CN102181481A - Construction of two MSTN (myostatin)-shRNA (short hairpin RNA) lentivirus vectors and inhibition to MSTN gene - Google Patents
Construction of two MSTN (myostatin)-shRNA (short hairpin RNA) lentivirus vectors and inhibition to MSTN gene Download PDFInfo
- Publication number
- CN102181481A CN102181481A CN 201010580055 CN201010580055A CN102181481A CN 102181481 A CN102181481 A CN 102181481A CN 201010580055 CN201010580055 CN 201010580055 CN 201010580055 A CN201010580055 A CN 201010580055A CN 102181481 A CN102181481 A CN 102181481A
- Authority
- CN
- China
- Prior art keywords
- mstn
- shrna
- cell
- inhibition
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses the construction of two MSTN-shRNA lentivirus vectors and inhibition to MSTN genes, which comprises the steps of: (1) sequencing from a starting code (ATG) to an ending code (TGA) in a coding region of 1128bp according to the sheep MSTN genes in the GeneBank; (2) artificially designing, synthesizing and screening two shRNA molecules with a prominent inhibiting effect on the sheep MSTN genes, wherein one of the shRNA molecules is formed by combining an upstream and a downstream DNA complementary single chains; (3) annealing the two synthesized complementary single chains to form double-chain shRNA molecules, and then respectively connecting the double-chain shRNA molecules to a pLL 3.7 lentivirus interference vector so as to construct two lentivirus RNA interference plasmids (MSTN-shRNA); (4) analyzing MSTN expression by fluorescence quantitative PCR (Polymerase Chain Reaction) and Western blot from mRNA (messenger RNA) and protein levels, wherein the efficiency of inhibition at the mRNA level can reach more than 58%, and the efficiency of inhibition to MSTN proteins can reach more than 80%; and (5) finishing the preparation, concentration and determination of MSTN-shRNA lentivirus.
Description
Technical field
The present invention relates to the research of gene, myostatin gene (MSTN) is had the design of remarkable inhibiting shRNA disturbing molecule, the structure of lentiviral vectors and the preparation of slow virus, the process that concentrates, measures according to two.
Background technology
RNA disturbs that (RNA interference, RNAi) technology be meant specific double-strand RNA (dsRNA) is imported in the cell, and goal gene is not expressed or a kind of technology of expression inhibiting.Laboratory siRNA commonly used mainly contains strand siRNA oligonucleotide, shRNA plasmid expression vector and slow virus expression vector at present.Utilize the RNAi technology, make up the shRNA plasmid expression vector, artificially import siRNA, goal gene is carried out silence, key is to obtain the target sequence with the target gene coupling.Obtain effectively to suppress the shRNA molecule that target gene is expressed, become the important step that the RNAi technology is used.
Myostatin gene (myostatin is called for short MSTN) is a kind of negative regulator gene that suppresses the muscle cell proliferation growth, belongs to TGF-'beta ' family member, so be called the GDF8 gene again.Studies show that, the inhibition of this genetic expression or sudden change inactivation, can block the restraining effect of MSTN to the muscle cell multiplication growth, cause muscle propagation and the significantly deposition of reduction body surface fat widely, generation with myofiber quantity significantly increase, body weight enlarges markedly is the myopachynsis phenomenon of feature, promptly so-called " double-muscling shape ".
At present, about MSTN gene shRNA molecular studies, only on mouse and goat kind, see report.As Thomas R in 2006, Liu Chao force in 2008, the report of Hemlata Jain in 2009.Thomas R screens 1 molecule with interference effect at first from 5 siRNA molecules, the target sequence of this molecule is positioned at MSTN cDNA sequence 426 sites.This sequence and mouse, rat, people, ox MSTN gene order 100% homology, but do not have homology with species such as sheep, goat, pigs.Research at other heavy livestock kind MSTN-RNAi as sheep, goat, pig etc., there is no report, also finds no the relevant report of closing MSTN gene pLL3.7 slow virus interference carrier simultaneously.
The present invention is according to sheep MSTN gene cDNA sequence, the shRNA molecule has been synthesized in design voluntarily, by functional verification, from the shRNA library of molecules of design, screening has also obtained the remarkable shRNA molecule that suppresses sheep MSTN gene first, article two, the shRNA molecule has the specificity of sequence and the uniqueness of kind, to deeply inquiring into domestic animal muscle growth molecular regulation mechanism of growing and the significant and wide application prospect of biotechnological formulation of developing promotion domestic animal muscle growth.
Summary of the invention
The objective of the invention is to: according to sheep MSTN gene cDNA sequence, the shRNA molecule has been synthesized in design voluntarily, by functional verification, two shRNA molecules have the specificity of sequence and the uniqueness of kind, to deeply inquiring into the growth of domestic animal muscle growth prospective researching value are arranged.
The object of the present invention is achieved like this: the structure of two MSTN-shRNA lentiviral vectorss and to the inhibition of MSTN gene, 1) according to sheep MSTN gene among the GeneBank from opening beginning password (ATG) to termination codon (TGA) 1128bp coding region sequence altogether; 2) artificial design is synthetic and screen two sheep MSTN gene had remarkable inhibiting shRNA molecule, the particular sequence that this molecule is made up of Nucleotide, and one the shRNA molecule is made up of the complementary strand of two DNA of upstream and downstream, and wherein one upstream sequence is 5 ' ATCTCTTGAATGTCTTATAGCATCTTTGCA-3 '; Downstream sequence is 5 ' TCGAGAAAAAAGCAAAGATGCTATAAGACATCTCTTGAATGTCTTATAGCATCTTT GC A-3 ', wherein two upstream sequence 5 '-TGTACAAGGTATACTGGAATTTCAAGAGAATTCCAGTATACCTTGTACTTTTTTC-3 '; Downstream sequence 5 '-AAAAAAGTACAAGGTATACTGGAATTCTCTTGAAATTCCAGTATACCTTGTAC A-3 '; 3) with two complementary strands of synthetic after annealing forms double-stranded shRNA molecule, be connected respectively on the pLL3.7 slow virus interference carrier, made up 2 slow virus RNA interference plasmids (MSTN-shRNA); 4) analyzed the expression of MSTN by quantitative fluorescence PCR and Western blot from mRNA and protein level, suppressing efficient on the mRNA level can reach more than 58%, and proteic inhibition can reach more than 80% to MSTN; 5) finish the preparation to the MSTN-shRNA slow virus, concentrated and mensuration.
The structure of described lentiviral vectors and to the inhibition of MSTN gene, the structure of shRNA lentiviral vectors is two complementary strand Nucleotide respectively getting 10 μ l, 10 μ m, add 10 μ l 10 * annealing buffer and 70 μ l sterilization ultrapure water, boil after 10 minutes and naturally cool to room temperature, simultaneously the pLL3.7 plasmid vector is reclaimed linearization plasmid behind XhoI and HpaI double digestion, spend the night for 4 ℃ and be connected with the annealing product, connect product and transform the DH5a competent cell, screening with the dull and stereotyped penbritin 100 μ g/ μ l of LB, with upstream carrier sense primer and downstream shRNA Oligonucleolide primers screening positive clone and after serving Hai Shenggong order-checking and identifying that sequence is correct, extract the purification of Recombinant plasmid and be used for transfection.
The structure of described lentiviral vectors and to the inhibition of MSTN gene, shRNA virus vector and MSTN expression plasmid cotransfection 293T cell, transfection is by every hole 4 * 10
5The cell density of individual/mL with the 293T cell inoculation in six orifice plates; the DMEM nutrient solution culturing cell that contains 10% foetal calf serum with 2ml; when cell reaches 70%~80% degree of converging behind the 24h, the Lipo-fectamine2000 of the MSTN expression plasmid mixed solution of the shRNA interference carrier of 1 μ g and 1 μ g and 6 μ l is added the OPTI-of 250 μ l serum-frees respectively
In the I substratum, placed 20 minutes under the room temperature behind the mixing; Plasmid DNA and liposome complex adding are contained in the cell of 1.5 milliliters of serum-free DMEM nutrient solutions, mixing gently, 37 ℃, 5%CO2 incubator were cultivated after 6 hours, be replaced by the DMEM complete culture solution that contains 10% foetal calf serum, cultivate harvested cell after 48 hours, extract total RNA and cell protein lysate extraction albumen with the Trizol method.
The structure of described lentiviral vectors and to the inhibition of MSTN gene, concentrates and measures the preparation of MSTN-shRNA slow virus;
Preparation: bed board: inoculate 3 * 10 in every 10cm area
6Individual 293T cell guarantees that degree of converging reaches about 80%-90% in the nutrient solution; In the Opti-MEM of 1.5ml preheating substratum, add Lipictamine2000 liposome by transfection carrier MSTN-shRNA 12 μ g, packaging plasmid REV6 μ g, pMDL6 μ g, coating plasmid VSVG6 μ g mixing gained; Then, add the Opti-MEM substratum of 1.5ml preheating in another pipe, add 90 μ lLipictamine2000 again, room temperature is placed behind the mixing gently; After 5 minutes, the DNA that above-mentioned dilution is good mixes with liposome, and mixture was in incubated at room 20 minutes; Can clean with the Opti-MEM substratum during this period and treat that cells transfected once, then liposome and DNA mixture are added cell, on have a down dip after cell plate make liquid evenly cover cell surface, cell is put back to 37 ℃ of incubators, cultivate after 4 hours, change the fresh DMEM perfect medium of 15ml, continue to cultivate and collect virus after 48 hours;
Concentrate: cell conditioned medium liquid is loaded in the 15ml centrifuge tube, and the centrifugal 15min of 2500rpm draws supernatant liquor with the 10ml syringe, filters by 0.45 μ m strainer, collects filtered solution; Get 5ml its branch is filled in the 1.5ml centrifuge tube, the virus of this moment can directly be used for transfection, or place-70 ℃ standby; Other gets 10ml virus filtered solution and it is loaded in the 50ml centrifuge tube 35000rpm centrifugal 2 hours (Beckman, SW28 rotary head); After centrifugal, can see the transparence throw out in the end at pipe, discard supernatant liquor, sop up remaining liquid with suction nozzle, room temperature left standstill 5 minutes, wait to evaporate clean after, concentrate by 1: 1000 times, add 10 μ l sterilization PBS, 4 ℃ of standing over night; Second day, divide to be filled in the 1.5ml centrifuge tube, place-70 ℃ or liquid nitrogen standby;
Measure: digest 293T cell to be infected, suspend, count, cell is pressed 4 * 10
5Individual inoculation 6 orifice plates, after 24 hours, infect, with spissated reorganization lentinvirus according to 1,0.1,0.01,0.001,0.0001,0.00001 doubly totally 6 gradients are diluted with nutrient solution, add respectively in 6 porocytes, add polybrene simultaneously, final concentration is 10 μ g/ml, shakes up, then cell is placed in 37 ℃ of incubators and hatch 14-16hr, renew bright DMEM perfect medium, 37 ℃ of incubators are cultivated after 48 hours, with the trypsin digestion cell of 200 μ l 0.05%, after the digestion fully, add the 1ml perfect medium and stop digestion, place the 1.5ml centrifuge tube, behind the centrifugal 10min of 3000rpm, supernatant discarded, with 1ml PBS suspension cell, cell is sucked in the lucite pipe, use cells were tested by flow cytometry EGFP fluorocyte positive rate.
The structure of described lentiviral vectors and to the inhibition of MSTN gene, its specificity binding sequence of article one shRNA sequence of screening is in MSTN cDNA sequence 218 site, so called after MSTN-shRNA-218; Second shRNA sequence is at 548 places event called after MSTN-shRNA-548.
The structure of described lentiviral vectors and to the inhibition of MSTN gene, the medicament that experiment is selected for use is the commercially available prod.
The designed nucleotide primer sequence of the present invention is as follows:
First base of upstream sequence is the required HpaI restriction enzyme site of clone, and 2 to 20 siRNA specific recognition sequences that base is 19bp, the specificity of shRNA molecule are promptly by this 19bp sequence decision.Middle loop ring sequence by 9 bases is formed.The 30-49bp zone is the complementary sequence of 19bp siRNA specific sequence, and shRNA forms hairpin structure by complementary sequence in cell, through DICE enzyme identification cutting, forms the siRNA molecule of 19bp, and identification and degraded MSTN mRNA disturb genetic expression.In the complementary sequence, 11-19bp is a seed region sequence, is direct and MSTN mRNA bonded position.48-54bp is the transcription termination sequence of U6 promotor, and last base is the XhoI restriction enzyme site.The complementation of shRNA upstream and downstream sequence, annealed back forms duplex structure, by XhoI, HpaI double digestion, is cloned in the pLL3.7 lentiviral vectors.Because of its specificity binding sequence of article one shRNA sequence in MSTN cDNA sequence 218 site, so called after MSTN-shRNA-218, second shRNA sequence at 548 places so called after MSTN-shRNA-548.
Two shRNA molecule 1 9bp specific sequences are gone up the Blast comparison through NCBI, discovery and sheep, mouse, people's MSTN gene 100% homology, with the present siRNA that reports and shRNA molecular sequences without any similarity.
The present invention goes into the shRNA molecular cloning in the pLL3.7 lentiviral vectors, and the RNAi technology is combined with lentiviral vectors, can efficiently shRNA be incorporated into the host cell gene group, has realized the stable and persistence silence to MSTN genetic expression; Compare with other the expression plasmid and the siRNA molecule of synthetic, MSTN-shRNA slow virus interference carrier has significant superiority on the persistence of gene transfering efficiency and gene silencing and stability, shown this development of technology.
Description of drawings
The present invention will contrast accompanying drawing and be described further.
Accompanying drawing 1 expression MSTN-shRNA is to MSTN gene interferential quantitative result;
As shown in the figure: MSTN-shRNA and plex-mstn-HA plasmid are according to 1: 1 cotransfection 293T of mass ratio cell, and collecting cell after 48 hours extracts total RNA, and Realtime PCR is carried out in 1 μ g RNA reverse transcription.218, cotransfection MSTN-shRNA-218 molecule and plex-mstn-HA plasmid cell cDNA; 548, cotransfection MSTN-shRNA-548 molecule and plex-mstn-HA cell cDNA; Negative, cotransfection Luc-shRNA molecule and plex-mstn-HA cell cDNA contrast as MOCK; Plex-mstn, a transfection plex-mstn-HA plasmid cell cDNA; Each sample is done once to repeat.
Accompanying drawing 2 expression MSTN-shRNA molecules are to the interference effect of MSTN protein expression;
As shown in the figure: (A) MSTN protein expression western blot result, MSTN-shRNA molecule and plex-mstn-HA press the 293T cell, collecting cell after 48 hours, sample on the 80 μ g albumen.C+, the cell pyrolysis liquid of a transfection plex-mstn-HA plasmid; C-, the blank cell pyrolysis liquid of plasmid-free transfection; Negative, the cell pyrolysis liquid of the shRNA molecule of transfection plex-mstn-HA and target Luciferase gene contrasts as MOCK; 218, the cell pyrolysis liquid of cotransfection Lv-mstn-218 and plex-mstn-HA; 548, the cell pyrolysis liquid of cotransfection Lv-mstn-548 and plex-mstn-HA; Luc-2,218-2 and 548-2 are respectively the repetition of luc, 218 and 548 treatment group; (B) β-actin protein expression westernblot result, sample standard deviation is with (A) unanimity.
Embodiment
The present invention is described further comparative examples.
Experimental procedure:
1) is total to the 1128bp coding region sequence according to sheep MSTN gene among the GeneBank from opening beginning password (ATG) to termination codon (TGA); 2) artificial design is synthetic and screen two sheep MSTN gene had remarkable inhibiting shRNA molecule; 3) with two complementary strands of synthetic after annealing forms double-stranded shRNA molecule, be connected respectively on the pLL3.7 slow virus interference carrier, made up 2 slow virus RNA interfering plasmids (pLL-MSTN-shRNA); 4) analyzed the expression of MSTN by PCR and Western blot from mRNA and protein level, suppressing efficient on the mRNA level can reach more than 58%, and proteic inhibition can reach more than 80% to MSTN; 5) finish the preparation to the Lv-MSTN-shRNA slow virus, concentrated and mensuration.
1, the structure of shRNA lentiviral vectors
Respectively get the complementary strands (normal chain and complementary strand) of two Nucleotide of 10 μ l, 10 μ m, add 10 μ l 10 * annealing buffer and 70 μ l sterilization ultrapure water, boil after 10 minutes and naturally cool to room temperature.The pLL3.7 plasmid vector reclaims linearization plasmid behind XhoI and HpaI double digestion simultaneously, and spending the night for 4 ℃ with the annealing product is connected.Connect product and transform the DH5a competent cell, the dull and stereotyped penbritin of LB (100 μ g/ μ l) screening.With carrier sense primer and shRNA Oligonucleolide primers screening positive clone and after serving Hai Shenggong order-checking and identifying that sequence is correct, extract the purification of Recombinant plasmid and be used for transfection.
2, shRNA virus vector and MSTN expression plasmid cotransfection 293T cell
ShRNA virus vector and MSTN expression plasmid cotransfection 293T cell, transfection is by every hole 4 * 10
5The cell density of individual/mL with the 293T cell inoculation in six orifice plates; the DMEM nutrient solution culturing cell that contains 10% foetal calf serum with 2ml; when cell reaches 70%~80% degree of converging behind the 24h, the Lipo-fectamine2000 of the MSTN expression plasmid mixed solution of the shRNA interference carrier of 1 μ g and 1 μ g and 6 μ l is added the OPTI-of 250 μ l serum-frees respectively
In the I substratum, placed 20 minutes under the room temperature behind the mixing; Plasmid DNA and liposome complex adding are contained in the cell of 1.5 milliliters of serum-free DMEM nutrient solutions, mixing gently, 37 ℃, 5%CO2 incubator were cultivated after 6 hours, be replaced by the DMEM complete culture solution that contains 10% foetal calf serum, cultivate harvested cell after 48 hours, extract total RNA and cell protein lysate extraction albumen with the Trizol method.
3, shRNA suppresses Evaluation on effect to the MSTN transcriptional level
3.1 total RNA extracts
Adopt guanidinium isothiocyanate trichloromethane extraction process (TAKARA company's T RNzol reagent).Concrete grammar is as follows, in 6 orifice plate cells, add 2ml PBS cleaning once, add 1ml TRNzol reagent again, piping and druming several times, liquid is transferred in the 1.5ml centrifuge tube of DEPC water treatment, add 200 μ l trichloromethane extractings once, supernatant is with 2 times of isopropanol precipitatings, and sedimentary total RNA is dissolved in 50 μ l not to be had in the RNase water.
3.2 reverse transcription
Reverse transcription uses the TAKARA AMV of company ThermoScript II to carry out reverse transcription by 40 μ l systems.Get the total RNA of 2 μ g, add 2 μ l, 6 Nucleotide random primers (Random 6 mers) make up water to 25 μ l in the centrifuge tube, 65 ℃ of 5min, add 15 μ l inverse transcription reaction liquid mixture (5 * RNA Buffer, 8 μ l, 10mM/eachdNTP 4 μ l, RNase Inhibitor 1 μ l, AMV Reverse Transcriptase 2 μ l), after room temperature leaves standstill 10min, 42 ℃ of effect 1hour, 99 ℃ of 5min deactivation ThermoScript II ,-20 ℃ of preservations.
Synthetic cDNA carries out purifying (seeing QIAquickPCR Purification Kit specification sheets for details) with the PCR of QIAGEN company product purification test kit, does not have the cDNA of RNase water elution purifying at last with 40 μ l, and is frozen, standby in-20 ℃.
3.3 real-time quantitative PCR
Select for use sheep β-actin gene as reference gene, the primer sequence of each gene sees Table 1.Sheep β-actin gene design is with reference to ncbi NM_001101 sequence, and the Myostatin gene is with reference to the NM_001001525 sequence.
3.3.1 the foundation of typical curve
MSTN, β-actin gene purpose fragment is connected with pMD-20-T PCR cloning vector (TAKARA), transform DH5a, use Minipreps-DNA Purification Sysem to extract plasmid (promega), deliver the order-checking of Shanghai Sangon company, it is consistent that purpose fragment and ncbi deliver sequence.
After above-mentioned cloned plasmids is purified, cut (3 μ g, 40 μ l systems), make its linearizing with the Sal I of the 15U enzyme that spends the night.Use QIAquick PCR Purification Kit (QIAGEN) plasmid purification then, after nucleic acid-protein analyser (Eppendorf BioPhotometer) is measured purity and concentration, it is done gradient dilution by every milliliter of 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg concentration, use QuantiTectSYBR Green I reagent (QIAGEN) to carry out Realtime PCR (Light Cycler 2.0, Roche), generate the typical curve of each gene.
3.3.2 the in good time quantitative PCR of sample cDNA
Sample cDNA is carried out realtime PCR, and (Light Cycler 2.0, Roche), this repetition of every increment twice uses the typical curve of each gene self to carry out relative quantitative assay.
Realtime PCR reaction system sees Table 1:
Remarks: β-actin, MSTN gene Realtime-PCR reaction conditions: 95 ℃ of 15min, ℃ 15s-99 ℃ of 0.1 ℃/s of 55cycles:95 ℃ 10s-60 ℃ 20s-72 ℃ 20s.melting curve:99 ℃ 0s-40, cooling-40 ℃, 30s.
3.3.3 interpretation of result
Use SPSS 13.0 statistical softwares that data mean ± std is carried out statistical study, when P<0.05, the genetic expression dependency is remarkable.By quantitative analysis, MSTN-shRNA-218 and MSTN-shRNA-548 suppress efficient in the mRNA level and reach 58% and 62% respectively.(see figure 1).
4, shRNA suppresses the evaluation of effect on protein level
4.1 protein sample preparation:
Collect the 293T cell of plex-MSTN-HA/shRNA cotransfection after 48 hours, method is as follows: the PBS that gets the 1ml precooling adds in the 6 orifice plate 293T cells, piping and druming changes in the 1.5ml centrifuge tube, behind the centrifugal 1min of 10000rpm for several times, remove supernatant, add 500 μ l PBS re-suspended cells, the centrifugal 1min of 10000rpm adds the cell pyrolysis liquid of 50 μ l precoolings, dispel mixing, hatch 10min on ice.Behind the centrifugal 10min of 12000rpm, collect supernatant liquor, be total protein solution.After being undertaken quantitatively by the albumen colorimetry, get the protein solution 80 μ g of same amount, add sample-loading buffer, put sex change 10min in the boiling water, carry out the SDS-PAGE electrophoresis after the sex change.
4.2SDS-PAGE electrophoresis:
The PAGE glue of preparation 12%, prescription: separation gel N liquid 4ml, L liquid 2.6ml, ddH
2O 3.3ml, 10%APS 100 μ l, TEMED 4 μ l, 5% concentrated glue N liquid 1ml, M liquid 0.81ml, ddH
2O 4.1ml, 10%APS 60 μ l, TEMED 6 μ l.After gelling admittedly, the protein solution of last sample 80 μ g carries out electrophoresis.
Electrophoresis: about electrophoresis time 2h, carry out electrophoresis by 80-100V voltage when concentrating glue, press the 150-200V electrophoresis later on to separation gel, electrophoresis has just been run out of to bromjophenol blue can stop electrophoresis.
4.3 commentaries on classics film
After electrophoresis finishes, separation gel is peeled off gently, put into fill transfering buffering liquid plate place 10min, the nitrocellulose filter of clip and glue consistent size or pvdf membrane and 4 filter paper place transfer liquid to soak 1min, simultaneously two blocks of sponge pads are soaked; Taking-up transfer printing folder places glue on two filter paper, covers nitrocellulose filter gently, avoids bubble, spreads two wet filter paper and last transfer printing folder.One ice bag is placed transfer groove, 3W transfer printing 100min.
4.4 immune response
Sealing: after the commentaries on classics film is finished, film is soaked from bottom to top with PBS, move in the hybridization bag that contains confining liquid (skim-milk), 4 spend night.
Hybridize: HA one is resisted be diluted to 1: 6000, from confining liquid, take out film, face is put in the hybridization bag down, drive residual bubble out of with PBS; After hatching 2h under the room temperature.At room temperature wash four times each 5min on the decolorization swinging table with PBST solution; Film is placed anti-(1: the 10000) diluents of fluorescence two, hatch 1h under the lucifuge room temperature after, at room temperature wash four times each 5min on the decolorization swinging table with PBST; Wash 5min one time with PBS, use the imaging of Odyssey Infrared fluorescence scanning imaging system.
4.5 data analysis:
By the imaging of Odyssey Infrared fluorescence scanning imaging system, the gray-scale value scanning analysis draws the relative value of protein content.By with to compare in the same old way, MSTN-shRNA-218 can effectively suppress the proteic expression of 82.5%MSTN, MSTN-shRNA-548 can effectively suppress the proteic expression (see figure 2) of 81%MSTN.
5, the preparation of MSTN-shRNA slow virus:
First day: bed board when 10-11 (morning)
Every 10cm area middle berth 3 * 10
6Individual 293T cell guarantees that degree of converging reaches about 80%-90% in second day sub-complete culture solution of cell;
Second day: Lipectamine2000 liposome transfection when 2-3 (afternoon)
After adding the Opti-MEM substratum of 1.5ml preheating, add the carrier and the viral package carrier of purpose, mixing gently, room temperature placement by following ratio;
Transfection carrier MSTN-shRNA 12 μ g
Packaging plasmid REV 6 μ g
pMDL 6μg
Coating plasmid VSVG 6 μ g
First mixing liposome gently before using Lipictamine2000; Then, in another pipe, add the Opti-MEM substratum of 1.5ml preheating, add 90 μ l Lipictamine2000 again; Room temperature is placed behind the mixing gently, and after 5 minutes, the DNA that above-mentioned dilution is good mixes with liposome, and compounding substances can be washed with Opti-MEM substratum scavenging solution during this period and treat that cells transfected once in incubated at room 20 minutes; (annotate: because the 293T cell easily takes off wall, so operation must be light and slow in the whole process.Can be earlier Tissue Culture Plate be tilted, liquid is slowly added along wooden partition, at upright cell plate slowly.) then lipid and DNA mixture are added cell, on the cell plate that have a down dip make liquid evenly cover cell surface, then, cell is put back to 37 ℃ of incubators, cultivate after 4 hours, change the fresh DMEM perfect medium of 15ml, continue to cultivate and collect virus after 48 hours.
6, the collection of Lv-MSTN-shRNA slow virus and concentrated:
Collection contains the cell conditioned medium liquid of virus.Cell conditioned medium liquid is loaded in the 15ml centrifuge tube, and the centrifugal 15min of 2500rpm draws supernatant liquor with the 10ml syringe, filters by 0.45 μ m strainer, collects filtered solution.Get 5ml its branch is filled in the 1.5ml centrifuge tube, the virus of this moment can directly be used for transfection, or place-70 ℃ standby;
Other gets 10ml virus filtered solution and it is loaded in the 50ml centrifuge tube 35000rpm centrifugal 2 hours (Beckman, SW28 rotary head).After centrifugal, can see the transparence throw out in the end at pipe, discard supernatant liquor, sop up remaining liquid with suction nozzle, room temperature left standstill 5 minutes, wait to evaporate clean after, concentrate by 1: 1000 times, add 10 μ lPBS, 4 ℃ of standing over night.Second day, divide to be filled in the 1.5ml centrifuge tube, place-70 ℃ or liquid nitrogen standby.(annotate: frozen virus can only be dissolved once and be used)
Cell after the collection virus and relevant vessel add the 84 thimerosals processing of dilution, and are discarded.
7, the mensuration of MSTN-shRNA slow virus concentrated solution titre:
First day
Digest 293T cell to be infected.Suspend, counting presses 4 * 10 with cell
5Individual inoculation 6 orifice plates after 24 hours, infect.
Second day
With spissated reorganization lentinvirus according to 1,0.1,0.01,0.001,0.0001,0.00001 times totally 6 gradients dilute with nutrient solution, add respectively in 6 porocytes, add polybrene (Polybrene) (final concentration is 10 μ g/ml) simultaneously, shake up, then, cell is placed overnight incubation in 37 ℃ of incubators (about 14-16hr, but time length visual cell is different and decide to the tolerance degree of polybrene).
The 3rd day
Renew bright DMEM perfect medium, 37 ℃ of incubators were cultivated after 48 hours, with the trypsin digestion cell of 200 μ l 0.05%, after the digestion fully, add the 1ml perfect medium and stop digestion, place the 1.5ml centrifuge tube, behind the centrifugal 10min of 3000rpm, supernatant discarded is with 1ml PBS suspension cell, cell is sucked in the lucite pipe, use cells were tested by flow cytometry EGFP fluorocyte positive rate.
By cells were tested by flow cytometry, obtain following result:
According to formula:
percentage?of?EGFP?positive?cell×(4×10
5)×dilution?factor=viralparticles/μl
7.7%×(4×105)×100=3.1×10
6viral?particles/μl
=3.1×10
9viral?particles/ml
Obtain MSTN-shRNA slow virus concentrated solution titre and can reach 3.1 * 10
9U/ μ l.
Claims (6)
1. the structure of two MSTN-shRNA lentiviral vectorss and to the inhibition of MSTN gene is characterized in that: 1) according to sheep MSTN gene among the GeneBank from opening beginning password (ATG) to termination codon (TGA) 1128bp coding region sequence altogether; 2) artificial design is synthetic and screen two sheep MSTN gene had remarkable inhibiting shRNA molecule, the particular sequence that this molecule is made up of Nucleotide, and one the shRNA molecule is made up of the complementary strand of two DNA of upstream and downstream, and wherein one upstream sequence is 5 ' ATCTCTTGAATGTCTTATAGCATCTTTGCA-3 '; Downstream sequence is 5 ' TCGAGAAAAAAGCAAAGATGCTATAAGACATCTCTTGAATGTCTTATAGCATCTTT GC A-3 ', wherein two upstream sequence 5 '-TGTACAAGGTATACTGGAATTTCAAGAGAATTCCAGTATACCTTGTACTTTTTTC-3 '; Downstream sequence 5 '-AAAAAAGTACAAGGTATACTGGAATTCTCTTGAAATTCCAGTATACCTTGTAC A-3 '; 3) with two complementary strands of synthetic after annealing forms double-stranded shRNA molecule, be connected respectively on the pLL 3.7 slow virus interference carriers, made up 2 slow virus RNA interfering plasmids (MSTN-shRNA); 4) analyzed the expression of MSTN by quantitative fluorescence PCR and Western blot from mRNA and protein level, suppressing efficient on the mRNA level can reach more than 58%, and proteic inhibition can reach more than 80% to MSTN; 5) finish the preparation to the MSTN-shRNA slow virus, concentrated and mensuration.
2. according to the structure of the described lentiviral vectors of claim 1 with to the inhibition of MSTN gene, it is characterized in that: the structure of shRNA lentiviral vectors is two complementary strand Nucleotide respectively getting 10 μ l, 10 μ m, add 10 μ l 10 * annealing buffer and 70 μ l sterilization ultrapure water, boil after 10 minutes and naturally cool to room temperature, simultaneously the pLL3.7 plasmid vector is reclaimed linearization plasmid behind XhoI and HpaI double digestion, spend the night for 4 ℃ and be connected with the annealing product, connect product and transform the DH5a competent cell, screening with the dull and stereotyped penbritin 100 μ g/ μ l of LB, with upstream carrier sense primer and downstream shRNA Oligonucleolide primers screening positive clone and after serving Hai Shenggong order-checking and identifying that sequence is correct, extract the purification of Recombinant plasmid and be used for transfection.
3. according to the structure of the described lentiviral vectors of claim 1 with to the inhibition of MSTN gene, it is characterized in that: shRNA virus vector and MSTN expression plasmid cotransfection 293T cell, transfection is by every hole 4 * 10
5The cell density of individual/mL with the 293T cell inoculation in six orifice plates; the DMEM nutrient solution culturing cell that contains 10% foetal calf serum with 2ml; when cell reaches 70%~80% degree of converging behind the 24h, the Lipo-fectamine2000 of the MSTN expression plasmid mixed solution of the shRNA interference carrier of 1 μ g and 1 μ g and 6 μ l is added the OPTI-of 250 μ l serum-frees respectively
In the I substratum, placed 20 minutes under the room temperature behind the mixing; Plasmid DNA and liposome complex adding are contained in the cell of 1.5 milliliters of serum-free DMEM nutrient solutions, mixing gently, 37 ℃, 5%CO2 incubator were cultivated after 6 hours, be replaced by the DMEM complete culture solution that contains 10% foetal calf serum, cultivate harvested cell after 48 hours, extract total RNA and cell protein lysate extraction albumen with the Trizol method.
4. according to the structure of the described lentiviral vectors of claim 1 with to the inhibition of MSTN gene, it is characterized in that: the preparation of MSTN-shRNA slow virus, concentrate and measure;
Preparation: bed board: inoculate 3 * 10 in every 10cm area
6Individual 293T cell guarantees that degree of converging reaches about 80%-90% in the nutrient solution; In the Opti-MEM of 1.5ml preheating substratum, add Lipictamine2000 liposome by transfection carrier MSTN-shRNA 12 μ g, packaging plasmid REV6 μ g, pMDL6 μ g, coating plasmid VSVG6 μ g mixing gained; Then, add the Opti-MEM substratum of 1.5ml preheating in another pipe, add 90 μ l Lipictamine2000 again, room temperature is placed behind the mixing gently; After 5 minutes, the DNA that above-mentioned dilution is good mixes with liposome, and mixture was in incubated at room 20 minutes; Can clean with the Opti-MEM substratum during this period and treat that cells transfected once, then liposome and DNA mixture are added cell, on have a down dip after cell plate make liquid evenly cover cell surface, cell is put back to 37 ℃ of incubators, cultivate after 4 hours, change the fresh DMEM perfect medium of 15ml, continue to cultivate and collect virus after 48 hours;
Concentrate: cell conditioned medium liquid is loaded in the 15ml centrifuge tube, and the centrifugal 15min of 2500rpm draws supernatant liquor with the 10ml syringe, filters by 0.45 μ m strainer, collects filtered solution; Get 5ml its branch is filled in the 1.5ml centrifuge tube, the virus of this moment can directly be used for transfection, or place-70 ℃ standby; Other gets 10ml virus filtered solution and it is loaded in the 50ml centrifuge tube 35000rpm centrifugal 2 hours (Beckman, SW28 rotary head); After centrifugal, can see the transparence throw out in the end at pipe, discard supernatant liquor, sop up remaining liquid with suction nozzle, room temperature left standstill 5 minutes, wait to evaporate clean after, concentrate by 1: 1000 times, add 10 μ l sterilization PBS, 4 ℃ of standing over night; Second day, divide to be filled in the 1.5ml centrifuge tube, place-70 ℃ or liquid nitrogen standby;
Measure: digest 293T cell to be infected, suspend, count, cell is pressed 4 * 10
5Individual inoculation 6 orifice plates, after 24 hours, infect, with spissated reorganization lentinvirus according to 1,0.1,0.01,0.001,0.0001,0.00001 doubly totally 6 gradients are diluted with nutrient solution, add respectively in 6 porocytes, add polybrene simultaneously, final concentration is 10 μ g/ml, shakes up, then cell is placed in 37 ℃ of incubators and hatch 14-16hr, renew bright DMEM perfect medium, 37 ℃ of incubators are cultivated after 48 hours, with the trypsin digestion cell of 200 μ l 0.05%, after the digestion fully, add the 1ml perfect medium and stop digestion, place the 1.5ml centrifuge tube, behind the centrifugal 10min of 3000rpm, supernatant discarded, use the 1mlPBS suspension cell, cell is sucked in the lucite pipe, use cells were tested by flow cytometry EGFP fluorocyte positive rate.
5. according to the structure of the described lentiviral vectors of claim 1 with to the inhibition of MSTN gene, it is characterized in that: its specificity binding sequence of article one shRNA sequence of screening is in MSTN coding region 218 site, so called after MSTN-shRNA-218; Second shRNA sequence is at 548 places event called after MSTN-shRNA-548.
6. according to the structure of the described lentiviral vectors of claim 1 with to the inhibition of MSTN gene, it is characterized in that: the medicament that experiment is selected for use is the commercially available prod.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010580055 CN102181481B (en) | 2010-12-09 | 2010-12-09 | Construction of two MSTN (myostatin)-shRNA (short hairpin RNA) lentivirus vectors and inhibition to MSTN gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010580055 CN102181481B (en) | 2010-12-09 | 2010-12-09 | Construction of two MSTN (myostatin)-shRNA (short hairpin RNA) lentivirus vectors and inhibition to MSTN gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102181481A true CN102181481A (en) | 2011-09-14 |
CN102181481B CN102181481B (en) | 2013-10-02 |
Family
ID=44567768
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201010580055 Expired - Fee Related CN102181481B (en) | 2010-12-09 | 2010-12-09 | Construction of two MSTN (myostatin)-shRNA (short hairpin RNA) lentivirus vectors and inhibition to MSTN gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102181481B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114836428A (en) * | 2022-06-08 | 2022-08-02 | 华东师范大学 | Chimeric antigen receptor NK cell interfered by TIGIT gene and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101591652A (en) * | 2008-05-26 | 2009-12-02 | 新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心 | The synthetic siRNA molecule that two kinds of inhibition " myostatin gene " are expressed |
CN101724647A (en) * | 2008-10-24 | 2010-06-09 | 刘娣 | Construction of eukaryotic expression vector of pig myostatin gene (MSTN) |
-
2010
- 2010-12-09 CN CN 201010580055 patent/CN102181481B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101591652A (en) * | 2008-05-26 | 2009-12-02 | 新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心 | The synthetic siRNA molecule that two kinds of inhibition " myostatin gene " are expressed |
CN101724647A (en) * | 2008-10-24 | 2010-06-09 | 刘娣 | Construction of eukaryotic expression vector of pig myostatin gene (MSTN) |
Non-Patent Citations (1)
Title |
---|
《畜禽业》 20070831 李辉 影响绵羊生长发育的主基因研究进展 8-9 1-6 , 第8期 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114836428A (en) * | 2022-06-08 | 2022-08-02 | 华东师范大学 | Chimeric antigen receptor NK cell interfered by TIGIT gene and application thereof |
CN114836428B (en) * | 2022-06-08 | 2024-03-26 | 华东师范大学 | TIGIT gene interference chimeric antigen receptor NK cell and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN102181481B (en) | 2013-10-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106636090B (en) | SiRNA, recombinant expression CAR-T carrier and its construction method of human leukocyte interleukin 6 and application | |
CN101117625B (en) | Method for evoking differentiation of mesenchyma stem cell and fat stem cell into neurons and special culture medium thereof | |
CN104531700B (en) | Suppress shRNA sequences and its application of mouse MACF1 gene expressions | |
Bao et al. | MicroRNA-589-5p modulates the expression of hemocyanin as part of the anti-WSSV immune response in Litopenaeus vannamei | |
CN103667286B (en) | The siRNA of Schistosoma japonicum PGMRC2 gene and application thereof | |
CN102181481B (en) | Construction of two MSTN (myostatin)-shRNA (short hairpin RNA) lentivirus vectors and inhibition to MSTN gene | |
CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
CN108531544A (en) | A kind of method of miR-181b target genes screening | |
CN103031334B (en) | Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid | |
CN108465108B (en) | Specific gene target for preventing or treating brain glioma | |
CN110951880B (en) | Application of reagent for detecting lncRNA marker of hypopharynx cancer in preparation of product for diagnosing hypopharynx cancer | |
CN102260672B (en) | siRNA (small interfering RNA) for inhibiting expression of porcine Somatostatin receptor 2 | |
CN113667725A (en) | Application of Mstn recombinant protein in screening of Epinephelus coioides | |
CN109321574B (en) | Short hairpin shRNA (short hairpin ribonucleic acid) for inhibiting ILT5 expression, lentivirus and application of short hairpin shRNA and lentivirus | |
CN114181936B (en) | shRNA for inhibiting chicken CA13 gene expression and application thereof | |
CN107753956B (en) | Targeted inhibitor of RAX2 gene and application thereof | |
CN114277119B (en) | Application of circular RNA circ-Arsb in preparation of osteoporosis prevention and treatment product | |
CN117517657B (en) | Application of LNX1 gene or protein in regulation of avian innate immune response | |
CN106399307B (en) | AsRNA and its application for MALAT-1 gene | |
CN109439661B (en) | Short hairpin shRNA (short hairpin ribonucleic acid), lentivirus and application thereof for inhibiting pirB expression | |
CN116637123B (en) | Application of reagent for knocking down or down expression of C15orf39 gene in preparation of medicines for treating gastric cancer | |
CN114774418B (en) | shRNA molecule and application thereof in knocking down TM9SF2 gene expression | |
CN108441496A (en) | It is a kind of inhibit chicken SOX5 gene expressions shRNA sequences and its application | |
CN117187249B (en) | Yak Lnc-MEG8 gene and application thereof | |
CN115161392B (en) | Application of TMEM144 in preparation of tumor drugs |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20131002 Termination date: 20211209 |