CN102206714B - Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus - Google Patents
Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus Download PDFInfo
- Publication number
- CN102206714B CN102206714B CN 201110087903 CN201110087903A CN102206714B CN 102206714 B CN102206714 B CN 102206714B CN 201110087903 CN201110087903 CN 201110087903 CN 201110087903 A CN201110087903 A CN 201110087903A CN 102206714 B CN102206714 B CN 102206714B
- Authority
- CN
- China
- Prior art keywords
- virus
- mosaic virus
- cowpea
- pcr
- subfamily
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus. The degenerate primer consists of a forward degenerate primer of following sequence: SEQ ID No.1:5'-TGTGAYTAYWVNVVNTTYGATGG-3' and a reverse degenerate primer of following sequence: SEQ ID No.2:5' -YTTRTCHBTVCCATCVGTAAT-3', wherein, Y,C,T,W,A,G,N,R,B and H satisfy the following relation: Y=C/T, W=A/T, V=G/A/C, N=A/G/C/T, R=A/G, B=G/T and H=A/T/C. The primer disclosed in the invention has good versatility, and the detection method is accurate and rapid, providing a guarantee of security of import and export.
Description
Technical field
The present invention relates to the general RT-PCR of a kind of cowpea mosaic virus subfamily virus detects with degenerated primer, detection method and application thereof.
Background technology
The cowpea mosaic virus subfamily (
Comovirinae) belong to class picornavirus order (
Picornavirales), association cowpea Viraceae (
Secoviridae) in a subfamily, comprise Comovirus (
Comovirus), fabavirus belong to (
Fabavirus) and Nepovirus (
Nepovirus) etc. 3 Tobamovirus, have 53 kinds of viruses.Cowpea mosaic virus subfamily virus is a class causes important threat to agricultural production security virus, and multiple virus has very widely host range, and can cause the various crop heavy losses.According to " People's Republic of China (PRC) enter the territory Plant Quarantine harmful organism register " that announced in 2007, the kind that is listed in quarantine virus in this virus subfamily has: arabis mosaic virus (
Arabis mosaic virus, ArMV), broad bean dyeing virus (
Broad bean stain virus, BBSV), bean pod mottle virus (
Bean pod mottle virus, BPMV), cowpea severe mosaic virus (
Cowpea severe mosaic virus, CPSMV), peach rosette mosaic virus (
Peach rosette mosaic virus, PRMV), nepovirus (
Tobacco ringspot virus, TRSV), tomato black ring virus (
Tomato black ring virus, TBRV), annulus zonatus (
Tomato ringspot virus, ToRSV), totally 8 kinds.Maliogka in 2004 etc. set up Comoviridae (
Comoviridae) the nido RT-PCR of (being present cowpea mosaic virus subfamily) viral general detection, but yet there are no conventional general RT-PCR detection method.The present application people seeks the conservative region on the RNA1 genome of cowpea mosaic virus subfamily again, according to conservative region sequence redesign pair of degenerate primers, by reverse transcription (reverse transcription, RT) and polymerase chain reaction technology (polymerase chain reaction, PCR) set up the general RT-PCR detection method of cowpea mosaic virus subfamily, reaction finishes rear location determination result according to the specific amplification dna fragmentation, and carries out virus identification according to the sequencing result.
Summary of the invention
The object of the present invention is to provide the general RT-PCR of a kind of cowpea mosaic virus subfamily virus to detect with degenerated primer, detection method and application thereof.Primer versatility of the present invention is good, detection method quick and precisely, for imports and exports safety provides assurance.
In order to reach above-mentioned purpose, solution of the present invention is:
The general RT-PCR of a kind of cowpea mosaic virus subfamily virus detects and uses degenerated primer, is comprised of forward and reverse primer, and the nucleotide sequence of its forward primer is seen SEQ ID No.1:5 '-TGTGAYTAYWVNVVNTTYGATGG-3 '; The nucleotide sequence of reverse primer is seen SEQ ID No.2:5 '-YTTRTCHBTVCCATCVGTAAT-3 '; Wherein, Y=C/T, W=A/T, V=G/A/C, N=A/G/C/T, R=A/G, B=G/T/C, H=A/T/C.
The detection method that the general RT-PCR of a kind of cowpea mosaic virus subfamily virus detects, comprise the steps: take the total RNA of sample as template, utilize above-mentioned primer to carry out the RT-PCR amplification, detected through gel electrophoresis amplified production after reaction finishes, according to the location determination result of amplification of DNA fragments, all can detect the dna fragmentation of 407 ~ 451 bp in the illness blade.
Described RT-PCR reaction comprises reverse transcription and two processes of pcr amplification.
The temperature of reverse transcription reaction is 42 ℃ in the reaction process of described RT-PCR, pcr amplification carry out 5 circulations with 42 ℃ of annealing temperatures first, then carry out 30 circulations with 50 ℃ of annealing temperatures, elongating temperature is 72 ℃.
Beneficial effect of the present invention is: the present invention is according to cowpea mosaic virus subfamily viral RNA 1 genome sequence design primer, and the general RT-PCR that this primer can be used for cowpea mosaic virus subfamily virus detects.Whether detection method of the present invention rapidly and accurately judgement sample has cowpea mosaic virus subfamily virus, and the primer versatility is good, detection method quick and precisely, for imports and exports safety provides assurance.
Description of drawings
Fig. 1 be the general RT-PCR method of cowpea mosaic virus subfamily virus to the specific test result of various subfamily viruses, comprise 9 kinds of Nepoviruses (
Nepovirus) virus, 7 kinds of Comoviruses (
Comovirus) virus and a kind of broad bean wilt virus belong to (
Fabavirus) virus.Namely, 1 is arabis mosaic virus (ArMV) isolate 1 sick leaf, 2 is the sick leaf of nepovirus (TRSV), 3 is annulus zonatus (ToRSV) isolate 1 sick leaf, 4 is the sick leaf of cherry leaf roll virus (CLRV), 5 is the sick leaf of tobacco black ring virus (TBRV), 6 is the sick leaf of peach rosette mosaic virus (PRMV), 7 is the sick leaf of grapevine fanleaf virus (GFLV), 8 is the sick leaf of myrtillin leave mottle virus (BLMoV), 9 is the sick leaf of raspberry ring spot virus (RpRSV), 10 is the sick leaf of bean pod mottle virus (BPMV), 11 is cowpea mosaic virus (CPMV) isolate 1 sick leaf, 12 is cowpea severe mosaic virus (CPSMV) isolate 1 sick leaf, 13 is broad bean dyeing virus (BBSV) sick leaf, 14 is the sick leaf of Flos Cucurbitae mosaic virus (SqMV), 15 is the sick leaf of red clover mottle virus (RCMV), 16 is No. 1 (BBWV1) sick leaf of broad bean wilt virus, 17 is the sick leaf of radish mosaic virus (RaMV), 18 is annulus zonatus (ToRSV) isolate 2 sick leaves, 19 is annulus zonatus (ToRSV) isolate 3 sick leaves, 20 is cowpea mosaic virus (CPMV) isolate 2 sick leaves, 21 is cowpea severe mosaic virus (CPSMV) isolate 2 sick leaves, 22 is arabis mosaic virus (ArMV) isolate 2 sick leaves, 23 is arabis mosaic virus (ArMV) isolate 3 sick leaves, and M is the DNA Mark of 100 bp.
Fig. 2 uses the result that the general RT-PCR method of cowpea mosaic virus subfamily virus detects healthy host plant.1-10 is respectively the healthy leaves of langenaria siceria, common cigarette, tomato, cucumber, pumpkin, Dolichos lablab, broad bean, cowpea, watermelon, lily.
Fig. 3 uses the result that the general RT-PCR method of cowpea mosaic virus subfamily virus detects the Bulbus Lilii syndrome leaf.1 is the detected result of healthy lily blade, and 2-6 is the detected result of morbidity lily blade, and 7 is blank, and M is the DNA Mark of 100 bp.
Embodiment
Following embodiment is used for further specifying of the present invention, but is not used for limiting the scope of the invention.
1. design of primers is with synthetic
According to the RNA1 genome sequence design primer of the downright bad stunt virus (CNSV) of sago cycas in the cowpea mosaic virus subfamily, grapevine chrome mosaic nepovirus (GCMV), GFLV, Ribes nigrum L. degeneration virus (BRV), RaMV, SqMV, BPMV, RCMV, CPMV, CPSMV, BBWV1, Broad bean wilt virus 2 (BBWV2), ArMV, TRSV, GFLV, RpRSV, TBRV, beet ring spot virus (BRSV), PRMV, ToRSV virus, primer sequence is:
SEQ ID No.1(upstream): 5 '-TGTGAYTAYWVNVVNTTYGATGG-3 ';
SEQ ID No.2(downstream): 5 '-YTTRTCHBTVCCATCVGTAAT-3 '.
For ease of order-checking, in primer, introduce respectively universal sequencing primer thing BCABESTTM Sequencing Primer RV-M and M13-47(underscore), primer sequence is:
SEQ?ID?No.1（Comov-sf-F2）：5′-
GAGCGGATAACAATTTCACACAGG?TGTGAYTAYWVNVVNTTYGATGG-3′
SEQ?ID?No.2（Comov-sf-R2）：5′-
CGCCAGGGTTTTCCCAGTCACGAC?YTTRTCHBTVCCATCVGTAAT-3′
2. the extraction of total RNA
1) get 0.1 g plant incidence of leaf, add the TRIzol(American I nvitrogen company of 1 ml) reagent, move in the 1.5 ml centrifuge tubes of sterilization, keep 5 min under the room temperature;
2) add 0.2 ml chloroform, thermal agitation 15 s, then at room temperature keep 2-15 min after, 4 ℃, centrifugal 15 min of 12000 g;
3) with the upper water phase transition in 1.5 new ml centrifuge tubes, add 0.5 ml Virahol, put upside down mixing, keep 15 min under the room temperature;
4) 4 ℃, centrifugal 10 min of 12000 g, RNA will form precipitation in sidewall and the bottom of pipe;
5) outwell supernatant liquor, add 75% washing with alcohol precipitation, then 4 ℃, centrifugal 5 min(of 7500 g suspend such as precipitation, then use 12000 g centrifugal), discard ethanol;
6) be deposited under the room temperature fully drying after, be dissolved in 40 μ l dH
2O(DEPC processes) in ,-20 ℃ save backup.
3.RT-PCR the foundation of amplification method
Take total RNA as template, carry out the RT-PCR reaction.20 μ L reaction systems are carried out reverse transcription reaction, namely add 6.75 μ L DEPC and process water, the total RNA of 4 μ L, the oligo of 1 μ L (d T) in the reaction tubes of 0.2 mL
15Primer (10 μ mol/L) (precious biotechnology (Dalian) company limited), 1 μ L dNTP mixture (10 mmol/L) (is specially dATP, dGTP, dTTP and four kinds of mixtures of dCTP, treasured biotechnology (Dalian) company limited), in 65 ℃ of maintenance 5 min, transfer to rapidly quenching 5min on ice behind the mixing; Then in reaction tubes, add 2 μ L DTT(dithiothreitol (DTT), U.S. Pu Luomaige company) (0.1 mmol/L), 4 μ L, 5 * reverse transcription damping fluid (U.S. Pu Luomaige company), 1 μ L RNA enzyme inhibitors (40 U/ μ L) (precious biotechnology (Dalian) company limited), 0.25 μ L ThermoScript II (200 U/ μ L) (U.S. Pu Luomaige company), 42 ℃ of reaction 50 min; Obtain reverse transcription product cDNA after 72 ℃ of 15 min deactivation ThermoScript II.
The PCR reaction system is 25 μ L, namely in the PCR of 0.2 mL reaction tubes, add 13.25 μ L DEPC and process water, 3 μ L cDNA, 2 μ L forward primer SEQ ID No.1(10 μ mol/L), 2 μ L reverse primer SEQ ID No.2(10 μ mol/L), the precious biotechnology (Dalian) of 10 * PCR damping fluid, 2.5 μ L(company limited), 2 μ L dNTP mixtures (2.5 mmol/L), 0.25 μ L Taq archaeal dna polymerase (5 U/ μ L) precious biotechnology (Dalian) company limited).Reaction conditions is: 95 ℃ of denaturation 3 min; 94 ℃ of sex change 50 s, 42 ℃ of annealing 50 s, 72 ℃ of extension 50 s, 5 circulations; Follow 94 ℃ of sex change 50 s, 50 ℃ of annealing 50 s, 72 ℃ of extension 50 s, 30 circulations; Last 72 ℃ are extended 7 min.Finish at the PCR instrument.
PCR reaction finishes laggard row agarose gel electrophoresis and detects, and judges whether contain cowpea mosaic virus subfamily virus in the sample according to the dna fragmentation of 407 ~ 451 bp that whether increase.Whether the present embodiment detection method rapidly and accurately judgement sample has cowpea mosaic virus subfamily virus, carries out Identification of Species according to sequence, for imports and exports safety provides assurance.The general RT-PCR of cowpea mosaic virus subfamily virus detects with degenerated primer further can make the general RT-PCR detection kit of cowpea mosaic virus subfamily virus.
The versatility of the general RT-PCR method of cowpea mosaic virus subfamily detects
Get arabis mosaic virus (ArMV), nepovirus (TRSV), annulus zonatus (ToRSV), cherry leaf roll virus (CLRV), tobacco black ring virus (TBRV), peach rosette mosaic virus (PRMV), grapevine fanleaf virus (GFLV), raspberry ring spot virus (RpRSV), myrtillin leave mottle virus (BLMoV), bean pod mottle virus (BPMV), cowpea mosaic virus (CPMV), cowpea severe mosaic virus (CPSMV), broad bean dyeing virus (BBSV), Flos Cucurbitae mosaic virus (SqMV), red clover mottle virus (RCMV), radish mosaic virus (RaMV), broad bean wilt virus 1(BBWV1) 17 kinds of viruses such as, 24 sick leaves of isolate, extract respectively total RNA by embodiment 1 method, carry out RT-PCR amplification, agarose gel electrophoresis detected result by the method for embodiment 1 again.The result infects the dna fragmentation that all detects 407 ~ 451 bp in the viral blade.Detected result as shown in Figure 1.Show that the RT-PCR method of foundation can be used for the detection of different virus kind in this subfamily, have good versatility, can be used for the general detection of cowpea mosaic virus subfamily virus.
The general RT-PCR method of cowpea mosaic virus subfamily specific detection
Get the healthy leaves of the plants such as langenaria siceria, common tobacco leaf, tomato, cucumber, pumpkin, Dolichos lablab, broad bean, cowpea, watermelon, lily, extract respectively total RNA by embodiment 1 method, carry out the RT-PCR amplification by the method for embodiment 1 again, carry out specific detection.Detected result as shown in Figure 2.The general RT-PCR method that shows foundation can't produce cross reaction with the host plant of virus, has good specificity, meets the requirement of detection.
The general RT-PCR method of cowpea mosaic virus subfamily the application in lily virus detects
Get the lily blade with similar viral symptom, extract respectively total RNA by embodiment 1 method, use primer Comov-sf-F2 and Comov-sf-R2, carry out the RT-PCR amplification by the method for embodiment 1, detect application.Detected result as shown in Figure 3.Dna fragmentation to amplification carries out direct Sequencing, and sequential analysis is indicated as arabis mosaic virus (ArMV).The general RT-PCR method that shows foundation can be used for the rapid detection of cowpea mosaic virus subfamily virus in the sample such as lily and identifies.
[0021]
Sequence table
＜110〉Inspection and Quarantine Center of Xiamen Entry-Exit Inspection and Quarantine Bureau
＜120〉the general RT-PCR of cowpea mosaic virus subfamily virus detects and uses degenerated primer
<130>
<160> 2
<170> PatentIn?version?？
<210> 1
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 1
TGTGAYTAYW?VNVVNTTYGA?TGG 23
<210> 2
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 2
YTTRTCHBTV?CCATCVGTAA?T 21
Claims (6)
1. the general RT-PCR of cowpea mosaic virus subfamily virus detects and uses degenerated primer, it is characterized in that being comprised of forward and reverse primer, and the nucleotide sequence of its forward primer is seen SEQ ID No.1:5 '-TGTGAYTAYWVNVVNTTYGATGG-3 '; The nucleotide sequence of reverse primer is seen SEQ ID No.2:5 '-YTTRTCHBTVCCATCVGTAAT-3 '; Wherein, Y=C/T, W=A/T, V=G/A/C, N=A/G/C/T, R=A/G, B=G/T/C, H=A/T/C; Described cowpea mosaic virus subfamily virus refers to arabis mosaic virus ArMV, nepovirus TRSV, annulus zonatus ToRSV, cherry leaf roll virus CLRV, tobacco black ring virus TBRV, peach rosette mosaic virus PRMV, grapevine fanleaf virus GFLV, raspberry ring spot virus RpRSV, myrtillin leave mottle virus BLMoV, bean pod mottle virus BPMV, cowpea mosaic virus CPMV, cowpea severe mosaic virus CPSMV, broad bean dyeing virus BBSV, Flos Cucurbitae mosaic virus SqMV, red clover mottle virus RCMV, radish mosaic virus RaMV and broad bean wilt virus 1 BBWV1.
2. the detection method that detects of the general RT-PCR of cowpea mosaic virus subfamily virus, it is characterized in that comprising the steps: take the total RNA of sample as template, utilize primer as claimed in claim 1 to carry out the RT-PCR amplification, detected through gel electrophoresis amplified production after reaction finishes, according to the location determination result of amplification of DNA fragments, all can detect the dna fragmentation of 407 ~ 451 bp in the illness blade; Described cowpea mosaic virus subfamily virus refers to arabis mosaic virus ArMV, nepovirus TRSV, annulus zonatus ToRSV, cherry leaf roll virus CLRV, tobacco black ring virus TBRV, peach rosette mosaic virus PRMV, grapevine fanleaf virus GFLV, raspberry ring spot virus RpRSV, myrtillin leave mottle virus BLMoV, bean pod mottle virus BPMV, cowpea mosaic virus CPMV, cowpea severe mosaic virus CPSMV, broad bean dyeing virus BBSV, Flos Cucurbitae mosaic virus SqMV, red clover mottle virus RCMV, radish mosaic virus RaMV and broad bean wilt virus 1 BBWV1.
3. the detection method that detects of the general RT-PCR of a kind of cowpea mosaic virus subfamily virus as claimed in claim 2, it is characterized in that: described RT-PCR reaction comprises reverse transcription and two processes of pcr amplification.
4. the detection method that detects of the general RT-PCR of a kind of cowpea mosaic virus subfamily virus as claimed in claim 3, it is characterized in that: the temperature of reverse transcription reaction is 42 ℃ in the reaction process of described RT-PCR, carry out 5 circulations with 42 ℃ of annealing temperatures first during pcr amplification, then carry out 30 circulations with 50 ℃ of annealing temperatures, elongating temperature is 72 ℃.
5. as claimed in claim 1 application of the general RT-PCR detection of cowpea mosaic virus subfamily virus usefulness degenerated primer, it is characterized in that: it is rear to behind the further sequencing of the dna fragmentation that increases that the total RNA of described primer pair sample carries out the RT-PCR amplification, the kind of energy Rapid identification cowpea mosaic virus subfamily virus, described cowpea mosaic virus subfamily virus is arabis mosaic virus ArMV, nepovirus TRSV, annulus zonatus ToRSV, cherry leaf roll virus CLRV, tobacco black ring virus TBRV, peach rosette mosaic virus PRMV, grapevine fanleaf virus GFLV, raspberry ring spot virus RpRSV, myrtillin leave mottle virus BLMoV, bean pod mottle virus BPMV, cowpea mosaic virus CPMV, cowpea severe mosaic virus CPSMV, broad bean dyeing virus BBSV, Flos Cucurbitae mosaic virus SqMV, red clover mottle virus RCMV, radish mosaic virus RaMV and broad bean wilt virus 1 BBWV1.
6. as claimed in claim 1 application of the general RT-PCR detection of cowpea mosaic virus subfamily virus usefulness degenerated primer, it is characterized in that: the general RT-PCR of described cowpea mosaic virus subfamily virus detects and uses degenerated primer for the preparation of the general RT-PCR detection kit of cowpea mosaic virus subfamily virus, and described cowpea mosaic virus subfamily virus is arabis mosaic virus ArMV, nepovirus TRSV, annulus zonatus ToRSV, cherry leaf roll virus CLRV, tobacco black ring virus TBRV, peach rosette mosaic virus PRMV, grapevine fanleaf virus GFLV, raspberry ring spot virus RpRSV, myrtillin leave mottle virus BLMoV, bean pod mottle virus BPMV, cowpea mosaic virus CPMV, cowpea severe mosaic virus CPSMV, broad bean dyeing virus BBSV, Flos Cucurbitae mosaic virus SqMV, red clover mottle virus RCMV, radish mosaic virus RaMV and broad bean wilt virus 1 BBWV1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110087903 CN102206714B (en) | 2011-04-08 | 2011-04-08 | Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110087903 CN102206714B (en) | 2011-04-08 | 2011-04-08 | Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102206714A CN102206714A (en) | 2011-10-05 |
| CN102206714B true CN102206714B (en) | 2013-05-01 |
Family
ID=44695772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110087903 Expired - Fee Related CN102206714B (en) | 2011-04-08 | 2011-04-08 | Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102206714B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191303B (en) * | 2016-07-08 | 2019-07-02 | 厦门出入境检验检疫局检验检疫技术中心 | A kind of pumpkin mosaic virus real-time fluorescent RT-PCR detection reagent box and its method |
| CN106148567B (en) * | 2016-07-08 | 2019-07-02 | 厦门出入境检验检疫局检验检疫技术中心 | A kind of cowpea mosaic virus subfamily virus wide spectrum detection kit and its method |
| CN107058611B (en) * | 2016-12-19 | 2020-02-04 | 云南农业大学 | Universal detection primer for tobacco mosaic virus and method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101215611B (en) * | 2008-01-11 | 2010-06-30 | 中华人民共和国厦门出入境检验检疫局 | Primer for detecting southern cowpea mosaic virus |
-
2011
- 2011-04-08 CN CN 201110087903 patent/CN102206714B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102206714A (en) | 2011-10-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | Factors affecting detection of PVY in dormant tubers by reverse transcription polymerase chain reaction and nucleic acid spot hybridization | |
| Okuda et al. | RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template | |
| CN101875982A (en) | Method for synchronously detecting multiple tobacco viruses | |
| CN102206714B (en) | Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus | |
| AU2020103434A4 (en) | Primers and kit for detecting four kiwifruit viruses of acva, acvb, cmv and accrav | |
| CN106755597B (en) | Multiplex PCR method for synchronously detecting 4 pepper viruses | |
| CN104178585A (en) | Potato virus detection primers and potato virus detection method | |
| CN103642804A (en) | Degenerate primer and method of detecting Y potyvirus virus of potato by using degenerate primer | |
| Fidan et al. | Occurrence of Alfalfa Mosaic Virus (AMV) diseases on potato crops in northern Cyprus | |
| JP6895168B2 (en) | Virus diagnostic method | |
| CN104878123A (en) | Blueberry shock virus nested RT-PCR (reverse transcription-polymerase chain reaction) detection kit and detection method thereof | |
| CN102140555B (en) | Degenerate primers for universal reverse transcription-polymerase chain reaction (RT-PCR) detection of cowpea mosaic virus and fabavirus, detection method and application thereof | |
| CN101871018B (en) | Real-time fluorescent RT-PCR method for detecting whether arabis mosaic virus, bean yellow mosaic virus and lily symptomless virus infect host | |
| CN103757138B (en) | Quick sensitive detection method of potato viruses | |
| CN103667519B (en) | Polymerase chain reaction (PCR) primer pair for identifying H9 subtype avian influenza virus and application thereof | |
| CN112574962B (en) | RT-PCR detection primer and method for aconita virus | |
| Ma et al. | Detection of three pear viruses by multiplex RT-PCR assays with co-amplification of an internal control | |
| CN113667776A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) method for detecting plantain mosaic virus in lily | |
| CN104263854B (en) | South leaf mustard mosaic virus SYBR Green I real-time fluorescent RT-PCR detection reagent box and method | |
| CN107893129A (en) | The method for detecting apple green wrinkle fruit disease poison | |
| CN102277450B (en) | Primer used for multiple detection of five quarantine nepoviruses and application thereof | |
| CN104498633B (en) | NASBA primer, test kit and the method for detection Peach latent mosaic viroid | |
| CN107164560A (en) | The special primer and method of tomato chlorisis virus in one-step method real-time fluorescent RT PCR detection single head Bemisia tabaci bodies | |
| CN111808992A (en) | Hot pepper vein mottle virus polygene joint detection and identification method | |
| CN104152588A (en) | Nested RT-PCR primer group, detection method and kit for CYVCV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130501 Termination date: 20160408 |