CN102199596A - SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) - Google Patents
SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) Download PDFInfo
- Publication number
- CN102199596A CN102199596A CN 201110058591 CN201110058591A CN102199596A CN 102199596 A CN102199596 A CN 102199596A CN 201110058591 CN201110058591 CN 201110058591 CN 201110058591 A CN201110058591 A CN 201110058591A CN 102199596 A CN102199596 A CN 102199596A
- Authority
- CN
- China
- Prior art keywords
- resistant
- brown planthopper
- bph20
- gene
- byl8
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a molecule marker of brown planthopper resistant gene. According to the present invention, through the hybridization and backcrossing of a resistant parent RBPH54 and a susceptible variety TN1, progenies are obtained. Through respective resistance identifications and molecule genetic linkage analysis of the progeny strains, a brown planthopper resistant major recessive gene bph20(t) is obtained. Two nearest molecule markers linked beside bph20(t) are BYL7 and BYL8, which are self-developed SSR markers. The distances from the markers to bph20(t) are 1.3cM and 1.2 cM. With molecule markers linked to the brown planthopper resistant gene, the detection can be carried out to detect whether the pest resistant variety RBPH54 or the derivative varieties (systems) of RBPH54 contain the pest resistant genetic locus. Therefore, the selection of brown planthopper resistant paddy varieties or paddy qualities can be substantially improved in efficiency.
Description
The application is to be on November 20th, 2008 applying date, and application number is: 200810226943.0, and denomination of invention is divided an application for the patent application of " anti-Nilaparvata lugen (brown planthopper) major gene and molecule marking method and application ".
Technical field
The present invention relates to the molecular genetics field, be specifically related to the molecule marker of paddy rice brown planthopper resistant major gene, can be used for the seed selection of the utilization of paddy rice brown planthopper resistant germ plasm resource and kind and insect-resistance and identify or the like the aspect.
Technical background
Brown paddy plant hopper is one of the most serious insect in Rice Production district (Cheng Xia etc., 2003; Pathak, 1972; Dyck et al., 1979; Sogawa, 1982).Facts have proved that utilizing varietal resistance is one of the control brown paddy plant hopper optimal path of causing harm (Pathak, 1969; Sogawa, 1982).Therefore, finding and identify new brown paddy plant hopper resistant gene, cultivate the rice varieties with durable resistance, is the key point of utilizing varietal resistance control brown paddy plant hopper to cause harm, and the Fine Mapping of antagonism gene is a basic prerequisite of utilizing resistant gene.Yet along with applying of insect-proof rice kind, the brown paddy plant hopper true tumor type that can overcome varietal resistance also occurs immediately, becomes a main difficult problem that faces in brown paddy plant hopper control and the breeding for pest resistance work.The sixties in last century, genetic breeding scholar and entomologist have set about Screening and Identification brown paddy plant hopper resistant gene resource, seed selection resistant rice kind.Up to now, successively identify at least 23 main resistant genes of imitating, wherein located (Su Changchao etc., 2003 by molecule for 17; Yang et al., 2004; Yang et al., 2005; Chen et al., 2006).On the 2nd karyomit(e), just located 1 resistant gene Bph13 (t) (Liu et al., 2001) at present.On the 3rd karyomit(e), 3 resistant gene Bph13 (t), Bph14 and bph19 (t) (Renganayaki et al., 2002 have been located at present; Huang et al., 2001; Chen et al., 2006).On the 4th karyomit(e), located 3 resistant gene Bph3, Bph12 (t) and Bph15 (yellow towards cutting edge of a knife or a sword 2003, Yang et al., 2002; Huang et al., 2001).On the 6th karyomit(e), 2 recessive resistant genes (Kawaguchi et al., 2001 have been located at present; Yang et al., 2005).On the 9th karyomit(e), up to the present, only located 1 dominance resistant gene, but do not given unnamed gene (Mei et al., 1996) as yet.On the 11st karyomit(e), up to now, also only located 1 dominance resistant gene, do not name (Jena et al., 2002) to gene yet.On the 12nd karyomit(e), present oriented resistant gene is maximum, always have 5, be Bph1 (Hirabayashi et al., 1995), bph2 (Murata et al., 1998), bph9 (Murai et al., 2001), Bph10 (t) (Ishii et al., 1994) and Bph18 (t) (Jena et al., 2005).
At present, partial resistance gene such as Bph1, bph2 and Bph3, by successful Application in the paddy rice resistance breeding, and when the beginning big area is promoted, played the effect of control brown paddy plant hopper harm really.But along with the appearance of brown paddy plant hopper true tumor type, the resistance stability of being controlled by major gene changes (Kenmore et al., 1984) to some extent.Therefore, screening, the how useful resistant gene of searching are applied to gene pyramiding from now on, cultivate more effective, as to have durable broad spectrum resistance improved seeds (being), are research purpose meanings of the present invention.
Summary of the invention
The object of the present invention is to provide the molecule marking method of brown planthopper resistant gene in rice, by detecting these and the chain molecule marker in brown paddy plant hopper resistant gene site, can predict the resistance of rice plant to brown paddy plant hopper, thus for the brown paddy plant hopper resistance breeding provide may.
The present invention finds two brown planthopper resistant gene sites by research paddy rice resistant variety RBPH54, is respectively bph20 (t) and bph21 (t), and they control the resistance of paddy rice brown planthopper resistant jointly.
Wherein, brown planthopper resistant gene site bph20 (t) and following molecule marker close linkage:
SSR mark BYL7:
5 ' rectifies to primer sequence AAGCTAGGGAATCAGCGGTTA
3 ' end reverse primer sequence TGTGGCATGTCACTCACTCAC
Or SSR mark BYL8:
5 ' rectifies to primer sequence CCCACTTCCACAACCACA
3 ' end reverse primer sequence A TGCTCCTAGCTTCCTATTCC
The amplifying rice genomic dna, if can amplify the amplified fragments of 142bp with primer BYL7, or amplify the amplified fragments of 190bp with primer BYL8, indicate that then rice varieties contains brown planthopper resistant gene site bph20 (t), this gene is positioned on the 6th chromosomal galianconism, chain with BYL7 and BYL8, and be positioned at BYL7 and BYL8 between the two, be respectively 1.3cM and 1.2cM with both distance.
The present invention also provides the molecule marking method of above-mentioned brown planthopper resistant gene site bph20 (t), it is to utilize SSR labeled primer BYL7 and/or BYL8 amplifying rice genomic dna, judges by amplification whether this rice varieties contains brown planthopper resistant gene site bph20 (t).
Wherein, brown planthopper resistant gene site bph21 (t), and following molecule marker close linkage:
SSR mark RM222:
5 ' rectifies to primer sequence: CTTAAATGGGCCACATGCG
3 ' end reverse primer sequence C AAAGCTTCCGGCCAAAAG
Or SSR mark RM244:
5 ' rectifies to primer sequence CCGACTGTTCGTCCTTATCA
3 ' end reverse primer sequence C TGCTCTCGGGTGAACGT
The amplifying rice genomic dna, if can amplify the amplified fragments of 213bp with primer RM222, or amplify the amplified fragments of 163bp with primer RM244, indicate that all rice varieties contains brown planthopper resistant gene site bph21 (t), this gene is positioned on the 10th chromosomal galianconism, chain with RM222 and RM244, and be positioned at RM222 and RM244 between the two, be respectively 7.9cM and 4.0cM with both distance.
The present invention also provides the molecule marking method of above-mentioned brown planthopper resistant gene site bph21 (t), it is to utilize SSR labeled primer RM222 and/or RM224 amplifying rice genomic dna, judges by amplification whether this rice varieties contains brown planthopper resistant gene site bph20 (t).
The present invention also provides the method for the above-mentioned resistant gene of screening site mark, and it comprises the steps:
(1) uses the two generations selfing and must BC again of reestablishing diplomatic relations after rice varieties RBPH54 and the TN1 hybridization
2F
2Colony carries out insect-resistance to the offspring and identifies, identifies that through resistance the back resistance shows preferably 300 individualities as mapping population;
(2) DNA of extraction parent and mapping population is with BC
2F
2Colony is as mapping population, from more than 2840 the SSR primer that covers rice genome, choose at interval about 10～15cM and 229 pairs of primers that are evenly distributed on 12 karyomit(e)s of paddy rice are analyzed, be used for polymorphism screening between the parent, use the analysis that the molecule marker that polymorphism is arranged is used for segregating population then;
(3) according to the molecule marker polymorphism, in conjunction with segregating population resistant phenotype parameter, carry out the genetic linkage analysis of anti insect gene and molecule marker with the Mapmaker/QTL3.0 mapping software, LOD 〉=3.0 obtain linkage map;
(5), determine that the resistant gene bph20 (t) in RBPH54 is chain with molecule marker RM435, RM589, RM586, RM588, RM190, RMR540, BYL7 and BYL8 according to linkage map; Bph21 (t) is chain with molecule marker RM222, RM311, RM5348 and RM244.Therefore, RM435, RM589, RM586, RM588, RM190, RMR540, BYL7 and BYL8 are the molecule marker primer of brown planthopper resistant gene site bph20 (t), and RM222, RM311, RM5348 and RM244 are the molecule marker primer of brown planthopper resistant gene site bph21 (t).
Beneficial effect:
(1): find two brown planthopper resistant recessive gene site bph20 (t) and bph21 (t) that derive from common wild-rice, these two genes are controlled the resistance of resistant material RBPH54 simultaneously, their antagonistic repeat functions that act as.
(2): located above-mentioned two resistant gene sites, wherein bph20 (t) and SSR molecule marker BYL7 and BYL8 are chain, and are positioned at BYL7 and BYL8 between the two, with both genetic distance with two marks be 1.3cM and 1.2cM; Bph21 (t) and SSR molecule marker RM222 and RM244 are chain, and are positioned at RM222 and RM244 between the two, with both be respectively 7.9cM and 4.0cM with marking path.
(3): the discovery of these two resistant genes and location, can be used for the seed selection work of rice varieties brown planthopper resistant, by molecular mark, by gene pyramiding a plurality of genes gatherings are obtained high-quality resistance of wide spectrum breeding material together, can improve breeding efficiency greatly, delay the forfeiture of varietal resistance simultaneously.
Description of drawings
Fig. 1. rice varieties RBPH54 brown planthopper resistant gene site bph20 (t) and molecule marker linkage map;
Fig. 2. rice varieties RBPH54 brown planthopper resistant gene site bph21 (t) and molecule marker linkage map.
Specific embodiments
The present invention is brown paddy plant hopper resistant gene bph20 (t) and the bph21 (t) that finds two recessiveness from resistant material RBPH54, this resistant material has the resistance of wide spectrum, double brown planthopper resistant biotype II and Bangladesh's type etc., the discovery of resistance of wide spectrum material and be applied in great function is arranged in the resistance breeding, and in the discovery and basis, molecule marker location in resistant gene site, can carry out the polymerization of autotelic anti insect gene, seed selection pest-resistant cultivar by the molecular mark technology.And the resistant material RBPH54 among the present invention can be used as the germ plasm resource of resistance breeding, uses simultaneously with the material of the chain molecule marker of resistant gene to pest-resistant breeding process and screens, and can improve breeding efficiency greatly.
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.
Embodiment 1
Materials and methods
1. material is selected
The RBPH54 insect-resistance identifies that the back finds that it has stronger brown planthopper resistant characteristic, therefore it as the parent, with sense worm kind TN1 hybridization, the selfing of backcrossing again after the hybridization, each is all identified through insect-resistance for plant.(RBPH54 and TN1 are available from Institute of Plant Protection, academy of agricultural sciences, Guangxi)
2. insect-resistance is identified
The standard seedling dish sieve method SSST (IRRI, 1988) that the authentication method of brown paddy plant hopper resistance uses with reference to the International Rice Research Institute, and make certain modification.The soil of the usefulness of growing seedlings is taken from rice field table soil, and after preliminary treatment, the soil of getting the shale homogeneous is used to grow seedlings.The rice paddy seed 24h that is soaked in water under 25 ℃ cleans, is sowed in the enamel seedling dish that fills above-mentioned soil after the vernalization.Every dish is broadcast 10 kinds, and each kind is broadcast 20-30 grain seed.Pest-resistant check variety ASD7 and sense worm contrast TN1 are broadcast in the centre.After planting, earthing, and place growth in the solarium.Normal management between nursery stage.Brown paddy plant hopper identifies that population is biological II type.
In 3.5～4 leaf phases of rice shoot, remove weak seedling, seedling, remaining 20 seedlings that stay connect the worm evaluation.Connect before the worm and the seedling basin to be transferred to (it is dark that water will soak rice shoot 0.5～1cm, with the maintenance high humidity, is beneficial to the growth of rice shoot and worm, and prevents intrusions such as ant and spider in the tank that is marked with water.Connect worm on the cover and identify cage, average every strain rice shoot connects 5～7 1-2 nymphs in age, equably worm is released to when connecing worm to connect in the worm cage as far as possible.When sense worm check variety TN1 death reaches 100% when above, investigate each strain victimization state of each kind, the rank of being injured is added up by table 1.The rank of on average being injured of each rice varieties adopts following method to calculate: the final resistance rank of each plant of each rice varieties that adds up, and again divided by total plant number of this kind.According to the rank of on average being injured, adopt the grading standard of Academy of Agricultural Sciences Institute of Plant Protection, Guangxi revision, determine the resistance rank of each kind, that is: 0 grade: immunity; 1 grade: high anti-(0.1～1.9); 3 grades: anti-(2.0～3.9); 5 grades: in anti-(4.0～5.9); 7 grades: middle sense (6.0～7.9); 9 grades: high sense (8.0～9.0) (Wei Sumei etc., 1994,1998).
Resistance is identified and is established 1～3 repetition, the comprehensive resistance of analysis of material, and according to resistance rank supposition genotype.
Table 1 paddy rice is to the judgement criteria of brown paddy plant hopper resistance
3. the foundation of mapping population
Total has developed BC
2F
2Colony is strain more than 900, identifies through three multiple resistances in seedling stage, and 300 strains of finally having selected extreme resistance and extreme perception are as mapping population.
4. resistant gene is located
(1) the SSR mark is selected
According to http://genome.cornell.edu/ric, the synthetic SSR primer information that provides is provided for http://www.gramene.org and the SSR correlated series of announcing in 2002, from more than 2840 the SSR primer that covers rice genome, choose at interval about 10～15cM and 229 pairs of primers that are evenly distributed on 12 karyomit(e)s of paddy rice are analyzed, be used for polymorphism screening between the parent, will have polymorphic molecule marker to be used for the analysis of segregating population.
(2) extraction of DNA and preparation
The extraction of DNA is carried out with simple and easy CTAB extraction process.Detailed process is as follows: get 1～2 spire in top at each individual plant of Sheng phase of tillering, be stored in-80 ℃ of refrigerators standby.Get the blade that is about 3～5cm during extracting DNA and put into mortar, the adding liquid nitrogen fully is ground to Powdered, is transferred in the 2ml centrifuge tube, the CTAB extract that adds 500～600 μ l preheatings, be positioned over 65 ℃ of water bath heat preservation 40～50min, during carefully shake centrifuge tube frequently, in order to avoid agglomerating; Add the about 1ml of chloroform/primary isoamyl alcohol (24: 1) then, vibration 10min, fully behind the mixing in the centrifugal 10min of 12000rpm, supernatant is transferred in another 1.5ml centrifuge tube, add two volumes chloroform/primary isoamyl alcohol (24: 1), vibration 5min, in the centrifugal 10min of 12000rpm, supernatant is transferred to and adds double precooling dehydrated alcohol in another 1.5ml centrifuge tube behind the abundant mixing, being placed to DNA under 4 ℃ separates out, the centrifugal 3min of 12000rpm removes supernatant liquor, with twice of 75% ethanol rinsing, abandon ethanol, appropriateness is air-dry, adds 100～200 μ l TE (10mMTris-HCl pH8.0,1mM EDTA) dissolving.Extractive DNA is positioned over 4 ℃ of refrigerator and cooled and hides standby.Being put in-20 ℃ of refrigerator and cooled as the need prolonged preservation hides.
(3) pcr amplification and electrophoresis
Pcr amplification is revised a little according to the method for Panaud et al. (1996) and is carried out.The primer, 250 μ M dNTP, 1 * PCR reaction buffer (50mM KCl, 10mM Tris-HCl pH8.3, the 1.5mM MgCl that comprise 0.10 μ M in the 20 μ l reaction systems
2), the dna profiling of 50～100ng, 1UTaq enzyme.Be reflected in the Tgradient PCR instrument and carry out.Response procedures is: 94 ℃ of pre-sex change 5min, and circulation (94 ℃ of 1min, 51-61 ℃ 1min, 72 ℃ of 1min) 41 times, last 72 ℃ are extended 5-10min.According to the characteristic of primer, annealing temperature is made corresponding modification.Pcr amplification product separates in 6% sex change (or neutral) polypropylene amine gel electrophoresis.Analyze with Silver Nitrate argentation dyeing back interpreting blueprints behind the electrophoresis.
(4) assignment of genes gene mapping
Be the Rapid identification resistant gene, the template of screening that serves as a mark the pest-resistant parent of this example application, sense worm parent and anti insect gene pond 15R and sense worm gene pool 15S increases, 229 pairs of SSR primers of the rice chromosome of selecting with (1) are amplimer, seek the mark that polymorphism is arranged.For the accuracy of the mark that guarantees to sift out, to preliminary screening to mark further confirm with the individual plant of two parents and mapping population, seek and the chain candidate's mark of resistant gene.Candidate's mark adopts recessive population analysis method (recessive-class analysis, RCA after determining; Zhang et al., 1994; Pan et al., 2003) carry out linkage analysis.According to the molecule marker polymorphism,, carry out the genetic linkage analysis of anti insect gene and molecule marker, LOD 〉=3.0 with the Mapmaker/QTL3.0 mapping software in conjunction with segregating population resistant phenotype parameter.
(5) the further location in resistant gene site
According to the result of resistant gene site Primary Location, the present invention is by the BIA method, and at the purpose regional search in resistant gene site and develop the mark of PCR-based, the antagonism gene locus carries out Fine Mapping.Concrete grammar is as follows: on the one hand, use the little satellite of international paddy rice and initiate tissue (International Rice Microsatellite Initiative, IRMI) public database of being announced (http://www.gramene.org), in the covering of demarcating by the linked marker in resistant gene site search new SSR mark in the zone in resistant gene site.On the other hand, from Japanese paddy rice genome research plan (Rice Genome Research Program, Japan, RGP) the middle download of database (http://rgp.dna.affrc.go.jp) with reference to the sequence that the fine PAC/BAC of kind (reference cultivar) Japan clones, is carried out PCR-based primer design according to this sequence information by the japonica rice of IRGSP release.Detailed process is as follows: at first the sequence that the PAC/BAC that downloads is cloned is carried out format conversion with DNAStart software, removes numeral, just carries out next step operation then.For the SSR mark, then utilize tumor-necrosis factor glycoproteins search software SSRIT (Simple Sequence Repeat Identification Tool) (http://www.gramene.org/db/searches/ssrtool) to carry out the search of microsatellite sequence, better (the general requirement repeat number is more than 8 to select repeating unit then, for GA/CT repeats, avoid AT to repeat as far as possible), microsatellite sequence that tumor-necrosis factor glycoproteins length is long, utilization include this microsatellite sequence a bit of genome sequence (500～600bp), carry out the PCR primer design.With the SSR mark called after BYL that developed * *.
Above-mentioned all SSR molecule marker primer design are all used Primer Premier 5.0 (http://www.premierbiosoft.com) software, the primer general requirement GC content of design is between 45～65%, annealing temperature (Tm) is between 50～65 ℃, primer sequence length is between 18～25bp, and avoid mispairing, dimer and hairpin structure etc. as far as possible, and in GenBank, detect the specificity of sequence, that is to say and avoid and other chromosome sequence homology of rice genome.Designed primer is given birth to precious biotinylated biomolecule technology company of worker biotech company and Dalian by Shanghai and is synthesized.The amplification system of SSR mark and amplification program and detection method are with above-mentioned (3).
Result and analysis
1. from qualification result, in all expert evidences, F
1Colony all shows as sense worm material, according to F
1It is by recessive gene control that phenotype is tentatively judged the resistance of these materials for the phenotype of sense worm and other colony entirely, and the supposition insect-resistance is by major gene control and find that it is recessive gene (table 2).
2. in 229 pairs of SSR primers, have 215 pairs of amplified production are arranged between parents, account for 89%, 24 couple of no amplified production accounts for 11%.Wherein have polymorphism, and can amplify have 97 pairs of stable band, account for 42% of total primer, do not have 108 couple of polymorphism, account for 47% of total primer.The dna fragmentation size of these 97 pairs of primer amplifications is between 100bp-400bp.
By the BSA method 97 pairs of polymorphism SSR primers have been carried out preliminary screening, 2 marks are wherein arranged, promptly the 6th chromosomal SSR mark RM589 and the 10th karyomit(e) RM311 simultaneously show polymorphism preferably in two anti-, sense gene pools, therefore tentatively they are decided to be candidate's mark.
Table 2TN1 (P
1)/RBPH54 (P
2) filial generation separates the genetics of resistance of brown paddy plant hopper II
* R-resistance; The S-perception; The P-test value is averaged.
In order further to determine these 2 candidate's marks, we have screened the individuality that constitutes mapping population respectively one time one by one.The result shows that these 2 marks are all chain with anti insect gene.The gene locus of preliminary in view of the above definite this material brown planthopper resistant proterties of control has two, and one (RM589) at the 6th karyomit(e), another (RM311) is on the 10th karyomit(e).
By the gained result, we think that tentatively the insect-resistance of this resistant material controlled by two major gene locis.On the 6th karyomit(e), published an anti insect gene bph4 (Kawaguchi et al., 2001), mark RM217 and RM225 on bph4 and the 6th karyomit(e) are chain, through we with RM217 and RM225 to we the parent and anti-ly feel gene pool and mapping population detects, find that two parents all do not have polymorphism between RM217 and RM225, and the genetic distance between these two marks and RM589 differs to be had more than the 15cM approximately, so we think the gene that resistant gene site on the 6th karyomit(e) that institute finds and identifies among the present invention and bph4 are different loci, promptly be a new resistant gene site, temporary transient called after bph20 (t).Simultaneously, because the recessive major gene of the brown planthopper resistant of on paddy rice the 10th chromosomal galianconism, also not publishing at present, therefore, brown paddy plant hopper resistant gene site on the 10th karyomit(e) that we think in this research to be identified also is a new resistant gene site, temporary transient called after bph21 (t).
Respectively one by one after the screening, find a plurality of and the chain SSR primer (table 3) in resistant gene site by the BSA method and to the individuality of mapping population.By analyzing, they with the resistant gene site distance distinguish as follows: RM589, RM586, RM588, RM190 all are positioned at the side of gene bph20 (t), are respectively 4.1cM, 4.7cM, 6.2cM and 10.2cM (Fig. 1) with the genetic distance of bph20 (t).RM244, RM5348 and RM311 are positioned at the same side of bph21 (t), with the distance of bph21 (t) be 4.0cM, 8.1cM and 16.3cM, RM222 is positioned at the opposite side of bph21 (t), with the genetic distance of this gene be 7.9cM (Fig. 2).
Table 3 from the IRMI database with two SSR marks that resistant gene is chain
3. in order to locate the resistant gene site more subtly, from the sequence data of IRGSP issue, downloaded the sequence that has comprised bph20 (t) site that is defined by nearby mark RM540 and RM435 from the fine BAC clone of reference kind Japan.10 pairs of SSR primers have been designed altogether according to this sequence data.The result that mapping population is detected shows, independently developed SSR primer BYL7 and BYL8 and resistant gene bph20 (t) chain (table 4, Fig. 1) are positioned at the both sides (Fig. 1) of this resistant gene, with the distance of gene locus bph20 (t) be respectively 1.3cM and 1.2cM.
Table 4 is the independently developed and chain new primer mark of bph20 (t) according to the Nipponbare sequence
The checking of embodiment 2 molecule markers
1, material and method
1.1 material
Negative kind: non-resistant gene kind, perceptual kind TN1
Positive kind:: contain resistant gene, be resistant variety: RBPH54 and ASD7 (available from Institute of Plant Protection, academy of agricultural sciences, Guangxi)
It is synthetic that molecule marker primer: BYL7 and BYL8 and RM222 and RM244 transfer to the living worker in Shanghai respectively.
1.2 method
The CTAB extraction process extracts paddy rice sample gene group DNA (method is with embodiment 1).Respectively with the anti-BYL7 of primer and BYL8 and RM222 and RM244 amplification sample DNA.The primer, 250 μ M dNTP, 1 * PCR reaction buffer (50mMKCl, 10mM Tris-HCl pH8.3, the 1.5mM MgCl that comprise 0.10 μ M in the reaction system
2), the dna profiling of 100ng, 1UTaq enzyme.Be reflected in the Tgradient PCR instrument and carry out.Response procedures is: 94 ℃ of pre-sex change 5min, and circulation (94 ℃ of 1min, 51-61 ℃ 1min, 72 ℃ of 1min) 41 times, last 72 ℃ are extended 10min.According to the characteristic of primer, annealing temperature is made corresponding modification.Pcr amplification product separates in 6% sex change (or neutral) polypropylene amine gel electrophoresis.Analyze with Silver Nitrate argentation dyeing back interpreting blueprints behind the electrophoresis.
2, result:
Use aforesaid method, respectively each ten parts of different sample of rice varieties RBPH54 and ASD7 and five parts of different samples of TN1 are increased.The result shows, all can amplify the fragment of 142bp and 190bp and 213bp and 163bp respectively in positive sample, and all can not amplify these fragments in negative sample.
Explanation thus, molecule marking method provided by the invention can accurately filter out the major gene that contains brown planthopper resistant, thereby improves breeding efficiency greatly.
Claims (3)
1. the SSR molecule marker primer BYL8 of brown planthopper resistant major gene loci bph20 (t), its sequence is:
5 ' rectifies to primer sequence CCCACTTCCACAACCACA
3 ' end reverse primer sequence A TGCTCCTAGCTTCCTATTCC.
2. the molecule marking method of brown planthopper resistant major gene is characterized in that:
With the described molecule marker primer of claim 1 BYL8 amplifying rice genomic dna, can amplify the amplified fragments of 190bp, indicate that then rice varieties contains brown planthopper resistant major gene loci bph20 (t).
3. the application of the described molecule marker primer of claim 1 BYL8 in seed selection brown planthopper resistant rice varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110058591 CN102199596B (en) | 2008-11-20 | 2008-11-20 | SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110058591 CN102199596B (en) | 2008-11-20 | 2008-11-20 | SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102269430A Division CN101403011B (en) | 2008-11-20 | 2008-11-20 | Anti-nilaparvata lugens major gene, molecular mark method and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102199596A true CN102199596A (en) | 2011-09-28 |
| CN102199596B CN102199596B (en) | 2013-02-20 |
Family
ID=44660583
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110058591 Expired - Fee Related CN102199596B (en) | 2008-11-20 | 2008-11-20 | SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102199596B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509791A (en) * | 2013-07-31 | 2014-01-15 | 江西省农业科学院水稻研究所 | Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof |
| CN104328168A (en) * | 2014-09-26 | 2015-02-04 | 广西大学 | Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof |
| CN104342437A (en) * | 2014-09-26 | 2015-02-11 | 广西大学 | Molecular mark of rice brown planthopper inhibition major gene qBph29(t) and application of molecular mark |
| CN106399468A (en) * | 2016-05-23 | 2017-02-15 | 广西大学 | Rice early-heading main-effect QTL molecular markers, identifying method thereof, and applications of molecular markers and identifying method |
| CN109652577A (en) * | 2016-02-04 | 2019-04-19 | 山东省农业科学院生物技术研究中心 | SSR molecular marker L08 and application with the high bar QTL close linkage of rice |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896282A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site |
-
2008
- 2008-11-20 CN CN 201110058591 patent/CN102199596B/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509791A (en) * | 2013-07-31 | 2014-01-15 | 江西省农业科学院水稻研究所 | Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof |
| CN103509791B (en) * | 2013-07-31 | 2016-03-16 | 江西省农业科学院水稻研究所 | The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof |
| CN104328168A (en) * | 2014-09-26 | 2015-02-04 | 广西大学 | Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof |
| CN104342437A (en) * | 2014-09-26 | 2015-02-11 | 广西大学 | Molecular mark of rice brown planthopper inhibition major gene qBph29(t) and application of molecular mark |
| CN104328168B (en) * | 2014-09-26 | 2017-02-22 | 广西大学 | Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof |
| CN109652577A (en) * | 2016-02-04 | 2019-04-19 | 山东省农业科学院生物技术研究中心 | SSR molecular marker L08 and application with the high bar QTL close linkage of rice |
| CN106399468A (en) * | 2016-05-23 | 2017-02-15 | 广西大学 | Rice early-heading main-effect QTL molecular markers, identifying method thereof, and applications of molecular markers and identifying method |
| CN106399468B (en) * | 2016-05-23 | 2019-05-31 | 广西大学 | Rice early heading main effect QTL molecular labeling and its identification method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102199596B (en) | 2013-02-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | QTL mapping of domestication-related traits in soybean (Glycine max) | |
| Kumar et al. | Mendelization and fine mapping of a bread wheat spot blotch disease resistance QTL | |
| Imam et al. | Molecular screening for identification of blast resistance genes in North East and Eastern Indian rice germplasm (Oryza sativa L.) with PCR based makers | |
| Nguyen et al. | Mapping of quantitative trait loci associated with resistance to Phytophthora sojae and flooding tolerance in soybean | |
| Liu et al. | Development and characterization of wheat-Ae. searsii Robertsonian translocations and a recombinant chromosome conferring resistance to stem rust | |
| Angaji et al. | QTLs associated with tolerance of flooding during germination in rice (O ryza sativa L.) | |
| Warnke et al. | Genetic linkage mapping of an annual× perennial ryegrass population | |
| Burnham et al. | Quantitative trait loci for partial resistance to Phytophthora sojae in soybean | |
| Zhu et al. | Mapping resistance to spot blotch in a CIMMYT synthetic-derived bread wheat | |
| Peng et al. | Microsatellite high-density mapping of the stripe rust resistance gene YrH52 region on chromosome 1B and evaluation of its marker-assisted selection in the F2 generation in wild emmer wheat | |
| Yan et al. | Identification and characterization of a major QTL responsible for erect panicle trait in japonica rice (Oryza sativa L.) | |
| Hari et al. | Marker‐assisted improvement of a stable restorer line, KMR‐3R and its derived hybrid KRH2 for bacterial blight resistance and grain quality | |
| Luu M et al. | Application of marker assisted backcrossing to introgress the submergence tolerance QTL SUB1 into the Vietnam elite rice variety-AS996 | |
| Chen et al. | Identification and fine-mapping of a major QTL conferring resistance against head smut in maize | |
| Turrini et al. | Large variation in mycorrhizal colonization among wild accessions, cultivars, and inbreds of sunflower (Helianthus annuus L.) | |
| Li et al. | Quantitative trait loci controlling barley powdery mildew and scald resistances in two different barley doubled haploid populations | |
| Kabelka et al. | Localization of two loci that confer resistance to soybean cyst nematode from Glycine soja PI 468916 | |
| Jingade et al. | Development of molecular map and identification of QTLs linked to Fusarium wilt resistance in chickpea | |
| CN102199596B (en) | SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) | |
| CN101403011B (en) | Anti-nilaparvata lugens major gene, molecular mark method and uses thereof | |
| Capuozzo et al. | Inheritance analysis and identification of SNP markers associated with ZYMV resistance in Cucurbita pepo | |
| Chakraborty et al. | Linkage map construction in allotetraploid creeping bentgrass (Agrostis stolonifera L.) | |
| Anjani et al. | Identification of simple‐sequence‐repeat markers linked to Fusarium wilt (Fusarium oxysporum f. sp. carthami) resistance and marker‐assisted selection for wilt resistance in safflower (Carthamus tinctorius L.) interspecific offsprings | |
| Martin et al. | Identification and mapping of net form of net blotch resistance in South African barley | |
| US11612120B2 (en) | Powdery mildew resistant pepper plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130220 Termination date: 20141120 |
|
| EXPY | Termination of patent right or utility model |