO. 4; in some embodiments, the amino acid sequence is set forth in SEQ ID NO. 4.

In yet another aspect, the present invention also provides a nucleic acid, wherein the nucleic acid encodes the protein; in some embodiments, the nucleic acid sequence is as set forth in SEQ ID NO.5-SEQ ID NO. 12.

In yet another aspect, the present invention provides a gene expression cassette, wherein the expression cassette comprises the nucleic acid sequence; in some embodiments, the above nucleic acid is operably linked to a hp4d promoter and an XPR2t terminator.

In still another aspect, the present invention provides an expression vector comprising the above-described expression cassette; in some embodiments, the vector further comprises a secretion signal peptide XPR2pre, the selection marker uracil ura3d4, vector resistant KanR.

In another aspect, the invention also provides an engineered yeast strain, which is characterized in that the engineered yeast strain is obtained by transforming a yeast strain with the expression vector; in some embodiments, the yeast strains described above are yarrowia lipolytica Polf and Polh strains.

In another aspect, the invention also provides applications of the protein, the nucleic acid, the gene expression cassette, the expression vector and the yeast engineering bacteria in preparation of tyrosinase.

In another aspect, the invention also provides a method for preparing tyrosinase, which is characterized in that the yeast engineering bacteria are subjected to fermentation culture, and tyrosinase is separated and purified.

Compared with the prior art, the invention has the advantages that: tyrosinase can be used for catalyzing mussel byssus protein expressed in vitro, and a yarrowia lipolytica expression system has advantages in the aspects of safety, substrate source, post-translational modification and the like. Although some of the data disclose tyrosinase expressed in yarrowia lipolytica, the amount of expression is very low and cannot be used for industrial production. No data show that the protein, the nucleic acid and the yeast engineering bacteria provided by the invention can be used for efficiently expressing tyrosinase in yarrowia lipolytica.

Drawings

FIG. 1 map of the vector of PINA 1297. The English letters of the elements and the meanings of the abbreviations are listed as follows:

zeta yeast multi-site integration site

Ura3d4 nutritional markers

Hp4d pXPR2 is the most commonly used strong promoter in yarrowia lipolytica, encoding an extracellular protease. Hp4d is a strong constitutive promoter formed by the crossing of 4 pXPR2 UAS1 tandem plus LEU2 promoter.

XPR2pre secretion signal peptide

XPR2term terminator

kanR antibiotic resistance

FIG. 2 cloning of yarrowia lipolytica transformed with expression vector on MD screening plates. Upper left: t1; upper right: t2; left lower: t3; right lower: t4.

FIG. 3 shows PCR-verified positive clones in the genome of tyrosinase-engineered bacteria. A: detecting T1 gene, detecting 510bp segment; b: detecting T2 gene, detecting 1249bp fragment; c: detecting T3 gene, detecting 749 bp; d: and detecting the T4 gene, and detecting a fragment 759 bp.

FIG. 4 Shake flask screening of tyrosinase-engineered bacteria. A: t1; b: t2; c: t3; d: t4.

FIG. 5 Oxidation of TYROSINASE ENGINEERS on YPD plates.

FIG. 6 tyrosinase gene expression analysis. Contains T1-T4 gene to transform wild strains polh and polf.

FIG. 7 protein assay standard curve.

FIG. 8 tyrosinase activity assay. A: the reaction is shown after adding the reaction substrate for 1 hour by using clear water as a control; b: the sample T4h-1 showed reaction after 1 hour of addition to the reaction substrate; c: 1 hour after sample T4f-3 was added to the reaction substrate; D. e, F shows reaction after adding reaction substrates for 2 hours respectively for clear water control, T4h-1 and T4 f-3.

FIG. 9 SDS-PAGE detection of the target protein. M: protein maker; 1. fermenting the supernatant; 2. making a river flow liquid; 3. Imidazole 50 elution; 4. imidazole 100 elutes.

FIG. 10T 4 shows the result of mass spectrometric detection of peptide fragment proteins.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise defined, terms are to be understood in accordance with their conventional usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards and other publications, etc., cited herein are incorporated by reference in their entirety.

Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potentially genetic sequences of proteins of interest.

In some embodiments, changes may be made to the nucleotide sequences of the present application to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, substitutions that do not alter the amino acid sequence of the nucleotide sequences of the present application can be made in accordance with the disclosed yeast codon preferences, e.g., codons encoding the same amino acid sequence can be substituted with yeast preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application is replaced with a different codon that encodes the same amino acid sequence, such that the nucleotide sequence is not altered while the amino acid sequence encoded thereby is altered. Conservative variants include those sequences that, due to the degeneracy of the genetic code, encode the amino acid sequence of one of the proteins of the embodiments. In some embodiments, the codons are substituted for a portion of the nucleotide sequences in the present application according to yeast preference. One skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituent groups having various of the foregoing properties are known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance as to suitable amino acid substitutions that do not affect the biological activity of the Protein of interest can be found in the model of the Atlas of Protein sequences and structural Atlas (Natl.biomed.Res.Foundation., Washington, D.C.) (1978), incorporated herein by reference. Conservative substitutions such as exchanging one amino acid for another with similar properties may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P or other detectable marker. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the sequence of the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences may be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target sequence to a detectably greater degree (e.g., at least 2-fold, 5-fold, or 10-fold over background) than to other sequences. Stringent conditions are sequence dependent and differ in different environments. By controlling the stringency of hybridization and/or the washing conditions, target sequences can be identified that are 100% complementary to the probes (homologous probe method). Alternatively, stringency conditions can be adjusted to allow some sequence mismatches in order to detect lower similarity (heterologous probe method). Typically, probes are less than about 1000 or 500 nucleotides in length. Typically, stringent conditions are conditions in which the salt concentration is at pH 7.0 to 8.3, less than about 1.5M Na ion, typically about 0.01M to 1.0M Na ion concentration (or other salt), and the temperature conditions are: when used with short probes (e.g., 10 to 50 nucleotides), at least about 30 ℃; when used with long probes (e.g., greater than 50 nucleotides), at least about 60 ℃. Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37 ℃ using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate), washing at 50 ℃ to 55 ℃ in 1 × to 2 × SSC (20 × SSC ═ 3.0M NaCl/0.3M trisodium citrate). Exemplary moderately stringent conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37 ℃ and washing in 0.5X to 1 XSSC at 55 ℃ to 60 ℃. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37 deg.C, and a final wash in 0.1 XSSC at 60 deg.C to 65 deg.C for at least about 20 minutes. Optionally, the wash buffer may comprise about 0.1% to about 1% SDS. The duration of hybridization is generally less than about 24 hours, and typically from about 4 hours to about 12 hours. Specificity usually depends on the post-hybridization wash, the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermal melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) anal. biochem.138: 267-284: tm 81.5 ℃ +16.6(logM) +0.41 (% GC) -0.61 (% formamide) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% formamide is the percentage formamide of the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Washing is typically performed at least until equilibrium is reached and a low background level of hybridization is achieved, such as for 2 hours, 1 hour, or 30 minutes. Decrease Tm by about 1 ℃ per 1% mismatch; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of desired identity. For example, if a sequence with > 90% identity is desired, the Tm can be lowered by 10 ℃. Typically, stringent conditions are selected to be about 5 ℃ lower than the Tm for the specific sequence and its complement under defined ionic strength and pH. However, under very stringent conditions, hybridization and/or washing can be performed at 4 ℃ below the Tm; hybridization and/or washing may be performed at 6 ℃ below the Tm under moderately stringent conditions; under low stringency conditions, hybridization and/or washing can be performed at 11 ℃ below the Tm.

In some embodiments, the present invention finds that tyrosinase can be expressed in yarrowia lipolytica by collecting a series of tyrosinase genes and performing tyrosinase expression tests in yarrowia lipolytica, wherein the tyrosinase genes (nucleic acid sequences shown in SEQ ID number 5-SEQ ID NO. 8) in Stenotrophomonas maltophilia, Aspergillus oryzae (Aspergillus oryzae), Bacillus megaterium (Bacillus megaterium), and Bacillus fibronus (Bacillus filmentosus) genes.

Further, according to the amino acid sequence (shown as SEQ ID NO.1-SEQ ID NO. 4) encoded by the tyrosinase gene, the tyrosinase gene sequence is optimized according to the codon preference of yarrowia lipolytica to obtain a novel tyrosinase gene nucleic acid sequence (shown as SEQ ID NO.9-SEQ ID NO. 12), the artificially synthesized nucleic acid fragment is connected into a PiNA1297 vector to obtain an expression vector, and yarrowia lipolytica Polf and Polh strains are transformed to obtain the engineering bacteria. The fermentation culture of the yeast engineering bacteria is found that the engineering bacteria can efficiently express tyrosinase. Among them, T4h-1 strain expresses the highest tyrosinase activity.

Furthermore, the invention discloses a method for preparing tyrosinase, which is to express the protein sequence in yarrowia lipolytica by a genetic engineering technology, perform fermentation culture on the yeast engineering bacteria, and separate and purify the tyrosinase.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the present invention may be made without departing from the spirit and substance of the invention and are intended to be included within the scope of the present application. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning Manual of Sambrook et al (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual,2001), or following the conditions suggested by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

EXAMPLE 1 screening and identification of tyrosinase Gene

1. The collection and synthesis of gene sequences and the construction of expression vectors.

The invention collects a series of tyrosinase gene sequences (the specific sequence information is shown in table 1) from an NCBI database, synthesizes DNA sequences and constructs the DNA sequences on an expression vector PiNA 1297.

PiNA1297 is a yeast expression vector (Madzak C, gailardin C, beckerrich J m. heterologous protein expression and secretion in the non-constitutive yeast lipolytica: a review [ J ]. Journal of Biotechnology 2004,109(1-2): 63-81.), the promoter is the growth cycle promoter hp4d, the vector contains the secretion signal peptide XPR2pre, the terminator is XPR2t, the selection marker is uracil ura3d4, the vector resistance is KanR, and the integration site is zeta site. The vector is shown in FIG. 1. And connecting the synthesized gene sequence into a backbone of a PINA1297 vector through a multi-cloning site SfiI and KpnI to obtain an expression vector.

2. Transformation of yarrowia lipolytica.

Polh and Polf competent cells were prepared by NotI linearized expression vector, lithium acetate method and yeast transformed. The competent preparation and transformation methods were as follows:

(1) the glycerol Y.lipolytica Po1f/Po1h preserved at-80 ℃ is streaked on a YPD plate and cultured for 1-2 days at 28 ℃.

(2) A single colony was picked and inoculated into 5mL YPD liquid medium, and shake-cultured overnight at 28 ℃.

(3) The suspension was resuspended in 1mL of 1 XTE buffer, centrifuged at 8000rpm for 1min, the supernatant was discarded, and the process was repeated once.

(4) The cells were resuspended in 600. mu.L of 0.1M LiAc (pH6.0) buffer and incubated in a water bath at 28 ℃ for 1 h.

(5) Centrifuging at 8000rpm for 1min, discarding the supernatant, and gently resuspending the cells in 80-120. mu.L of 0.1M LiAc (pH6.0).

(6) Taking 40 mu L of cell suspension, adding the linearized DNA and salmon sperm DNA which are mixed uniformly according to a ratio of 3:2(v/v), gently mixing uniformly, and carrying out water bath at 28 ℃ for 15min to obtain a transformation system.

(7) Adding a transformation and re-breeding system into the transformation system: 20 mu L of 2M LiAc (pH6.0), 0 mu L of 50% PEG4000320 mu L and 16 mu L of 1M DTT, gently blowing, beating and uniformly mixing, then carrying out water bath at 28 ℃ for 1h, and then carrying out heat shock on the mixture in water bath at 39 ℃ for 10 min.

(8) After heat shock the system was centrifuged at 8000rpm for 1min with 600. mu.L of 0.1M LiAc (pH6.0) and the supernatant discarded, leaving 50-100. mu.L of the cell suspension to be spread on MD plates. For Polf transformation, leucine was added to the MD screening medium.

The preparation method of the MD solid culture medium comprises the following steps: adding 20g of agar into 800mL of double distilled water, performing steam sterilization at 121 ℃ for 20min, cooling to 60 ℃, and adding 100mL of 10 XYNB, 2mL of 500 XYNB and 40mL of 50% glucose; the YPD culture medium preparation method comprises the following steps: 10g of yeast extract and 20g of peptone are added into 900mL of double distilled water, steam sterilization is carried out at 121 ℃ for 20min, 40mL of separately sterilized 50% glucose (m/v) is added to the solution until the final concentration is 20g/L, and agar with the final concentration of 20g/L is added to the solid culture medium.

And after 2-5d of transformation, randomly selecting transformed yeast transformants into a YPD liquid culture medium, carrying out shaking overnight culture at 28 ℃, preserving bacteria, extracting genome DNA, designing a target gene positive detection primer, and carrying out PCR amplification on the genome to obtain a positive strain.

3. And (5) shake flask fermentation of the recombinant engineering bacteria.

According to the PCR detection result, 3-4 positive clones are selected, shake flask fermentation is carried out by using 50mL of BMSY culture medium, and the fermentation time is 96 h. BMSY medium (/ L): 20g of Tryptone, 10g of Yeast Extract, 50g of D-sorbitol and ddH₂O to 800mL, 100mL of 1M potassium phosphate buffer, pH 6.5. After autoclaving, 10% by volume of 10 XYNB and 0.2% by volume of 500 XBiotin were added. YNB (Yeast Nitrogen base) is yeast Nitrogen base, does not contain amino acid organic Nitrogen source, and can be used for preparing auxotroph screening culture medium.

The tyrosinase can catalyze monophenol to generate dihydric phenol and catalyze the dihydric phenol to generate corresponding quinone under the participation of oxygen. While quinones undergo a series of enzymatic and non-enzymatic redox reactions to ultimately produce melanin (Manivasagan P, Venkatesan J, Sivakumar K, et al., Actinobacterium melanins: current status and specificity for the future [ J ]. World Journal of microbiology and Biotechnology,2013,29(10): 1737-1750.). During the shake flask fermentation, the broth was observed for color, and the apparent color darkened indicating a strain with tyrosinase activity (see Table 1).

TABLE 1 tyrosinase gene information screened according to the invention

Example 2 optimization of the preparation Process of tyrosinase

1. Gene sequence optimization

The series of tyrosinase gene sequences or protein sequences retrieved in NCBI (Table 1) were optimized according to the codon bias of yarrowia lipolytica and DNA sequences were synthesized anew.

The specific optimization method comprises the following steps: optimizing according to the amino acid sequence SEQ ID NO.1-SEQ ID NO.4 coded by the T1-T4 gene, and optimizing according to the Kinsley codon optimization software OptimumGene of gene synthesis company^TMOptimizing the gene, mainly referring to the codon preference of yarrowia lipolytica, and finally completing the optimization of the gene codon by combining a filter element and balancing the GC content of the gene to obtain a DNA sequence SEQ ID number 9-SEQ ID NO. 12. A DNA sequence was synthesized and constructed into the expression vector PINA1297 (see FIG. 1 for vector map) according to the procedure of example 1.

2. Transformation of yarrowia lipolytica and shake flask fermentation of recombinant engineered bacteria.

Polh, Polf competent cells were prepared by NotI linearized expression vector PiNA1297, lithium acetate method and yeast transformed. The selection medium is MD medium, Polf is uracil and leucine deficient strain, and leucine is added into MD selection medium during transformation (the result of yeast transformation is shown in figure 2).

Randomly picking transformed yeast transformants into YPD liquid culture medium, carrying out overnight culture at 28 ℃, preserving bacteria, extracting genome DNA, designing gene positive detection primers (T1-F: ATGGACCGAGGTGTCAACGT; T1-R: TTAAGCTCGGGAAGCAGACC; T2-F: GCCTGGCGATGGATTCAAGA T2-R: TAGCAAGGGCGAAAGATCCG; T3-F: GTGCGAAAGAACGTCCTGCA; T3-R: CCAGCCCATGAAGAACGGT; T4-F: TCTGACCGAAACGCTGCTCA; T4-R: GTGGTGGTGGTGGTGGTTGG; T5-F: CGAATCCGAAAGAACGTCCG; T5-R: TCCGGTCTTGTAGGCGAAGG; T6-F: ATGGCCGTCCGAAAGAACG; T6-R: AAGTCGGTAGCCCACACAGGAG), and carrying out PCR amplification to obtain positive strains.

The PCR amplification is shown in FIG. 3. According to the PCR detection result, 3-4 positive clones are selected, 50mL of BMSY culture medium is used for shake flask fermentation, and the fermentation time is 96 h. BMSY medium (/ L): 20g of Tryptone, 10g of Yeast Extract, 50g of D-sorbitol and ddH₂O to 800mL, 100mL of 1M potassium phosphate buffer, pH 6.5. After autoclaving, 10% by volume of 10 XYNB and 0.2% by volume of 500 XB were added. YNB (Yeast Nitrogen base) is a Nitrogen base for yeast, contains no amino acid as organic Nitrogen source, and can be used to prepare screening medium for auxotrophy.

During the shake flask fermentation, the broth color was observed and the apparent color darkening indicated a strain of tyrosinase activity. The results showed that all 4 engineered yeasts had a distinct darkening, while the transformed strains of the T3 and T4 genes had the darkest black color, indicating that the obtained tyrosinase strain had a higher activity (FIG. 4), and that the selected strains were further verified on YPD plates, and that melanin oxidation was observed after 4-5 days of YPD plate culture (FIG. 5).

3. Tyrosinase gene expression analysis

Control Polh, Polf, test engineering bacteria were fermented in 50mL BMSY, samples were taken after 24h, RNA extraction and subsequent expression analysis experiments were performed, the quantitative PCR primers for each gene are shown in Table 2, Act1 is the reference gene in yarrowia lipolytica (GenBank: AJ250347.1), the data analysis was performed by the Δ Δ Δ CT method:

CT (target gene, sample to be tested) -CT (internal standard gene, sample to be tested);

CT (target gene, control sample) -CT (internal standard gene, control sample);

expression fold 2^-(A-B)。

TABLE 2 primer information for tyrosinase gene expression analysis

The results are shown in FIG. 6. No expression of the T1-T4 tyrosinase gene was detected in both control Polh and Polf, whereas different levels of expression of the tyrosinase gene were detected in both Polh and Polf-engineered bacteria containing the T1-T4 gene. The engineering bacteria containing the T4 gene have the highest expression level, T4h-1 reaches 9.38, T4h-2 reaches 5.71, T4f-3 reaches 8.34, and T4f-4 reaches 8.36.

4. Determination of protein content

Protein content was measured for T4h-1, T4h-2, T4f-3, T4f-4 and the negative control po1h, pofl, samples from 50ml of fermentation broth in BMSY, and supernatants were removed after centrifugation.

The protein content is measured by adopting a traditional BSA method, and the principle is that Coomassie brilliant blue G-250 is combined with protein under an acidic condition, so that the maximum absorption peak of the dye is changed from 465nm to 595nm, the variation of the absorbance at 595nm of a reaction solution is in direct proportion to the amount of reaction protein in a certain linear range, and the protein quantification experiment can be carried out by measuring the increase of the absorbance at 595 nm. The total protein content was determined using the Tiangen Bradford protein quantification kit (accession number PA 102). The standard curve is shown in fig. 7.

The test sample and the negative control are diluted and then the light absorption value is measured, and the protein yield of T4h-1, T4h-2, T4f-3 and T4f-4 with the total protein content of 0.43 g/mL, 0.46g/mL, 0.26g/mL and 0.21g/mL respectively under the small volume of 50mL fermentation liquid is obtained by combining the calculation of the standard curve.

5. Tyrosinase Activity assay

Tyrosinase activity in the samples was tested using the homogeneous biotech (shanghai) cell tyrosinase activity quantitative detection kit (cat # GMS70112.1, run according to the instructions) and the results are shown in table 3.

TABLE 3 tyrosinase Activity

h：Polh；f：Polf。

Through enzyme activity determination, the engineering bacteria T4h-1 with the maximum enzyme activity of 0.147 micromol dopa/min in a shake flask is finally obtained. The reaction chart of the enzyme activity test of the two maximum enzyme activity engineering bacteria T4h-1 and T4f-3 is shown in figure 8.

EXAMPLE 3 isolation and purification of tyrosinase

And selecting a T4h-1 strain to ferment and purify the target protein by combining the results of the expression analysis of the tyrosinase gene and the determination of the tyrosinase activity. Fermenting for 4 days under 50mL BMSY culture by a shaker at 37 degrees and 200rpm, and centrifuging the fermentation liquor at high speed to obtain a supernatant. And (3) purifying the supernatant by using a Biyunshi tag protein purification reagent (product number p2226), wherein the target protein is predicted to be about 34KD, and the purified target protein is shown in figure 9 through SDS-PAGE detection.

EXAMPLE 3 isolation and purification of tyrosinase

TABLE 4 Mass spectrometric identification of protein gel samples

There is also a specific band at 45KD-65KD in SDS-PAGE, which is detected by mass spectrometry as the endogenous protein hexose-1-phosphate uridyltransferase of yarrowia lipolytica (also known as galactose-1-phosphate uridyltransferase) is a key enzyme of the Leloir pathway in lactose metabolism. The active center contains imidazole rings on two histidines [ his to (164) and his to (166) ] as nucleophilic catalytic groups, so the compounds are easy to be eluted together in nickel column purification.

Although the invention has been described in detail hereinabove with respect to specific embodiments thereof, it will be apparent to those skilled in the art that modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of science and technology in Huazhong

<120> tyrosinase protein sequence and application thereof in preparation of tyrosinase

<130>1

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>169

<212>PRT

<213> Stenotrophomonas maltophilia (Stenotrophormonas maltophilia)

<400>1

Met Asp Arg Gly Val Asn Val Ala Lys Gln Met Lys Phe Thr Asn Ala

1 5 10 15

Pro Asp Phe Ser Gly Ala Leu Asn Val Glu Tyr Arg Thr Glu Leu Ala

20 25 30

Ser Ala Gly Asn Leu Ser Ala Arg Val Ser Tyr Ser Tyr Gln Ser Glu

35 40 45

Val Trp Pro Thr Thr Asp Leu Ser Pro Val Ile Arg Gln Asp Gly Tyr

50 55 60

Gly Leu Val Asn Ala Gly Val Ile Trp Lys Leu Asp Asp Ala Trp Thr

65 70 75 80

Phe Ser Leu Gln Gly Thr Asn Leu Ala Asp Lys Glu Tyr Arg Thr Thr

85 90 95

Gly Tyr Asn Ile Pro Ala Val Gly Thr Leu Ile Gly Phe Tyr Gly Pro

100 105 110

Pro Arg Gln Tyr Thr Ser Ala Ser Val Thr Ile Ser Arg Asn Arg Leu

115 120 125

His Asp Thr Val Leu Arg Leu Ile Cys Thr Gly Lys Val Thr Met Val

130 135 140

Cys Ala Cys Met Arg Ala Ile Met Pro Gln Ala Arg Asp Ser His Pro

145 150 155 160

Val Ala Arg Trp Ser Ala Ser Arg Ala

165

<210>2

<211>539

<212>PRT

<213> Aspergillus oryzae (Aspergillus oryzae)

<400>2

Met Ala Ser Val Glu Pro Ile Lys Thr Phe Glu Ile Arg Gln Lys Gly

1 5 10 15

Thr Val Glu Thr Lys Ala Glu Arg Lys Ser Ile Arg Asp Leu Asn Glu

20 25 30

Glu Glu Leu Asp Lys Leu Ile Glu Ala Trp Arg Trp Ile Gln Asp Pro

35 40 45

Ala Arg Thr Gly Glu Asp Ser Phe Phe Tyr Leu Ala Gly Leu His Gly

50 55 60

Glu Pro Phe Arg Gly Ala Gly Tyr Asn Asn Ser His Trp Trp Gly Gly

65 70 75 80

Tyr Cys His His Gly Asn Ile Leu Phe Pro Thr Trp His Arg Ala Tyr

85 90 95

Leu Met Ala Val Glu Lys Ala Leu Arg Lys Ala Cys Pro Asp Val Ser

100 105 110

Leu Pro Tyr Trp Asp Glu Ser Asp Asp Glu Thr Ala Lys Lys Gly Ile

115 120 125

Pro Leu Ile Phe Thr Gln Lys Glu Tyr Lys Gly Lys Pro Asn Pro Leu

130 135 140

Tyr Ser Tyr Thr Phe Ser Glu Arg Ile Val Asp Arg Leu Ala Lys Phe

145 150 155 160

Pro Asp Ala Asp Tyr Ser Lys Pro Gln Gly Tyr Lys Thr Cys Arg Tyr

165 170 175

Pro Tyr Ser Gly Leu Cys Gly Gln Asp Asp Ile Ala Ile Ala Gln Gln

180 185 190

His Asn Asn Phe Leu Asp Ala Asn Phe Asn Gln Glu Gln Ile Thr Gly

195 200 205

Leu Leu Asn Ser Asn Val Thr Ser Trp Leu Asn Leu Gly Gln Phe Thr

210 215 220

Asp Ser Glu Gly Lys Gln Val Lys Ala Asp Thr Arg Trp Lys Ile Arg

225 230 235 240

Gln Cys Leu Leu Thr Glu Glu Tyr Thr Val Phe Ser Asn Thr Thr Ser

245 250 255

Ala Gln Arg Trp Asn Asp Glu Gln Phe His Pro Leu Glu Ser Gly Gly

260 265 270

Lys Glu Thr Glu Ala Lys Ala Thr Ser Leu Ala Val Pro Leu Glu Ser

275 280 285

Pro His Asn Asp Met His Leu Ala Ile Gly Gly Val Gln Ile Pro Gly

290 295 300

Phe Asn Val Asp Gln Tyr Ala Gly Ala Asn Gly Asp Met Gly Glu Asn

305 310 315 320

Asp Thr Ala Ser Phe Asp Pro Ile Phe Tyr Phe His His Cys Phe Ile

325 330 335

Asp Tyr Leu Phe Trp Thr Trp Gln Thr Met His Lys Lys Thr Glu Ala

340 345 350

Ser Gln Ile Thr Ile Leu Pro Glu Tyr Pro Gly Thr Asn Ser Val Asp

355 360 365

Ser Gln Gly Pro Thr Pro Gly Ile Ser Gly Asn Thr Trp Leu Thr Leu

370 375 380

Asp Thr Pro Leu Asp Pro Phe Arg Glu Asn Gly Asp Lys Val Thr Ser

385 390 395 400

Asn Lys Leu Leu Thr Leu Lys Asp Leu Pro Tyr Thr Tyr Lys Ala Pro

405 410 415

Thr Ser Gly Thr Gly Ser Val Phe Asn Asp Val Pro Arg Leu Asn Tyr

420 425 430

Pro Leu Ser Pro Pro Ile Leu Arg Val Ser Gly Ile Asn Arg Ala Ser

435 440 445

Ile Ala Gly Ser Phe Ala Leu Ala Ile Ser Gln Thr Asp His Thr Gly

450 455 460

Lys Ala Gln Val Lys Gly Ile Glu Ser Val Leu Ser Arg Trp His Val

465 470 475 480

Gln Gly Cys Ala Asn Cys Gln Thr His Leu Ser Thr Thr Ala Phe Val

485 490 495

Pro Leu Phe Glu Leu Asn Glu Asp Asp Ala Lys Arg Lys His Ala Asn

500 505 510

Asn Glu Leu Ala Val His Leu His Thr Arg Gly Asn Pro Gly Gly Gln

515 520 525

Arg Val Arg Asn Val Thr Val Gly Thr Met Arg

530 535

<210>3

<211>297

<212>PRT

<213> Bacillus megaterium (Bacillus megaterium)

<400>3

Met Ser Asn Lys Tyr Arg Val Arg Lys Asn Val Leu His Leu Thr Asp

1 5 10 15

Thr Glu Lys Arg Asp Phe Val Arg Thr Val Leu Ile Leu Lys Glu Lys

20 25 30

Gly Ile Tyr Asp Arg Tyr Ile Ala Trp His Gly Ala Ala Gly Lys Phe

35 40 45

His Thr Pro Pro Gly Ser Asp Arg Asn Ala Ala His Met Ser Ser Ala

50 55 60

Phe Leu Pro Trp His Arg Glu Tyr Leu Leu Arg Phe Glu Arg Asp Leu

65 70 75 80

Gln Ser Ile Asn Pro Glu Val Thr Leu Pro Tyr Trp Glu Trp Glu Thr

85 90 95

Asp Ala Gln Met Gln Asp Pro Ser Gln Ser Gln Ile Trp Ser Ala Asp

100 105 110

Phe Met Gly Gly Asn Gly Asn Pro Ile Lys Asp Phe Ile Val Asp Thr

115 120 125

Gly Pro Phe Ala Ala Gly Arg Trp Thr Thr Ile Asp Glu Gln Gly Asn

130 135 140

Pro Ser Gly Gly Leu Lys Arg Asn Phe Gly Ala Thr Lys Glu Ala Pro

145 150 155 160

Thr Leu Pro Thr Arg Asp Asp Val Leu Asn Ala Leu Lys Ile Thr Gln

165 170 175

Tyr Asp Thr Pro Pro Trp Asp Met Thr Ser Gln Asn Ser Phe Arg Asn

180 185 190

Gln Leu Glu Gly Phe Ile Asn Gly Pro Gln Leu His Asn Arg Val His

195 200 205

Arg Trp Val Gly Gly Gln Met Gly Val Val Pro Thr Ala Pro Asn Asp

210 215 220

Pro Val Phe Phe Leu His His Ala Asn Val Asp Arg Ile Trp Ala Val

225 230 235 240

Trp Gln Ile Ile His Arg Asn Gln Asn Tyr Gln Pro Met Lys Asn Gly

245 250 255

Pro Phe Gly Gln Asn Phe Arg Asp Pro Met Tyr Pro Trp Asn Thr Thr

260 265 270

Pro Glu Asp Val Met Asn His Arg Lys Leu Gly Tyr Val Tyr Asp Ile

275 280 285

Glu Leu Arg Lys Ser Lys Arg Ser Ser

290 295

<210>4

<211>301

<212>PRT

<213> Bacillus fibrosus (Bacillus filamntiosus)

<400>4

Met Thr Thr Lys Tyr Lys Val Arg Lys Asn Val Lys His Leu Thr Lys

1 5 10 15

Lys Glu Arg Arg Asp Phe Ile Arg Ala Val Leu Gly Leu Lys Lys Lys

20 25 30

Gly Ile Tyr Asp Arg Tyr Val Ala Trp His Ala Thr Ala Gly Asn Phe

35 40 45

Pro Thr Pro Pro Gly Ser Asp Arg Asn Ala Ala His Met Gly Pro Ala

50 55 60

Phe Leu Pro Trp His Arg Glu Phe Leu Leu Arg Phe Glu Lys Asp Leu

65 70 75 80

Gln Ser Ile Val Pro Gly Ile Thr Ile Pro Tyr Trp Asp Trp Thr Glu

85 90 95

Asp Ala Lys Met Lys Asp Pro Ser Gln Ser Ser Ile Trp Asn Gln Asp

100 105 110

Phe Met Gly Gly Asn Gly Asn Pro Gln Lys Glu Phe Val Val Asp Thr

115 120 125

Gly Pro Phe Ser Ile Asp Asn Trp Thr Val Ile Asp Ser Gln Gly Asn

130 135 140

Pro Phe Gly Gly Leu Arg Arg Asn Phe Gly Gly Asp Glu Arg Ala Pro

145 150 155 160

Thr Leu Pro Thr Lys Ser Asp Val Arg Asn Val Leu Lys Ile Thr Pro

165 170 175

Tyr Asp Thr Ser Pro Trp Asp Met Thr Ser Thr Pro Ser Phe Arg Asn

180 185 190

Gln Leu Glu Gly Phe Ile Asn Gly Pro Gln Leu His Asn Arg Val His

195 200 205

Val Trp Ile Gly Gly His Met Gly Ser Val Pro Val Ala Pro Asn Asp

210 215 220

Pro Ile Phe Tyr Leu His His Ala Asn Val Asp Arg Ile Trp Ala Ile

225 230 235 240

Trp Gln Ile Ile His Pro Glu Glu Gly Tyr Tyr Pro Arg Asp Asp Gly

245 250 255

Pro Phe Gly Gln Asn Leu Asp Asp Pro Met Tyr Pro Trp Asp Thr Thr

260 265 270

Pro Arg Asp Met Met Asn His Arg Lys Leu Lys Tyr Val Tyr Asp Ile

275 280 285

Glu Leu Lys Lys Ser Lys Arg Ile Gln Leu His Ala Asn

290 295 300

<210>5

<211>510

<212>DNA

<213> Stenotrophomonas maltophilia (Stenotrophormonas maltophilia)

<400>5

atggatcgtg gcgtcaacgt ggccaagcag atgaagttca ccaacgcacc ggacttctcg 60

ggcgcgctga acgttgaata ccgcaccgag ctggccagtg cgggcaacct gtccgcgcgg 120

gtgagctaca gctatcagag cgaggtgtgg ccaaccaccg atctgagccc ggtgatccgc 180

caggacggct acggactggt caacgccggc gtgatctgga agctcgacga cgcctggacc 240

ttctcgctgc agggcaccaa cctggccgac aaggaatacc gcaccaccgg ttacaacatt 300

ccggcggtcg gcacgctgat tggcttctat gggccgccgc gccaatatac ctcagcgtcc 360

gttacgattt ctaggaaccg tctgcatgac accgtcttac gattgatctg tactggaaaa 420

gtgacgatgg tctgcgcctg catgcgcgcg atcatgcccc aggcgcggga cagccacccc 480

gtggcacggt ggtctgcatc ccgggcctga 510

<210>6

<211>1620

<212>DNA

<213> Aspergillus oryzae (Aspergillus oryzae)

<400>6

atggcctcag tcgaacccat caaaaccttt gagatcagac agaagggaac agttgaaacc 60

aaagcggaac gcaagtcgat tcgagacctc aatgaagaag agttagataa actcatcgag 120

gcttggagat ggattcaaga ccccgcgaga acaggcgaag actcattttt ctacctagcc 180

gggctgcatg gtgagccttt ccgaggcgcg ggatacaaca attcccactg gtggggggga 240

tactgccatc atggaaacat cttgtttcca acctggcatc gtgcgtatct gatggctgtg 300

gagaaggctc tacgcaaggc gtgcccagat gtctcactcc catattggga tgaaagtgac 360

gatgaaacgg caaagaaggg gattccgtta attttcaccc agaaagaata caagggaaaa 420

cctaacccac tgtattccta tacgtttagc gaacgaattg tcgaccgctt ggccaaattc 480

cccgatgcag actacagtaa gccacaaggc tataaaactt gccgataccc ttattcgggc 540

ctttgtggcc aggacgacat tgcgatagct caacagcaca acaatttcct tgatgccaac 600

tttaaccaag aacagattac tggtctgctg aatagcaatg tcacgtcatg gcttaatttg 660

gggcaattca ccgatagtga gggcaagcaa gtcaaggccg acacccgctg gaagattcgt 720

cagtgtctct tgacagaaga gtacactgtc ttctcgaata caacttcggc tcaacgatgg 780

aatgatgaac agttccatcc actggagtcg ggtggtaaag agacagaggc caaagcaacc 840

tcactcgctg ttcccctgga aagcccccat aatgacatgc atctcgctat tggtggagtc 900

caaattccgg gctttaatgt tgatcagtat gctggcgcca acggcgacat gggggagaac 960

gacaccgcct cattcgatcc gatcttttac tttcatcatt gctttattga ctatctattc 1020

tggacctggc agacaatgca caagaagaca gaggctagtc aaataacaat cttgccagaa 1080

tatcctggaa cgaacagcgt tgatagccaa ggtcctacac ccgggatctc tggcaacacc 1140

tggcttacct tggacactcc ccttgaccca ttcagagaga atggagataa ggtcacttca 1200

aataaactcc tgaccttgaa agatcttccc tatacataca aggcgcccac gtccggcaca 1260

ggttcggttt tcaatgatgt gcctcggctc aattaccctc tttctccacc aatactacgt 1320

gtctccggta tcaatcgtgc tagtatcgcc ggttcctttg ccttggctat ctcgcagaca 1380

gaccacaccg gcaaagctca agtcaaaggt atcgaatctg tgcttagtag atggcatgta 1440

cagggctgcg cgaactgcca gactcaccta agcacaacag catttgtacc tctttttgag 1500

ctgaatgagg atgatgcaaa aagaaaacat gctaataatg aattggcagt gcacctgcat 1560

actaggggta atccaggagg tcaaagagtg cgcaatgtta ccgtgggaac tatgagatag 1620

<210>7

<211>894

<212>DNA

<213> Bacillus megaterium (Bacillus megaterium)

<400>7

atgagtaaca agtatagagt tagaaaaaac gtattacatc ttaccgacac ggaaaaaaga 60

gattttgttc gtaccgtgct aatactaaag gaaaaaggga tatatgaccg ctatatagcc 120

tggcatggtg cagcaggtaa atttcatact cctccgggca gcgatcgaaa tgcagcacat 180

atgagttctg cttttttacc gtggcatcgt gaataccttt tacgattcga acgtgacctt 240

cagtcaatca atccagaagt aacccttcct tattgggaat gggaaacgga cgcacagatg 300

caggatccct cacaatcaca aatttggagt gcagatttta tgggaggaaa cggaaatccc 360

ataaaagatt ttatcgtcga taccgggcca tttgcagctg ggcgctggac gacgatcgat 420

gaacaaggaa atccttccgg agggctaaaa cgtaattttg gagcaacgaa agaggcacct 480

acactcccta ctcgagatga tgtcctcaat gctttaaaaa taactcagta tgatacgccg 540

ccttgggata tgaccagcca aaacagcttt cgtaatcagc ttgaaggatt tattaacggg 600

ccacagcttc acaatcgcgt acaccgttgg gttggcggac agatgggcgt tgtgcctact 660

gctccgaatg atcctgtctt ctttttacac cacgcaaatg tggatcgtat ttgggctgta 720

tggcaaatta ttcatcgtaa tcaaaactat cagccgatga aaaacgggcc atttggtcaa 780

aactttagag atccgatgta cccttggaat acaacccctg aagacgttat gaaccatcga 840

aagcttgggt acgtatacga tatagaatta agaaaatcaa aacgttcctc ataa 894

<210>8

<211>906

<212>DNA

<213> Bacillus fibrosus (Bacillus filamntiosus)

<400>8

atgacaacta aatataaagt aagaaaaaat gtgaaacatc ttaccaaaaa agaaaggagg 60

gactttatac gtgctgtttt aggattaaag aaaaaaggta tttatgatcg atatgtagca 120

tggcatgcta ccgcaggtaa tttccctacc ccccctggtt ccgaccgaaa tgcagctcat 180

atggggccag catttcttcc atggcaccgt gaattcctcc tacgatttga aaaagacctt 240

caatcaattg tacctgggat aactattcct tactgggatt ggacagaaga tgcaaaaatg 300

aaggatccat cgcaatcatc tatatggaatcaagacttta tgggaggaaa tggaaatccc 360

caaaaagaat ttgttgtgga tacaggacca ttttctattg ataattggac tgttattgat 420

tcgcaaggaa atcctttcgg aggattacgt cgtaatttcg gaggagatga aagggctcca 480

acacttccta ctaaaagtga tgtccgaaat gtcttaaaaa taactccata tgatacatca 540

ccttgggata tgacaagtac tcctagcttc cgtaaccaat tggaaggatt tatcaatgga 600

ccacaacttc ataaccgtgt ccatgtttgg atcggtggtc atatgggatc tgtaccagtg 660

gctccaaatg accctatctt ctatctacac catgctaacg tggaccgtat ctgggcgata 720

tggcaaatta ttcatccaga ggagggatac tatccaaggg atgacgggcc atttggtcaa 780

aatttagatg atcctatgta tccatgggat acaaccccta gagatatgat gaatcataga 840

aaacttaaat atgtttatga tatagaattg aagaaatcaa aacgtattca gctccatgct 900

aactaa 906

<210>9

<211>510

<212>DNA

<213>unkown

<400>9

atggaccgag gtgtcaacgt cgccaagcag atgaagttca ccaacgcccc cgacttctcc 60

ggagctctta acgtcgagta ccgaaccgag ctggcctccg ctggtaacct ttccgctcga 120

gtgtcctact cctaccagtc cgaggtctgg cccaccactg acctttcccc tgtcattcga 180

caggacggct acggcctcgt caacgctggt gttatctgga agctggacga cgcctggact 240

ttctccctgc agggtaccaa cctggctgac aaggagtacc gaactaccgg ctacaacatt 300

cccgctgtcg gtaccctgat cggtttttac ggcccccccc gacagtacac ctccgcttct 360

gttaccatct cccgaaaccg actgcacgac accgtcctgc gactgatctg caccggtaag 420

gttaccatgg tctgcgcctg catgcgagcc atcatgcctc aggctcgaga ctcccacccc 480

gttgctcgat ggtctgcttc ccgagcttaa 510

<210>10

<211>1620

<212>DNA

<213>unkown

<400>10

atggcttccg tcgagcctat caagaccttc gagatccgac agaagggcac cgtcgagacc 60

aaggctgagc gaaagagcat ccgagacctg aacgaggagg agctggacaa gctgatcgag 120

gcctggcgat ggattcaaga ccccgctcga accggagagg actctttctt ctacctcgcc 180

ggcctgcacg gagagccttt tcgaggtgct ggatacaaca acagccactg gtggggcggt 240

tactgccacc atggtaacat tcttttcccc acctggcacc gagcctacct gatggctgtg 300

gagaaggccc tgcgaaaggc ctgtcctgac gtctctctgc cctactggga cgagtccgac 360

gacgagactg ctaagaaggg cattcccctg atcttcaccc agaaggagta caagggcaag 420

cccaaccccc tgtacagcta caccttctcc gagcgaatcg tcgatcgact ggccaagttt 480

cccgacgccg actacagcaa gccccagggt tacaagacct gccgataccc ctactccggc 540

ctctgtggtc aggacgatat cgccatcgcc cagcagcata acaacttcct ggacgccaac 600

ttcaaccagg agcagatcac cggcctgctg aactccaacg ttacctcctg gctcaacctc 660

ggccagttca ctgactccga gggcaagcag gtcaaggccg atacccgatg gaagatccga 720

cagtgcctgc tcaccgagga gtacaccgtc ttctccaaca ccacctccgc ccagcgatgg 780

aacgacgagc agttccaccc cctggagtcc ggtggtaagg agactgaggc caaggccacc 840

tccctcgctg ttcctcttga gtccccccac aacgacatgc acctggctat cggcggcgtc 900

cagatccctg gtttcaacgt cgaccagtac gctggcgcca acggtgatat gggtgagaac 960

gacaccgcct ccttcgaccc tatcttctac tttcaccact gcttcatcga ctacctcttc 1020

tggacttggc agaccatgca caagaagacc gaggcctccc agattaccat tctgcccgag 1080

taccccggca ccaactccgt tgattcccag ggacccaccc ccggtatttc cggtaacacc 1140

tggctgaccc tggacacccc tctggaccct ttccgagaga acggcgacaa ggtcacctcc 1200

aacaagctcc tgaccctgaa ggacctcccc tacacctaca aggcccccac ttccggaacc 1260

ggtagcgttt tcaacgacgt cccccgactt aactaccccc tgtcccctcc tatcctccga 1320

gtctctggca tcaaccgagc ctccatcgcc ggatctttcg cccttgctat ctcccagact 1380

gaccataccg gcaaggccca ggtcaaggga atcgagtccg tcctttcccg atggcacgtc 1440

cagggttgcg ctaactgcca gacccacctg tccactaccg ccttcgtgcc tctcttcgag 1500

ctcaacgagg atgatgccaa gcgaaagcac gccaacaacg agctggccgt ccaccttcac 1560

actcgaggta accccggcgg acagcgagtt cgaaacgtca ctgtcggcac catgcgataa 1620

<210>11

<211>894

<212>DNA

<213>unkown

<400>11

atgtccaaca agtaccgagt gcgaaagaac gtcctgcacc tgaccgacac cgagaagcga 60

gacttcgtgc gaaccgtcct gatcctgaag gagaagggaa tctacgaccg atacattgcc 120

tggcacggcg ccgctggaaa gttccacacc cctcccggtt ctgaccgaaa cgccgctcac 180

atgtcttccg ctttcctgcc ctggcaccga gagtacctgc tgcgattcga gcgagacctg 240

cagtccatca accccgaggt gaccctgccc tactgggagt gggagaccga cgcccagatg 300

caggacccct ctcagtccca gatttggtct gctgacttca tgggcggaaa cggcaacccc 360

atcaaggact tcattgtgga caccggtcct ttcgctgctg gacgatggac caccattgac 420

gagcagggta acccctctgg tggcctgaag cgaaacttcg gagctaccaa ggaagccccc 480

accctgccta cccgagacga cgtgctgaac gccctgaaga tcacccagta cgacacccct 540

ccctgggaca tgacctctca gaactccttc cgaaaccagc tggagggatt cattaacggt 600

ccccagctgc acaaccgagt gcaccgatgg gtcggaggtc aaatgggagt ggtccccacc 660

gctcctaacg accccgtctt cttcctgcac cacgccaacg tggaccgaat ctgggctgtc 720

tggcagatca ttcaccgaaa ccagaactac cagcccatga agaacggtcc cttcggccag 780

aacttccgag accccatgta cccctggaac accacccccg aggacgtgat gaaccaccga 840

aagctgggat acgtctacga cattgagctg cgaaagtcca agcgatcttc ctaa 894

<210>12

<211>906

<212>DNA

<213>unkown

<400>12

atgaccacca agtacaaggt gcgaaagaac gtcaagcacc tgaccaagaa ggagcgacga 60

gacttcatcc gagccgtgct gggcctgaag aagaagggaa tctacgaccg atacgtcgct 120

tggcacgcca ccgctggtaa cttccctacc cctcccggtt ctgaccgaaa cgctgctcac 180

atgggtcctg ccttcctgcc ttggcaccga gagttcctgc tgcgattcga gaaggacctg 240

cagtctatcg tgcccggaat caccattccc tactgggact ggaccgagga cgctaagatg 300

aaggacccct cccagtcttc catttggaac caggacttca tgggcggaaa cggaaacccc 360

cagaaggagt tcgtggtgga caccggtccc ttctctatcg acaactggac cgtcattgac 420

tctcagggta accctttcgg tggcctgcga cgaaacttcg gaggtgacga gcgagccccc 480

accctgccta ccaagtctga cgtgcgaaac gtcctgaaga tcacccccta cgacacctcc 540

ccctgggaca tgacctctac cccctccttc cgaaaccagc tggagggatt catcaacggt 600

ccccagctgc acaaccgagt gcacgtctgg attggcggac acatgggttc tgtgcccgtc 660

gctcccaacg accccatttt ctacctgcac cacgccaacg tggaccgaat ctgggctatt 720

tggcagatca ttcaccccga ggaaggctac tacccccgag acgacggtcc cttcggccag 780

aacctggacg accccatgta cccctgggac accacccctc gagacatgat gaaccaccga 840

aagctgaagt acgtctacga catcgagctg aagaagtcca agcgaatcca gctgcacgcc 900

aactaa 906

Claims

1. A protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO.1-SEQ ID NO. 4; optionally, the amino acid sequence is shown as SEQ ID NO. 4.

2. A nucleic acid encoding the protein of claim 1; optionally, the nucleic acid sequence is shown in SEQ ID NO.5-SEQ ID NO. 12.

3. A gene expression cassette comprising the nucleic acid sequence of claim 2; optionally, the nucleic acid is operably linked to a hp4d promoter and an XPR2t terminator.

4. An expression vector comprising the expression cassette of claim 3; optionally, the vector further comprises a secretion signal peptide XPR2pre, a selection marker uracil ura3d4, a vector resistant KanR.

5. The yeast engineering bacteria is characterized in that yeast strains are transformed by the expression vector of claim 4 to obtain the yeast engineering bacteria; optionally, the yeast strains are yarrowia lipolytica Polf and Polh strains.

6. Use of the protein, nucleic acid, gene expression cassette, expression vector, yeast engineering bacteria of claims 1 to 5 for preparing tyrosinase.

7. The method for preparing tyrosinase is characterized in that the yeast engineering bacteria of claim 5 are subjected to fermentation culture, and tyrosinase is separated and purified.