CN102174548B - Deep-sea cold-adapted and salt-tolerant collagenase as well as encoding gene myr02 and application of same - Google Patents

Abstract

The invention relates to a deep-sea cold-adapted and salt-tolerant collagenase as well as an encoding gene myr02 and application of the same, belonging to the field of biotechnology. The nucleotide sequence of a deep-sea cold-adapted and salt-tolerant collagenase gene myr02 is as shown in SEQ ID NO.1, and the nucleotide sequence of the collagenase myr02 encoded by the collagenase gene myr02 is as shown in SEQ ID NO.12. The collagenase myr02 can be used for degrading insoluble I type collagens, also has a higher activity for soluble substrates such as gelatins and the like, and has better cold adaptability and salt tolerance.

Description

Cold salt tolerant Collagenase and encoding sox myr02 and application are fitted in a kind of deep-sea

Technical field

The present invention relates to a kind of deep-sea and fit cold salt tolerant Collagenase and encoding sox myr02 and application, belong to technical field of biotechnology.

Background technology

Collagen protein (collagen) is distributed widely in the tissues such as skin, bone, tooth and blood vessel of animal, is the main composition composition of extracellular matrix.It has unique triple-helix structure, is difficult to by general protease hydrolysis, can only be by the collagen protein enzymic hydrolysis.Collagenase (collagenase) also abbreviates collagenase as, be a kind of be the proteolytic ferment of characteristic with insoluble hydrolysate property collagen protein, in a plurality of proteolytic enzyme family, as in serine stretch protein enzyme family and the metalloprotein enzyme family existence being arranged all.At present, Collagenase has good using value at everyways such as medical treatment and industry.Aspect medical, Collagenase can make the degraded of wound edge collegen filament, has debridement effect preferably, impels the granulation growth then, epithelization, accelerating wound and to normal blood vessels and the effect of nervous tissue not damaged.Be mainly used in debridement, decrustation and the skin-grafting of serious (II-III degree) burn clinically, also can be used for skin ulcer, bedsore etc., treatment is definite, and is safe and reliable.In addition, Collagenase also is widely used in the depilation and the softening process of leather industry, has replaced traditional liming method, both saves time, and improves labour health condition again, and little to environmental hazard.Simultaneously, Collagenase also is widely used in silk and comes unstuck, processes such as tenderization and drinks clarification.

The Collagenase of having studied at present is main with animal matrix metalloproteinase (MMPs), and is bacteriogenic less.The microbe-derived collagenase of studying the earliest is clostridium histolyticum's collagenase, existing at present clinical application.The bacterial origin collagenase is different from the gelatin protoenzyme and mainly is: (1) substrate kind is different: microbiological Collagenase substrate scope is more extensive, also can degrade easily to IV, collagen type v that the gelatin protoenzyme can not be degraded; (2) fragmentation pattern is different: general microbiological Collagenase can act on a plurality of sites of collagen; Produce small molecules small peptide or amino acid; And the gelatin protoenzyme only acts on collagen N and holds 3/4 Gly-Lue of place or Gly-Ile peptide bond, produces one 3/4 fragment and 1/4 fragment, called after TCA and TCB respectively; (3) difficulty or ease that obtain are different: the microbiological Collagenase overwhelming majority can be secreted into outside the born of the same parents, can obtain in a large number through fermentation culture, and the gelatin protoenzyme needs tissue culture and extraction, difficult the acquisition; (4) potential degrade collagen ability is different: microbiological Collagenase has higher activity.Thereby microbe-derived collagenase has wider range of application.At present, the correlative study of mikrobe collagen proteolytic enzyme is less, and several kinds of bacterial collagenases of having reported are attended by the generation of toxin more, has limited its application.Simultaneously, owing to sampled and the culture condition restriction, the Collagenase relevant report of marine source also seldom is worth deeply probing at present.

Because collagen protein is a water-insoluble protein; Major part is deposited in the marine bottom sediment in the ocean, and therefore, abyssal sediment is the good material of separating marine bacterial collagenase; But owing to sampled and the restriction of difficulty such as cultivation, the Collagenase in source, deep-sea also seldom at present.Derive from the Collagenase of deep-sea bacterium owing to pass through to seabed low temperature; Secular adaptation of weak base and hypersaline environment and evolution; Have active at low temperatures high, advantages such as the pH tolerance range is wide, anti-high salt concentration; And because its environment of living in is unique, also possibly have new collagen protein degradation mechanism, thereby the Collagenase in source, deep-sea possibly have broad application prospects in fields such as medicine, food, makeup and chemical industry.

Summary of the invention

The present invention is directed to the deficiency of prior art, provide a kind of deep-sea to fit cold salt tolerant Collagenase and encoding sox myr02 and application.

Terminological interpretation in the specification sheets:

Round pcr: the chain polymerization enzyme reaction, utilize archaeal dna polymerase, template, primer and dNTP carry out the technology of amplification in vitro specific DNA fragments.

The Tail round pcr: hot asymmetric chain polymerization enzyme reaction, use the primer of two kinds of different lengthss, thereby make the annealing temperature of two kinds of primers different.Long primer is three nested primerss with known array design, and annealing temperature 58-63 ℃, short primer is any degenerated primer, can with DNA random incorporation, annealing temperature 47-48 ℃.Each circulation of PCR temperature cycle comprises: two high temperature annealing reactions, at this moment have only long primer annealing and extension; A low-temperature annealing reaction, at this moment two kinds of primers are annealed simultaneously and are increased.

CDD analysis software: a kind of software that is used for inferring and analyzing the structural domain information of specific amino acids sequence formation that provides on the NCBI website.

Technical scheme of the present invention is following:

Cold salt tolerant Collagenase gene myr02 is fitted at a kind of deep-sea, and its nucleotide sequence is shown in SEQ ID NO.1.

The gene myr02 of Collagenase clones to obtain from the genomic dna that cold-adaptive microbe bacterium strain (Myroides profundi) D25 extracts.Cold-adaptive microbe bacterium strain (Myroides profundi) D25 separates from Japanese southern Okinawa the groove marine bottom sediment; This bacterial strain is stored in Chinese typical culture collection center, address: China, Wuhan on July 13rd, 2008; Wuhan University, culture presevation number: CCTCC NO.M 208030.This bacterial strain biological property sees document for details: Myroidesprofundi sp.nov.; Isolatedfrom deep-sea sediment of the southern Okinawa Trough. (Xi-Ying Zhang et al.; 2008, FEMSMicrobiol Lett, 287:108-102).

A kind of expression vector that contains nucleotide sequence shown in the SEQ ID No.1.

The reconstitution cell that contains nucleotide sequence shown in the above-mentioned SEQ ID No.1 or above-mentioned expression vector.

The Collagenase myr02 of above-mentioned Collagenase gene myr02 coding is shown in its aminoacid sequence SEQ ID NO.12.

The present invention at first separation and purification the Collagenase myr02 that produced of Myroides profundi D25, measured the N terminal sequence of this enzyme.According to its N terminal sequence and Tryase conservative gene sequences Design primer, utilize PCR and Tail round pcr from the genomic dna of Myroides profundi D25, to clone the gene of coding Collagenase myr02.Nucleotide sequence to this gene is measured.Sequencing result shows in the dna fragmentation of acquisition and contains an open reading frame with 2040 Nucleotide that this open reading frame promptly is the gene myr02 of coding Collagenase myr02,679 amino acid of encoding altogether.Utilize the CDD analysis software to carrying out analysis revealed according to the gene order deduced amino acid, the structure of Collagenase myr02 precursor comprises signal peptide, leading peptide, four parts of catalyst structure domain and C end structure territory.

The precursor of Collagenase myr02 is one and contains 679 amino acid whose polypeptide.The front body structure of Collagenase mry02 comprises signal peptide, leading peptide, catalyst structure domain and C end structure territory four parts.Maturing enzyme contains 584 amino acid, is a Collagenase of not reporting as yet with new sequence in the Tryase S8 family.

Nucleotide and coded amino acid corresponding relation are as shown in Figure 7 among the gene myr02 of above-mentioned Collagenase, and initiator codon indicates with square frame; Signal peptide, leading peptide and maturing enzyme cleavage site indicate with arrow.The present invention is with a kind of Collagenase called after of bacterial strain Myroides profundiD25 excretory myr02, and the unnamed gene of this proteolytic enzyme is myr02.Collagenase myr02 to purifying carries out property testing.The result shows that this enzyme has very strong degrading activity to collagen protein.The righttest enzyme temperature alive is 60 ℃, and ph optimum is 8.5.Salt tolerance is strong.Therefore, Collagenase myr02 is a S8 family protein enzyme with novel collagen degradation mechanism.

Above-mentioned Collagenase gene myr02 and/or the Collagenase myr02 application aspect degraded insolubility collagen protein.

Beneficial effect:

1, Collagenase myr02 of the present invention has advantage of high activity under the high salt condition of low temperature; This enzyme still keeps 10% enzymic activity at 0 ℃; In 4M NaCl, has 50% enzymic activity;

2, the insoluble type i collagen albumen of Collagenase myr02 degradable of the present invention also has greater activity to soluble substrate such as gelatin simultaneously, has suitable to cold and salt tolerance preferably;

3, Collagenase myr02 of the present invention not only can be applicable to aspects such as medical treatment, daily use chemicals, also has the important use potentiality at aspects such as sea life medicine, processing of aquatic products;

What 4, the present invention provided also that a strain is used for preparing gene myr02 separates cold-adaptive microbe bacterium strain (Myroides profundi) D25 that obtains by Japan's southern Okinawa groove marine bottom sediment.

Description of drawings:

Fig. 1. the electrophorogram of the genomic dna of the cold-adaptive microbe bacterium strain of extraction (Myroides profundi) D25; M:DNA molecular weight marker; 1: the genomic dna of cold-adaptive microbe bacterium strain (Myroides profundi) D25;

Fig. 2 .PCR amplification obtains the complete genome of myr02; M:DNA molecular weight marker; 1: gene myr02 (2040bp);

Fig. 3. the Collagenase myr02 of purifying; M:marker; A: the Collagenase myr02 behind the anion chromatography column purification; B: through the myr02 of molecular sieve G75 purifying (shown in the red arrow);

Fig. 4. the righttest enzyme of Collagenase myr02 temperature alive;

Fig. 5. the ph optimum of Collagenase myr02;

Fig. 6. the salt tolerance of Collagenase myr02;

Fig. 7. Collagenase gene myr02 Nucleotide and its coded amino acid corresponding relation figure; Among the figure, initiator codon indicates with square frame; Signal peptide, leading peptide and maturing enzyme cleavage site indicate with arrow.

Embodiment

Cold-adaptive microbe bacterium strain among the embodiment (Myroides profundi) D25, this bacterial strain are stored in Chinese typical culture collection center, address on July 13rd, 2008: China, Wuhan, Wuhan University, culture presevation number: CCTCC NO.M 208030.

Embodiment 1

One strain cold-adaptive microbe bacterium strain (Myroides profundi) D25, this bacterial strain are stored in Chinese typical culture collection center, address on July 13rd, 2008: China, Wuhan, Wuhan University, culture presevation number: CCTCC NO.M 208030.

Embodiment 2

The Collagenase gene myr02 that above-mentioned cold-adaptive microbe bacterium strain (Myroides profundi) D25 extracts, its nucleotide sequence is shown in SEQ ID NO.1.

The Collagenase myr02 of above-mentioned Collagenase gene myr02 coding is shown in its aminoacid sequence SEQ ID NO.12.

Collagenase gene myr02 includes the open reading frame coding Collagenase myr02 of a 2040bp, and initiator codon is positioned at 1bp, and terminator codon is positioned at 2038bp, 679 amino acid of encoding altogether.Nucleotide and coded amino acid corresponding relation are as shown in Figure 7 in this gene.

The preparation method of Collagenase gene myr02 is following:

1. the clone of Collagenase myr02 encoding sox

1.1 the extraction of cold-adaptive microbe bacterium strain (Myroides profundi) D25 genomic dna is extracted the test kit specification sheets with reference to hundred Imtech's genomes:

(1) get 1ml cold-adaptive microbe bacterium strain (Myroides profundi) D25 bacterium liquid, the centrifugal 30sec of 10000rpm abandons supernatant, collects thalline, and supernatant as much as possible exhausts;

(2) in the thalline that step (1) makes, add the resuspended washed cell of 200 μ l damping fluid RB, the centrifugal 30sec of 10000rpm is resuspended in cell concussion or piping and druming among the 200 μ l damping fluid RB after abandoning supernatant, resuspended liquid;

(3) in the resuspended liquid that step (2) makes, add 200 μ l and combine liquid CB, acutely put upside down the abundant mixing of jog at once, add 20 μ l Proteinase K (20mg/ml) solution again, fully mixing is placed 10min for 70 ℃;

(4) the cooling back adds the Virahol of 100 μ l, acutely puts upside down the abundant mixing of jog, gets solution, and flocks possibly appear in this moment;

(5) solution and the flocks that step (4) are made all add among the adsorption column AC, and the centrifugal 30sec of 10000rpm outwells the waste liquid in the collection tube;

(6) add 500 μ l inhibitions and remove liquid IR, 12, the centrifugal 30sec of 000rpm abandons waste liquid;

(7) add 700 μ l rinsing liquid WB, 12, the centrifugal 30sec of 000rpm discards waste liquid;

(8) add 500 μ l rinsing liquid WB, 12, the centrifugal 30sec of 000rpm discards waste liquid;

(9) adsorption column AC is put back in the sky collection tube, 13, the centrifugal 2min of 000rpm goes out rinsing liquid as far as possible, in order to avoid residual ethanol suppresses downstream reaction in the rinsing liquid;

(10) take out adsorption column AC and put into a clean centrifuge tube, add 100 μ l elution buffer EB (elution buffer is preheating in 65-70 ℃ of water-bath in advance) in the middle part of adsorption film, room temperature is placed 3-5min, 12, the centrifugal 1min of 000rpm; The solution that obtains is added in the centrifugal adsorption column again, and room temperature is placed 2min, 12, the centrifugal 1min of 000rpm;

(11) DNA places 4 ℃ of refrigerators to preserve.

1.2 design of primers is with synthetic

Maturing enzyme N terminal sequence NYGSRLTARVNAIQK design three degenerate primer: SP1:TAYGGNAGYCGNCTNGGNGC (SEQ ID NO.2) according to myr02; SP2:CGNCTNGGNGCNCGNGTNAA (SEQ ID NO.3); SP3:NCGNGTNAAYGCNATHCARAAR (SEQ ID NO.4); According to the conserved sequence designs C end primer M2:CRTGNGGNGYNGCCATNSWNGTNCC of Tryase S8 family (SEQ ID NO.5), give birth to worker biotech company by Shanghai and synthesize again.

1.3 utilize PCR to carry out the gene order amplification

(1) respectively with SP1, SP2, SP3 and M2 are primer, are template with the genomic dna, do pcr amplification.The PCR reaction conditions is: 95 ℃, and 5 minutes; 95 ℃ then, 1 minute; 55 ℃, 1 minute; 72 ℃, 2 minutes, after 30 circulations, 72 ℃, extended 10 minutes;

(2) pcr amplification product is carried out 1% agarose gel electrophoresis, the result shows that with SP3 and M2 be the dna fragmentation that primer amplification obtains a treaty 900bp, and the DNA with OMEGA company reclaims test kit according to its explanation recovery amplification of DNA fragments then.

2. gene sequencing

(1) dna fragmentation is connected with cloning vector

Be connected on the pMD-18T carrier of TaKaRa company the ligation system with reclaiming dna fragmentation:

solution?I 5μl

Carrier pMD-18T 1 μ l

Exogenous dna fragment 4 μ l

Cover tight lid, finger flicks centrifuge tube, and the mixing sample changes 2sec on whizzer, concentrates on the pipe end, 15 ℃ of connections of spending the night to sample;

(2) go up the competent method of preparation intestinal bacteria by " molecular cloning experiment guide " and prepare the bacillus coli DH 5 alpha competence;

(3) by the heat shock method for transformation on " molecular cloning experiment guide " recombinant vectors that connects is gone to the bacillus coli DH 5 alpha competence;

(4) bacillus coli DH 5 alpha that transforms is coated the Mai Kangkai substratum that contains 100 μ g/mL penbritins, and 37 ℃ of incubated overnight are selected white transformant and are inoculated in the LB substratum, gets 1ml after 37 ℃ of cultivations and extracts the plasmid checking;

(5) transformant that plasmid is contained the dna fragmentation of pcr amplification is served the sea and is given birth to the order-checking of worker Bioisystech Co., Ltd, therefore, obtains the sequence of one section 841bp.

3.Tail PCR proceeds sequence amplification

According to the design of calling sequence three-wheel nested primers:

SU1：GCCATTTGTCCCATCTTGCG，(SEQ?ID?NO.6)

SU2：CGACTCTTTTGATACCCTTTAG，(SEQ?ID?NO.7)

SU3：CGAGAGTAACCTTAGGAGAGTC。(SEQ?ID?NO.8)

SD1：TGTATTATCAGCGGCTTATCG，(SEQ?ID?NO.9)

SD2：GAGTAAGATAGTGGTGACGTTGG，(SEQ?ID?NO.10)

SD3：GAGCGATCCAAGGAGTCAATG。(SEQ?ID?NO.11)

Design two degenerate primer N:AAKYRTATG, C:GCAGCGTTA at random in addition again.For the unknown nucleotide sequence that gets fragment N extreme direction, be primer with SU1 and N earlier, with the genome template, carry out first round PCR, condition is: 94 ℃, 30 seconds, 53 ℃, 1 minute; 72 ℃, 2 minutes, after 5 circulations, 94 ℃, 30 seconds, 28 ℃, 3 minutes, 72 ℃, 2 minutes; 94 ℃, 20 seconds, 40 ℃, 1 minute, 72 ℃, 2 minutes, after 10 circulations, 94 ℃, 20 seconds; 53 ℃, 1 minute, 72 ℃, 2 minutes, 94 ℃, 20 seconds, 53 ℃, 1 minute, 72 ℃; 2 minutes, 94 ℃, in 30 seconds, 40 ℃, 1 minute, 72 ℃, 2 minutes, 12 circulations were extended 10 minutes for back 72 ℃.

Be that primer carry out second take turns PCR as template with SU2 and N with gained PCR product then, condition is 94 ℃, 20 seconds, 55 ℃, 1 minute, 72 ℃; 2 minutes, 94 ℃, 20 seconds, 55 ℃, 1 minute, 72 ℃; 2 minutes, 94 ℃, 20 seconds, 40 ℃, 1.5 minutes; 72 ℃, 2 minutes, after 16 circulations, 72 ℃, extended 10 minutes.

Taking turns the PCR product with second again is template, is that template is carried out third round PCR with SU3 and N, and condition is 94 ℃, 30 seconds, 55 ℃, 1 minute; 72 ℃, 2 minutes, after 25 circulations, 72 ℃, extended 10 minutes.

Third round PCR product is carried out 1% agarose gel electrophoresis, find to obtain the band about a 900bp.Unknown nucleotide sequence to known array C extreme direction carries out pcr amplification with same procedure.Band about 650bp appears in the result.Check order with same procedure in 2 and splice in the back.The open reading frame that wherein contains the coding collagenase myr02 of a 2040bp through the blastX software analysis discovery of NCBI website.Initiator codon is positioned at 1bp, and terminator codon is positioned at 2038bp, 679 amino acid of encoding altogether.Complete genome sequence and the amino acid sequence coded thereof of Collagenase myr02 are as shown in Figure 7.

Embodiment 3: the purifying of Collagenase myr02

Cold-adaptive microbe bacterium strain (Myroides profundi) D25 be inoculated in fermention medium (contain 0.2% yeast powder in the artificial seawater, 1% gelatin, pH8.5), at 15 ℃, 200rpm cultivates 84h.Fermented liquid is at 4 ℃, the centrifugal 10min of 10000g.Collect supernatant and carry out 55% ammonium sulfate precipitation, spend the night and leave standstill, 4 ℃, the centrifugal 10min collecting precipitation of 10000g heavily dissolves after the also dialyzed overnight desalination 4 ℃ with 50mM Tris-HCl damping fluid (pH 9.5), the centrifugal 15min of 10000g.Supernatant carries out gradient elution with 0-0.8M NaCl after passing DEAE-Sepharose Fast Flow chromatography column with 0.4ml/min speed.Active part behind the collection wash-out concentrates the back and crosses the further separation and purification of supherdex G75.Proteolytic enzyme behind the purifying detects purity (Fig. 3) with 7.5%SDS-PAGE

Embodiment 4: the property testing of Collagenase myr02

The temperature 4.1 the righttest enzyme is lived

The enzyme of under 0,10,20,30,40,50,60,70,80,90 ℃ of condition, measuring Collagenase myr02 is respectively lived, to confirm the optimal reactive temperature of enzyme.Measuring enzyme concrete grammar alive is:

The collagen protein that takes by weighing 5mg adds the myr02 enzyme liquid that 1ml concentration is about 20 μ g/ml, reacts 5h under the condition of different temperatures, the centrifugal 10min termination reaction of 10000g.Get 20 μ l supernatants and add 100 μ l triketohydrindene hydrate-Trisodium Citrate mixed solutions, boiling water bath reaction 20min, the cooling back adds 500 μ l n-propyl alcohols, the mixing colour developing.Get 200 μ l supernatants and measure light absorption value in the 600nm place.The result shows that the righttest enzyme of this enzyme temperature alive is 60 ℃ (like Fig. 4).

4.2 ph optimum

The enzyme of under pH6.0,7.0,7.5,8.0,8.5,9.0,9.5,10.00 conditions, measuring Collagenase myr02 is respectively lived, to confirm the ph optimum of this enzyme.Buffer system is a 50mmol/L Tris-HCl damping fluid.Concrete grammar is:

Method mensuration Collagenase myr02 enzyme in above-mentioned different pH damping fluids under 60 ℃ according in 4.1 is lived.The result shows that the ph optimum of this enzyme is 8.5 (like Fig. 5).

4.3 salt tolerance

At pH8.5, adding NaCl in the 50mmol/L Tris-HCl damping fluid is 0.5,1,2,3 to final concentration, and 4M lives at 60 ℃ of enzymes of measuring Collagenase myr02 according to the method in 4.1, to confirm the salt tolerance of this enzyme.The result shows that this enzyme salt tolerance is strong, in 4 M NaCl, still keeps 50% activity (like Fig. 6).

The result

Utilize test kit to extract the genomic dna (Fig. 1) of cold-adaptive microbe bacterium strain (Myroides profundi) D25.Conserved regions design primer sequence according to existing this proteolytic enzyme family in the DB; With the genomic dna is template, obtains the nucleotide sequence of the gene myr02 of coding Collagenase myr02 through order-checking through increase obtain the encoding gene DNA fragment (Fig. 2) of Collagenase myr02 of PCR and TailPCR mode.Its gene contains the open reading frame coding Collagenase myr02 of a 2040bp, and initiator codon is positioned at 1bp, and terminator codon is positioned at 2038bp, 679 amino acid of encoding altogether.Utilize the structure of the CDD software analysis Collagenase myr02 of NCBI website, find that the structure of the precursor of Collagenase myr02 comprises signal peptide at least, leading peptide, catalyst structure domain and four parts of C end Unknown Function structural domain.Maturing enzyme myr02 contains 585 amino acid, is an enzyme of not reporting as yet with new sequence in the Tryase S8 family.This enzyme has very high reactivity to collagen protein.The righttest enzyme temperature alive is 60 ℃, still can keep the enzyme more than 10% to live (Fig. 4) at 0 ℃, and ph optimum is 8.5 (Fig. 5), and salt tolerance is strong, can keep the activity (Fig. 6) more than 50% among the 4M NaCl.Therefore, the Collagenase myr02 of gene myr02 coding is the former proteolytic enzyme of novel right cold glue.

Claims (5)

1. cold salt tolerant Collagenase gene is fitted at a deep-sea Myr02, its nucleotide sequence is shown in SEQ ID NO.1.

2. expression vector that contains nucleotide sequence shown in the SEQ ID No.1.

3. contain the said deep-sea of claim 1 and fit cold salt tolerant Collagenase gene Myr02Or the reconstitution cell of the said expression vector of claim 2.

4. the said Collagenase gene of claim 1 Myr02The Collagenase myr02 of coding is shown in its aminoacid sequence SEQ ID NO.12.

5. Collagenase gene according to claim 1 Myr02Or the application of the said Collagenase myr02 of claim 4 aspect degraded insolubility collagen protein.

Images