CN102183643A - Kit for distinguishing and diagnosing capripox field virus infection, preparation and detection method thereof - Google Patents

Abstract

The invention discloses an ELISA (Enzyme-Linked Immunosorbent Assay) antibody detection kit for distinguishing and diagnosing capripox field virus infection. The indirect ELISA antibody detection kit for distinguishing and diagnosing capripox field virus infection, disclosed by the invention, is internally provided with a coated antigen ELISA antibody detection board and an ELIAS secondary antibody, wherein the coated antigen is a mixture of a recombination capripox virus ORF95 protein and an ORF103 protein. The recombination proteins of ORF95 and ORF103, adopted by the invention, are convenient to prepare and purify in large quantities. The kit disclosed by the invention has a strong specificity, can effectively exclude the interference of the capripox attenuated-vaccine immunity, and specifically detects the capripox field virus infection.

Description

The kit of antidiastole sheep pox wild virus infection and preparation and detection method

Technical field

The present invention relates to a kind of diagnostic kit, is a kind of ELISA antibody assay kit that is used for antidiastole sheep pox wild virus infection exactly, and the ELISA antibody test plate and the ELIAS secondary antibody of envelope antigen arranged in the kit.

Background technology

Sheep pox (Capripox) has another name called sheep " smallpox ", is a kind of acute, hot, the contagious disease that is caused by capripox virus.Hansen reported first in 1879 goatpox of Norway, China has successively found the popular of sheep pox and goatpox in the forties in 20th century.Capripox virus can cause goatpox (goatpox), sheep pox (sheeppox) and lumpy skin disease piece disease (lumpy skin disease, LSD.This sick principal character is heating, does not have hair and lack hair position skin and mucosa generation papule and bleb, internal organ pathology (particularly lung) and even death.Sheep pox is pathogenic the most serious a kind of in all animal poxvirus, infectiousness with height, can cause pregnant ewe miscarriage, lamb death, and atypia symptom and secondary, accompanying infection arranged, classified as the category-A serious infectious diseases by OIE (OIE), China classifies them as class Animal diseases.Sheep pox is widely current China, has already caused enormous economic loss not only for China's sheep husbandry and fur manufacturing, has also had a strong impact on the development of international trade and sheep husbandry.

At present, the diagnostic method of sheep pox is more, but also all there are a lot of problems in these methods.Traditional laboratory diagnosis will be by electron microscope, but capripox virus is similar on form to infectiousness dermatitis impetiginosa virus, is difficult to distinguish.Agar diffusion experiment (AGID) can be used for the Detection of antigen of capripox virus, but this antigen and parapoxvirus have cross reaction.Indirect fluorescent antibody experiment (IFAT) exists darker background color and nonspecific reaction, and simultaneously, this method can not be distinguished sheep aphtha (orf), ox pustular Stomatovirus.Virus neutralization tests (VNT) is to detect the stronger serological diagnostic method of capripox virus specificity, also is the alternative diagnostic test (sheep pox does not still have the appointment serological diagnostic method at present) of " International Animal Health code " requirement at present.Yet after infecting, sheep pox, only produces low-level neutralizing antibody after the animal contact cause of disease, so virus neutralization tests susceptibility is not high mainly based on cellular immunity.Western trace test is with the have a blood test specific antibody of virus structural protein in the final proof product of the cytolysis quality testing that capripox virus infects, and have susceptibility and specificity preferably, but this test costs an arm and a leg complex operation.

Enzyme linked immunosorbent assay (ELISA) now has been widely used in the detection of many antigen-antibodies because of advantages such as it is easy to operate, quick, responsive, high specificities.Sharm in 1988 uses the goatpox crust and makes the indirect ELISA method that crude antigen has been set up goatpox antibody, referring to Sharm S N, Negi B S.Yadav M P.et al.Application of ELI SA in the detection of goat pox antigen and antibodies.Acta Virologica, 1988,32:65-69, but the background values of test is too high, is prone to false positive results.Rao had set up the immunocapture ELISA that detects capripox virus antigen in 1997, referring to Rao T.V.S.Nandi.Evalution of immunocaputure ELISA for diagnosis of goatpox.Acta Virologica, 1997,41:345-348, but this method has certain restriction when using separately, need just can make a definite diagnosis with the counter immunoelectrophoretic test common application.The having of application of purified done antigen than the recombinant protein of strong antigen and carried out ELISA and can improve its susceptibility, Heine utilized the capripox virus P32 albumen of expressing to achieve success for antigen carries out ELISA in 1999, referring to Heine H G, et al.A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32the homolog of the vaccinia virus H3L gene.Journal ofImmunological Methods, 1999,227:187-196, yet P32 protein Preparation difficulty is very big, has limited the application of this ELISA method.Therefore, screening can be stablized and the strong antigen gene of the immunogenicity of great expression is a key of setting up reliable ELISA method.

The prevention of sheep pox mainly relies on the immunity inoculation of vaccine, and inactivated vaccine has safe, nontoxic characteristics, but the immune effect of inactivated vaccine is relatively poor, and attenuated vaccine then has good immune effect.The vaccine strain and the difference between the street strain of capripox virus are very little, and therefore the homology of both amino acid sequences, is difficult to distinguish vaccine immunity and wild malicious natural infection up to 99.9% behind the inoculation attenuated vaccine.The goatpox attenuated vaccine can be used for the prevention of goatpox and sheep pox simultaneously, inoculates and can produce immunity after 4～5 days, and the antibody extended period was 12 months, sheep that has even generation lifetime immunity.So can the antibody test key of carrying out sheep pox be effectively avoid the interference that attenuated vaccine brings, still there is not any detection method that can distinguish weak poison immunity and wild virus infection at present.

Summary of the invention

The purpose of this invention is to provide a kind of indirect ELISA antibody assay kit of energy antidiastole sheep pox wild virus infection, this kit can specific detection go out the antibody of sheep pox street strain, the antibody interferes with behind the eliminating attenuated vaccine immunity.The present invention provides the preparation and the using method of this detection kit simultaneously.

ELISA antibody test plate and ELIAS secondary antibody that envelope antigen is arranged in the indirect ELISA antibody assay kit of antidiastole sheep pox wild virus infection of the present invention, the antigen of its bag quilt is the potpourri of reorganization capripox virus ORF95 albumen and ORF103 albumen.

In the indirect ELISA antibody assay kit of antidiastole sheep pox wild virus infection of the present invention, the specification of the ELISA antibody test plate that it is used is the removable ELISA Plate of 8 holes * 12, and the antigen of the quilt that wraps is the potpourri of reorganization capripox virus ORF95 albumen and reorganization ORF103 albumen.

In the indirect ELISA antibody assay kit of antidiastole sheep pox wild virus infection of the present invention, antigen coated amount is in each hole of ELISA Plate: ORF95 protein 10 ng, ORF 103 protein 20 ng, employed ELIAS secondary antibody working fluid are that the anti-goat ELIAS secondary antibody of Sigma company rabbit is through 60,000 times of 1 * blocking buffer (Sigma) dilutions.

The preparation method of used reorganization capripox virus ORF95 albumen and ORF103 albumen is to be template with goat capripoxvirus attenuated vaccine strain genomic DNA in the indirect ELISA antibody assay kit of antidiastole sheep pox wild virus infection provided by the invention, carry out pcr amplification with two pairs of special primers respectively, amplified production is connected with pET30a (+) expression vector after enzyme is cut, make up prokaryotic expression carrier pET-95 and pET-103 respectively, transform BL21 host bacterium, the positive bacterium of recombinating is inoculated in that resistance of card LB nutrient culture media and carries out abduction delivering, obtain ORF95 recombinant protein and ORF103 recombinant protein respectively, collect the host bacterium and the ultrasonic degradation of great expression, also use membrane filtration with 8M urea dissolving inclusion body, obtain destination protein through nickel Ago-Gel affinitive layer purification, two pairs of used special primers are as follows respectively:

ORF95: upstream primer: ACCGAATTCATGGACTTCATGAAAAAATATACT;

ORF95: downstream primer: ACCAAGCTTTTTGCTGTTATTATCATCCAG;

ORF103: upstream primer: ACCGAATTCATGTCTGATAAAAAATTATCTCG;

ORF103: downstream primer: ACCAAGCTTATCCATACCATCGTCGATAG.

The preparation method of ELISA Plate uses the carbonate buffer solution of pH9.6 as coating buffer in the indirect ELISA antibody assay kit of antidiastole sheep pox wild virus infection of the present invention, ORF95 and ORF103 recombinant protein mixing with purifying, make that the final concentration of ORF95 is 100ng/mL, the final concentration of ORF103 is 200ng/mL, pressing the 100uL/ hole adds in the ELISA Plate, the package amount in the every hole of ORF95 recombinant protein is 10ng, being measured of the every hole of ORF103 recombinant protein is 20ng, 4 ℃ of bags are spent the night, wash plate four times with PBST, every hole adds 37 ℃ of sealings of 200uL 1 * blocking buffer 1 hour, wash plate four times with PBST, room temperature is dried, and the drying agent of packing into carries out vacuum packaging, puts 4 ℃ of preservations; The ELIAS secondary antibody working fluid is that the anti-goat ELIAS secondary antibody of Sigma company rabbit forms for 60,000 times through 1 * blocking buffer (Sigma company) dilution; Sample diluting liquid is 1 * blocking buffer; 10 times of concentrated cleaning solutions are 0.1M, the pH7.4 phosphate buffer that contains 0.5% Tween-20; Substrate colour developing liquid is tetramethyl benzidine (TMB); Stop buffer is the 2M sulfuric acid solution.

The using method of the ELISA antibody assay kit of antidiastole sheep pox wild virus infection of the present invention is:

(1) dilution of 10 * concentrated cleaning solution is cleansing solution for 10 times;

(2) serum to be checked, positive control serum and negative control sera are all done 1: 100 times of dilution with antibody diluent, add in the antibody test plate by every hole 100uL, hatch 30min for 37 ℃, dry;

(3) every hole adds the 200uL cleansing solution, washs 4 times, and each 1min dries;

(4) every hole adds 100uL two anti-working fluids, hatches 30min for 37 ℃, dries;

(5) every hole adds the 200uL cleansing solution, washs 4 times, and each 1min dries;

(6) every hole adds 100uL TMB colour developing liquid, and 37 ℃ of lucifuges are hatched 5min;

(7) every hole adds the 50uL stop buffer, reads absorbance value (OD with microplate reader under the 450nm wavelength _450nmValue).

Whether last is wild virus infection according to the definite sample to be checked of the OD value that records, when OD450＞0.3 is judged to be the positive; OD450＜0.25 an o'clock sample is judged to feminine gender; Be judged to suspiciously when 0.3＞OD450＞0.25, this moment, sample need be rechecked once, if OD450＞0.3 is judged to be the positive, otherwise was judged to feminine gender.

ELISA envelope antigen ORF95 and ORF103 used among the present invention are the core proteins of capripox virus particle, and its sequence is seen below SQ L № 5 and SQL № 6 in the attached gene order table.ORF95 and ORF103 play an important role in the assembling of virion.The present invention is through evidence, can the specific antibody test of carrying out the sheep pox wild virus infection by ORF95 and ORF103 albumen hybrid packet by indirect enzyme-linked immunosorbent assay that set up, get rid of the interference that the sheep pox attenuated vaccine immunity brings effectively.Preferable methods of the present invention is to prepare detection kit by the ORF95 of prokaryotic expression and purifying and ORF103 recombinant protein, and this detection kit is simple to operate fast, the result is reliable and stable and with low cost, has very strong practicality and generalization.

Compared with prior art, the present invention has following advantage:

1, ORF95 of the present invention and ORF103 recombinant protein are convenient to a large amount of preparations and purifying.Compare with the expression of P32 albumen, ORF95 and ORF103 have obtained expressing efficiently in the pET prokaryotic expression system, and the recombinant protein that carries histidine mark is easy to purifying.

2, recombinant protein purity height used in the present invention is active good.The square formation burette test of antigen shows that each enzyme mark hole only need be wrapped by the ORF103 of the ORF95 of 10ng and 20ng and just can be obtained good testing result.

3, kit high specificity of the present invention can effectively be got rid of the interference of sheep pox attenuated vaccine immunity, specific detection sheep pox wild virus infection, this be existing any method can't realize.

4, kit result of the present invention judges sensitivity, accurate, reliable.Adopt tmb substrate to develop the color, microplate reader is carried out the result and judged that the yin and yang attribute result difference is obvious, and is sensitive more more stable than the OPD colour developing.

5, utilize kit of the present invention can in 1.5h, finish detection.This diagnostic method is simple to operate, weak point consuming time, and cost is low, is fit to very much the detection of a large amount of animal blood serum samples.

Description of drawings

Fig. 1 is that the nucleic acid electrophoresis of ORF103 and ORF95 gene is identified figure, and wherein each swimming lane is: 1,2,3 are ORF103; 4,5,6 is ORF95; M:DL2000.

The SDS-PAGE electrophoresis of Fig. 2 ORF103 and ORF95 Recombinant Protein Expression and purified product identify figure wherein each swimming lane be: 1,2: through the ORF103 recombinant protein of Ni post purifying; 3,4: the ORF103 recombinant protein product before the purifying; M:Marker; 5: the ORF95 recombinant protein product before the purifying; 6,7,8 swimming lanes are the ORF95 recombinant protein behind Ni post purifying.

Embodiment

Below be specific embodiments of the invention:

1, the clone and the construction of prokaryotic expression vector of goat capripoxvirus ORF95 and ORF103 gene

With reference to the Auele Specific Primer of capripox virus genome sequence (AY077832) design ORF95 and ORF103 gene among the GenBank, primer sequence is:

ORF95: upstream primer: ACC GAATTCATGGACTTCATGAAAAAATATACT, the line part is the EcoRI restriction enzyme site;

Downstream primer: ACC AAGCTTTTTGCTGTTATTATCATCCAG, the line part is the HindIII restriction enzyme site;

ORF103: upstream primer: ACC GAATTCATGTCTGATAAAAAATTATCTCG, the line part is the EcoRI restriction enzyme site;

Downstream primer: ACC AAGCTTATCCATACCATCGTCGATAG, the line part is the HindIII restriction enzyme site;

By the pcr amplification size is the ORF95 of 483bp and the ORF103 specificity genes of interest of 570bp, enzyme is cut the back and is connected with pET30a (+) expression vector, make up prokaryotic expression carrier pET-95 and pET-103, show by PCR, double digestion and order-checking evaluation, success makes up ORF95 and ORF103 gene prokaryotic carrier, and its electrophoretogram is seen Fig. 1.

2, ORF95 and ORF103 recombinant protein efficiently expresses and purifying

Prokaryotic expression carrier pET-95 and pET-103 transform BL21 (DE3), and the positive bacterium of recombinating is inoculated in 37 ℃ of shaken cultivation in that resistance of card LB nutrient culture media, and adding IPTG carries out abduction delivering when bacterium liquid OD600 reaches 0.6, and the final concentration of IPTG is 1mM.The host bacterium and the ultrasonic degradation of centrifugal collection great expression, with 8M urea dissolving inclusion body and with 0.45 membrane filtration, through nickel Ago-Gel affinitive layer purification recombinant protein, the SDS-PAGE electrophoresis is identified and is shown, ORF95 recombinant protein size is about 30kD, and ORF103 recombinant protein size is about 35kD.Its electrophoretogram is seen Fig. 2.

3, best coating agent amount of the antigen of ELISA antibody test plate and method for coating

Two kinds of recombinant proteins of ORF95 and ORF103 adopt following bag to be carried out the test of square formation titre by mode respectively, see Table 1.

Table 1

Detect 50 parts of negative serum samples and 28 parts of positive serum samples with above-mentioned different antigen coated mode, when the ORF103 of the ORF95 of 10ng recombinant protein and 20ng recombinant protein hybrid packet by the time, the result who detects and the coincidence rate of standard female sample and positive are the highest, have all reached 100% coincidence rate.

With the carbonate buffer solution of pH9.6 as coating buffer, ORF95 and ORF 103 recombinant protein mixings with purifying make that the final concentration of ORF95 is 100ng/mL, and the final concentration of ORF103 is 200ng/mL, press the 100uL/ hole and add in the polystyrene micropore plate, 4 ℃ of bags are spent the night.Wash plate four times with PBST, every hole adds 37 ℃ of sealings of 200uL 1 * blocking buffer 1 hour, washes plate four times with PBST, and room temperature is dried, and the drying agent of packing into carries out vacuum packaging, puts 4 ℃ of preservations.

4, the preparation of positive control serum and negative control sera

The capripox virus standard positive serum (OD450nm 〉=1.00) of positive control serum for obtaining through ORF95 and ORF103 recombinant protein mixed immunity, add ten thousand/ thimerosal anticorrosion, aseptic filtration; Negative control sera is the negative sheep blood serum (OD450nm≤0.20) that obtains through screening, add ten thousand/ thimerosal anticorrosion, aseptic filtration.

5, kit detecting operation program

Its trace routine is: 1) dilution of 10 * concentrated cleaning solution is cleansing solution for 10 times; 2) serum to be checked, positive control serum and negative control sera are all done 1: 100 times of dilution with antibody diluent, add in the antibody test plate by every hole 100uL, hatch 30min for 37 ℃, dry; 3) every hole adds the 200uL cleansing solution, washs 4 times, and each 1min dries; 4) every hole adds 100uL two anti-working fluids, hatches 30min for 37 ℃, dries; 5) every hole adds the 200uL cleansing solution, washs 4 times, and each 1min dries; 6) every hole adds 100uLTMB colour developing liquid, and 37 ℃ of lucifuges are hatched 5min; 7) every hole adds the 50uL stop buffer, reads absorbance value (OD with microplate reader under the 450nm wavelength _450nmValue).

6, the criterion of testing result

Do not carry out the negative sheep of attenuated vaccine immunity and 40 parts of statistical analysis that do not have the normal immune sheep serum testing result of sheep pox morbidity history by 50 parts, calculate negative mean value (X) ± 3SD and obtain the cut-off value of this ELISA detection method.Criterion by the cut-off value defined sample detection calculated is: when sample OD450 to be checked＞0.3 is judged to be the positive; OD450＜0.25 an o'clock sample is judged to feminine gender; Be judged to suspiciously when 0.3＞OD450＞0.25, this moment, sample need be rechecked once, if OD450＞0.3 is judged to be the positive, otherwise was judged to feminine gender.

7, specificity test

(1) with 30 parts of sheep aftosas, 10 parts of PPRs (attenuated vaccine immunity) and 3 parts of sheep aphtha positive serums carry out the specificity test of this diagnostic method, and the value of test sample OD450 is all less than 0.3 as a result.

(2) detection of clinical sample: the present invention once detected nearly 800 parts of 5-7 monthly age lambs that do not carry out the sheep pox attenuated vaccine immunity of different Yang Chang, testing result shows, 96% sample OD450＜0.3, table 2 detects data for the part in the correlation test of the present invention.

Table 2

1	1	2	3	4	5	6	7	8	9	10	11	12
													A	0.150	0.211	0.156	0.167	0.155	0.139	0.149	0.197	0.672	0.205	0.195	0.154
B	0.174	0.180	0.194	0.194	0.146	0.196	0.165	0.134	0.228	0.120	0.187	0.157
													C	0.236	0.200	0.155	0.162	0.158	0.167	0.113	0.157	0.135	0.174	0.108	0.188
D	0.231	0.167	0.112	0.142	0.216	0.140	0.195	0.144	0.191	0.134	0.133	0.126
													E	0.178	0.183	0.172	0.131	0.168	0.112	0.125	0.093	0.130	0.126	0.120	0.165
F	0.147	0.147	0.140	0.123	0.127	0.136	0.149	0.166	0.148	0.122	0.159	0.135
													G	0.162	0.188	0.108	0.180	0.118	0.152	0.113	0.147	0.248	0.155	0.103	0.110
H	0.171	0.167	0.193	0.176	0.338	0.146	0.153	0.163	0.116	0.140	0.198	1.144

(annotate: H12 is the sheep pox positive serum)

(3) the present invention once carried out the sheep pox attenuated vaccine immunity to 47 parts and did not have the blood serum sample of sheep pox morbidity Records of the Historian record to detect, and the partial data such as the table 3 of detection show.

Table 3

	1	2	3	4	5	6	7	8	9	10	11	12
													A	0.149	0.165	0.123	0.099	0.165	0.111	0.138	0141	0.151	0.140	0.154	0.124
B	0.154	0.191	0.118	0.115	0.147	0.123	0.164	0.130	0.135	0.138	0.141	0.130
													C	0.143	0.122	0.125	0.096	0.126	0.107	0.139	0.105	0.122	0.140	0.129	0.283
D	0.142	0.144	0.111	0.087	0.137	0.093	0.125	0.112	0.126	0.107	0.142	0.711

(annotate: D12 is the sheep pox positive serum)

(4) serum of clinical onset sheep detects

28 sick sheep blood serum samples that are accredited as sheep pox through clinical symptoms and dissection are tested, detect data and see Table 4

Table 4

	1	2	3	4	5	6	7	8	9	10	11	12
													A	1.543	2.068	0.449	1.893	2.281	0.462	2.192	2.061	0.379	2.270	2.207	1.747
B	0.690	1.112	1.836	1.736	0.610	1.541	1.953	1.685	0.676	2.204	1.044	0.321
													C	1811	0.485	1.759	0.772	0.116	0.233	0.170	0.162	0.138	0.167	0.208	0.946

(annotate: A1-C4,28 parts of sheep pox positive; C5-C11 is sheep pox negative control sample; C12 is the sheep pox positive control serum)

More than test shows, ELISA diagnostic method high specificity of the present invention, and the result is reliable and stable, can detect the sheep pox wild virus infection specifically, so the present invention can be used to carry out the antibody test of sheep pox wild virus infection fully.

Claims (6)

1. the indirect ELISA antibody kit of antidiastole sheep pox wild virus infection wherein has the ELISA antibody test plate and the ELIAS secondary antibody of envelope antigen, and the antigen that it is characterized in that wrapping quilt is the potpourri of capripox virus ORF95 albumen and ORF 103 albumen.

2. the indirect ELISA antibody kit of antidiastole sheep pox wild virus infection according to claim 1, the specification that it is characterized in that used ELISA antibody test plate is the removable ELISA Plate of 8 holes * 12, and the antigen of the quilt that wraps is the potpourri of reorganization capripox virus ORF95 albumen and reorganization ORF103 albumen.

3. the indirect ELISA antibody kit of antidiastole sheep pox wild virus infection according to claim 1 and 2 is characterized in that wherein the antigen coated amount in every hole is: ORF95 protein 10 ng, ORF103 protein 20 ng; The ELIAS secondary antibody working fluid is that the anti-goat ELIAS secondary antibody of rabbit is through 60,000 times of 1 * blocking buffer (Sigma) dilutions.

4. the preparation method of used reorganization capripox virus ORF95 albumen and reorganization capripox virus ORF103 albumen in the indirect ELISA antibody kit of claim 2 or 3 described antidiastole sheep pox wild virus infections, it is characterized in that with goat capripoxvirus attenuated vaccine strain genomic DNA be template, carry out pcr amplification with two pairs of special primers respectively, amplified production is connected with pET30a (+) expression vector after enzyme is cut, make up prokaryotic expression carrier pET-95 and pET-103 respectively, after transforming expression of BL21 host bacterium and purifying, the positive bacterium of recombinating is inoculated in that resistance of card LB nutrient culture media and carries out abduction delivering, obtain ORF95 recombinant protein and ORF103 recombinant protein respectively, collect the recombinant host bacterium and the ultrasonic degradation of great expression, also use membrane filtration with 8M urea dissolving inclusion body, obtain destination protein through nickel Ago-Gel affinitive layer purification, two pairs of used special primers are as follows respectively:

ORF95: upstream primer: ACCGAATTCATGGACTTCATGAAAAAATATACT;

ORF95: downstream primer: ACCAAGCTTTTTGCTGTTATTATCATCCAG;

ORF103: upstream primer: ACCGAATTCATGTCTGATAAAAAATTATCTCG;

ORF103: downstream primer: ACCAAGCTTATCCATACCATCGTCGATAG.

5. the preparation method of the indirect ELISA antibody kit of the described antidiastole sheep pox of claim 3 wild virus infection, it is characterized in that using the carbonate buffer solution of pH9.6 as coating buffer, ORF95 and ORF103 recombinant protein mixing with purifying, make that the final concentration of ORF95 is 100ng/mL, the final concentration of ORF103 is 200ng/mL, pressing the 100uL/ hole adds in the ELISA Plate, the package amount in the every hole of ORF95 recombinant protein is 10ng, being measured of the every hole of ORF103 recombinant protein is 20ng, 4 ℃ of bags are spent the night, wash plate four times with PBST, every hole adds 37 ℃ of sealings of 200uL 1 * blocking buffer 1 hour, washes plate four times with PBST, and room temperature is dried, the drying agent of packing into carries out vacuum packaging, puts 4 ℃ of preservations; The ELIAS secondary antibody working fluid is that the anti-goat ELIAS secondary antibody of rabbit is done 60,000 times of dilutions through 1 * blocking buffer and formed; Sample diluting liquid is 1 * blocking buffer; 10 times of concentrated cleaning solutions are 0.1M, the pH7.4 phosphate buffer that contains 0.5% Tween-20; Substrate colour developing liquid is tetramethyl benzidine; Stop buffer is the 2M sulfuric acid solution.

6. the ELISA detection kit using method of antidiastole sheep pox wild virus infection according to claim 3 is characterized in that:

(1) dilution of 10 * concentrated cleaning solution is cleansing solution for 10 times;

(2) serum to be checked, positive control serum and negative control sera are all done 1: 100 times of dilution with antibody diluent, add in the antibody test plate by every hole 100uL, hatch 30min for 37 ℃, dry;

(3) every hole adds the 200uL cleansing solution, washs 4 times, and each 1min dries;

(4) every hole adds 100uL two anti-working fluids, hatches 30min for 37 ℃, dries;

(5) every hole adds the 200uL cleansing solution, washs 4 times, and each 1min dries;

(6) every hole adds 100uL TMB colour developing liquid, and 37 ℃ of lucifuges are hatched 5min;

(7) every hole adds the 50uL stop buffer, reads absorbance value (OD with microplate reader under the 450nm wavelength _450nmValue);

Determine according to the OD value that records whether sample to be checked is wild virus infection.

Images