CN102154496B - Various important aquagenic zoonoses protozoa simultaneous assay kit and preparation method thereof - Google Patents
Various important aquagenic zoonoses protozoa simultaneous assay kit and preparation method thereof Download PDFInfo
- Publication number
- CN102154496B CN102154496B CN2011100664348A CN201110066434A CN102154496B CN 102154496 B CN102154496 B CN 102154496B CN 2011100664348 A CN2011100664348 A CN 2011100664348A CN 201110066434 A CN201110066434 A CN 201110066434A CN 102154496 B CN102154496 B CN 102154496B
- Authority
- CN
- China
- Prior art keywords
- probe
- quantitative pcr
- primer
- fluorescence quantitative
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a various important aquagenic zoonoses protozoa simultaneous assay kit, and further provides a preparation method of the kit. A primer and a probe are designed according to the special gene sequence of the giardia lamblia, the cryptosporidium parvum and the toxoplasma gondii by a multi-fluorescence quantitative PCR (polymerase chain reaction) specific assay method, the sensitivity is improved by optimizing the fluorescence quantitative PCR reaction system and condition, the amplification can be performed, and an amplification result can be directly and timely observed. The invention can be used for fast and exactly assaying three important aquagenic zoonoses protozoa, and has the characteristics of being precise in design, simple and easy to operate, high in sensitivity, high in specificity, exact and objective in judgment, and the like.
Description
Technical field
The present invention discloses one kind of multiple important water people beasts and suffers from protozoon detection kit simultaneously altogether, the rapid fluorescence quantitative PCR detection that is used for Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii, the present invention also provides the preparation method of this test kit, belongs to parasite detection technique field.
Background technology
Giardiasis (giardiasis) be by giardia lamblia cause a kind of be the intestinal tract disease of cardinal symptom with diarrhoea, be a kind of serious Amphixenosis, this disease has been listed in one of 10 kinds of main parasitic parasitosis of harm humans health.
Cryptosporidiosis (Cryptosporidiosis) is a kind ofly to endanger serious people beast and suffer from protozoal disease altogether by Cryptosporidium is caused, can cause especially ruminating animal and people's serious diarrhoea of Mammals.Named Cryptosporidium to have 27 kinds at present, the Cryptosporidium of energy infected person has multiple, wherein common and serious with the infection of cryptosporidium parvum, the cryptosporidium parvum host range is extensive and harm is serious, therefore Mammalss such as many infected person, domestic animal are the maximum Cryptosporidium kinds of harm in the Cryptosporidium.Etiological diagnosis is the Ziehi-Neelsen stain inspection by ight soil microscope inspection and improvement how, this method waste time and energy and recall rate low.Immunology diagnosis specificity and susceptibility are also lower.
Toxoplasmosis (toxoplasmosis) claim toxoplasmosis again, is by the caused zoonosis of toxoplasma gondii (Toxophasma gondii), but infected person and domestic animal, multiple Mammals such as cat family.Cause of disease can be passed through the placental infection fetus, directly influence fetation, teratogenesis is serious, its danger more not the infected is big 10 times, it is the significant threat of livestock industry, also be one of disease the most serious in the human congenital infection, caused extensive attention, this disease is also very close with the relation of acquired immune deficiency syndrome (AIDS) (AIDS).
The pathogenic agent of above-mentioned three kinds of diseases is respectively Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii, be the cytozoicus protozoon, its egg capsule or packing are all less, microscopy is difficult for finding, and its pathogenic agent survival time in the water that pollutes is lasting, be difficult to be killed by common sterilizing agent, bring bigger difficulty therefore for medical diagnosis on disease, cause of disease detection and environmental monitoring, need a kind of multiple quick detection kit of exploitation badly.
Summary of the invention
[0006] the invention provides one kind of multiple important water people beasts and suffer from protozoon detection kit simultaneously, rapid detection and diagnosis when can be used for Lan Shi giardia lamblia, cryptosporidium parvum and three kinds of protozoons of toxoplasma gondii altogether.
The present invention further provides the preparation method of mentioned reagent box.
Multiple important water people beast of the present invention suffers from protozoon detection kit simultaneously altogether, comprises with the lower section:
(1) sample lysate and DNA extraction reagent
The mixing solutions of sample lysate: NaCl, Tris-HCl, EDTA, SDS and Proteinase K; Wherein, concentration proportioning is: NaCl 100mM, Tris-HCl (pH 7.5) 20Mm, EDTA 25 Mm, SDS 2%(w/v) and Proteinase K 0.1 μ g/ μ l;
DNA extraction reagent is phenol: chloroform: primary isoamyl alcohol (24:25:1);
(2) fluorescence quantitative PCR reaction solution: contain 4 kinds of dNTPs of each 100-300 μ M of reaction final concentration, the primer of each 10-100pmol/ μ l of reaction final concentration, the reaction final concentration is the probe of 10-100pmol/ μ l, the Mg2+ concentration of 1.5-4.5mM; Archaeal dna polymerase, sterile purified water;
(3) multi-primers and probe:
The Lan Shi giardia lamblia:
Ga：5'- GGCATCTTCATTCATAGACCTTCTG -3'
Gs：5'-ATATGCTGACATCTGGAGGAAAATC-3'
G-probe：5'-FAM-TCTTCCGTCTCGCCGTAACTGGTAA-BHQ1-3'
Cryptosporidium parvum:
Ca：5'-ATTGAAATAGATTCTGGTCCTTTGG-3'
Cs：5'-CATATTCCCTGTCCCTTGAGTTG-3'
C-probe：5'-JOE-CCGACCTCTCTCTCATTTGGTGACC-BHQ1-3'
Toxoplasma gondii:
Ta：5'-ATTTGCCAGCGGGAAATACAG-3'
Ts：5'-CCACAAGACGGCTGAAGAATG-3'
T-probe：5'-Cy5-TTCTTGTGCTGCCTCCTCTCATGG-BHQ2-3'；
(4) positive control: Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii detection lug segment standard plasmid, relatively whether PCR product and monitoring PCR operating process be correct.
(5) negative control: get the negative check sample of sterile purified water, purpose in getting rid of reaction solution pollution of nucleic acid and the false positive problem in the operating process.
(6) multiple fluorescence quantitative PCR typical curve: carry out fluorescent quantitative PCR by the positive criteria plasmid and draw.
In test kit of the present invention, can also contain smart cycler system PCR reaction tubes.
The preparation method of test kit of the present invention may further comprise the steps:
(1) sample lysate and DNA extraction reagent
Sample lysate: NaCl, Tris-HCl, EDTA, SDS and Proteinase K are made mixing solutions; Wherein, concentration proportioning is: NaCl 100mM, Tris-HCl (pH 7.5) 20Mm, EDTA 25 Mm, SDS 2%(w/v) and Proteinase K 0.1 μ g/ μ l;
DNA extraction reagent is phenol: chloroform: primary isoamyl alcohol (25:24:1).
(2) multiple fluorescence quantitative PCR primer and probe:
Lan Shi giardia lamblia special primer Ga and Gs and probe G-probe, cryptosporidium parvum special primer Ca and Cs and probe C-probe, toxoplasma gondii special primer Ta and Ts and probe T-probe
(3) fluorescence quantitative PCR reaction solution contains 4 kinds of dNTPs that react each 100-300 μ M of final concentration, the primer of each 10-100pmol/ μ l of reaction final concentration, and the reaction final concentration is the probe of 10-100pmol/ μ l, the Mg2+ concentration of 1.5-4.5mM; Archaeal dna polymerase, the sterilization distilled water;
(4) the positive control standard plasmid is the pMD-18T recombinant plasmid that contains Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii kind specific gene;
(5) negative control: get the negative check sample of sterile purified water, purpose in getting rid of reaction solution pollution of nucleic acid and the false positive problem in the operating process.
(6) multiple fluorescence quantitative PCR typical curve: carry out fluorescent quantitative PCR by the positive criteria plasmid and draw.
(7) test kit of the present invention can also contain smart cycler system PCR reaction tubes.
The detection method of test kit of the present invention may further comprise the steps:
1) pre-treatment of sample: this usefulness of taking a sample PBS mixing sieves, and crosses earlier 60 orders, after 100 mesh sieves, and filtrate centrifugation three times repeatedly, precipitation is standby sample;
2) extraction of sample DNA:
(1) above-mentioned precipitation is transferred in the 1.5ml centrifuge tube, added the 1ml lysate, multigelation is three times in liquid nitrogen and 65 ℃ of water-baths;
(2) sample after the freeze thawing is added 5-6 μ l(20mg/ml) Proteinase K, making its final concentration is 100 μ g/ml.In 65 ℃ of water-baths, soak 2h behind the mixing;
(3) use phenol: chloroform: primary isoamyl alcohol (25:24:1) carries out extracting twice, 7000r/min centrifugal ten minutes;
3), fluorescent quantitative PCR detects:
(1) prepare the PCR reaction tubes of sample number to be checked+2, comprise PCR reaction solution etc. in the pipe, cover tightly lid, mixing is standby on vortice;
(2) negative and positive control are added respectively in the good pipe of mark, then sample is added successively that also mark is good, place Smart Cycler System PCR instrument.The PCR condition is: 30s is extended in 95 ℃ of pre-sex change 5min, 94 ℃ of sex change 10s, 60 ℃ of annealing, and the result is read in 40-50 circulation.
Positively effect of the present invention is:Utilize the multiple fluorescence quantitative PCR method for detecting specificity, according to Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii kind special gene sequence design primer and probe, improve its susceptibility by optimizing quantitative fluorescent PCR reaction system and condition, the amplification while is the Real Time Observation amplification directly.The present invention can suffer from protozoon altogether to three kinds of important water people beasts simultaneously and detect fast and accurately, and it is rigorous, simple to operation, highly sensitive to have a design, and high specificity is judged accurately characteristics such as objective.
Description of drawings
Fig. 1 is multiple fluorescence quantitative PCR canonical plotting of the present invention;
Fig. 2 is multiple fluorescence quantitative PCR specificity proof diagram of the present invention;
Fig. 3 is multiple fluorescence quantitative PCR nucleic acid detecting sensitivity figure of the present invention;
Fig. 4 is that multiple fluorescence quantitative PCR of the present invention is to the pattern detection sensitivity map.
Embodiment
For the ease of understanding the present invention, especially exemplified by following examples.Its effect is understood to be to explaination of the present invention but not to any type of restriction of the present invention.
Embodiment 1
1, the primer of multiple rapid fluorescence quantitative PCR detection kit and probe design
Choosing Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii three-type-person beast in GeneBank comparison suffers from protozoon specific diagnostic gene altogether and is respectively beta-giardin gene, TRAP-C2 gene and B1 gene.
As follows according to specific gene biosoftware Beacon Designer-v7.5 design multiple fluorescence quantitative PCR primer and the probe chosen:
The Lan Shi giardia lamblia:
Ga：5'- GGCATCTTCATTCATAGACCTTCTG -3'
Gs：5'-ATATGCTGACATCTGGAGGAAAATC-3'
G-probe：5'-FAM-TCTTCCGTCTCGCCGTAACTGGTAA-BHQ1-3'
Cryptosporidium parvum:
Ca：5'-ATTGAAATAGATTCTGGTCCTTTGG-3'
Cs：5'-CATATTCCCTGTCCCTTGAGTTG-3'
C-probe：5'-JOE-CCGACCTCTCTCTCATTTGGTGACC-BHQ1-3'
Toxoplasma gondii:
Ta：5'-ATTTGCCAGCGGGAAATACAG-3'
Ts：5'-CCACAAGACGGCTGAAGAATG-3'
T-probe：5'-Cy5-TTCTTGTGCTGCCTCCTCTCATGG-BHQ2-3'
More than the three pairs of primers in same system (multiple fluorescence quantitative PCR) simultaneously augmentation detection go out the specific gene segment of three kinds of protozoons, can realize detecting simultaneously three kinds of important water people beasts such as cryptosporidium parvum, Lan Shi giardia lamblia and toxoplasma gondii and suffer from the purpose of protozoon altogether.
2, the preparation of sample lysate and DNA extraction reagent
According to following concentration proportioning NaCl 100mM, Tris-HCl (pH 7.5) 20Mm, EDTA 25 Mm, SDS 2%(w/v) and Proteinase K 0.1 μ g/ μ l mix preparation sample lysate; DNA extraction reagent: volume ratio is the phenol of 25:24:1: chloroform: primary isoamyl alcohol.
3, the preparation of fluorescence quantitative PCR reaction solution
4 kinds of dNTPs that contain each 100-300 μ M of reaction final concentration, the primer of each 10-100pmol/ μ l of reaction final concentration, the reaction final concentration is the probe of 10-100pmol/ μ l, the Mg2+ concentration of 1.5-4.5mM; Archaeal dna polymerase, the sterilization distilled water.
4, the preparation of positive control standard plasmid
At the two ends of above-mentioned fluorescent quantitation multi-primers difference design construction standard plasmid primer, by the pcr amplification goal gene, be connected construction recombination plasmid with the pMD-18T carrier, choose that mono-clonal checks order, Blast compares evaluation, 100% homology plasmid is defined as standard plasmid.
5, negative control
Negative control is the sterilization distilled water.
6, reaction system optimization
The optimization of test kit PCR reaction conditions of the present invention, be 10 μ M concentration with synthetic primer and probe with the sterile purified water dilution, each reaction system detects the known positive sample of same concentration according to concentration ratio shown in the table 1, selects the optimal concentration ratio according to CT value and amplification curve.
Primer and concentration and probe concentration proportioning in table 1 fluorescent quantitative PCR detection method
| Primers Probe | 0.3μL | 0.4μL | 0.5μL | 0.6μL | 0.7μL |
| 0.2μL | ⑴ | ⑷ | ⑺ | ⑽ | ⒀ |
| 0.3μL | ⑵ | ⑸ | ⑻ | ⑾ | ⒁ |
| 0.4μL | ⑶ | ⑹ | ⑼ | ⑿ | ⒂ |
Determine each reaction system ultimate density than being Ga/Gs difference 0.4 μ L through testing, Ca/Cs and Ta/Ts be 0.5 μ L respectively, and G-probe, C-probe and T-probe are 0.4 μ L.
7, multiple fluorescence quantitative PCR detection architecture typical curve is drawn
Three kinds of positive control standard plasmids are carried out nucleic acid quantification respectively, calculate copy number, be respectively 10 according to 10 doubling dilutions
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1Copy/μ L carries out multiple fluorescence quantitative PCR, according to CT value drawing standard curve, sees Fig. 1 respectively.
Experimental example 1, the experiment of multiple fluorescence quantitative PCR detection architecture specificity
Getting 10 negative control sample DNAs such as Eimeria, cryptosporidium andersoni, Trichinella spiralis, trichomonas, intestinal bacteria, Shigellae, streptococcus aureus, Clostridium botulinum, cholera bacilli, Salmonellas is template, respectively it is detected with the amplification system of setting up.Referring to Fig. 2.
The result shows that check sample does not all have amplification and meets the special examination criteria of genus.
Experimental example 2
The experiment of multiple fluorescence quantitative PCR detection architecture susceptibility
The Lan Shi giardia lamblia, cryptosporidium parvum and the toxoplasma gondii total nucleic acid that extract is quantitative on the foranalysis of nucleic acids instrument, be 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg with concentration dilution to the content in each reaction system with Easy Dilution respectively.Carry out multiple fluorescence quantitative PCR and detect, establish negative control simultaneously.The result shows that the detection threshold of Lan Shi giardia lamblia is 100fg, and the detection threshold of cryptosporidium parvum is 10fg, and the detection threshold of toxoplasma gondii is 10fg, all belongs to high-sensitivity detecting method, meets the sensitivity Detection standard, sees Fig. 3.
Experimental example 3
The stability of test kit and repeated experiment
Positive template, PCR reaction solution can be under-20 ℃ of conditions long storage, dissolve 4 ℃ of preservations of back 4 ℃ of conditions and get final product, should avoid multigelation.When being 30 days, 60 days, 100 days, 150 days, 200 days, period of storage takes out each component, according to detection architecture detection kit stability.Get 15 parts of positive sample with this test kit revision test 3 times, 15 parts of same repetitions 3 times of PCR negative sample.The result shows in component non-false positive and the false negative result appearance in stability and replica test that above day part takes out, so test kit stability and repeatability are good.
Experimental example 4
The quality guaranteed period test of test kit
The test kit of storing 1 month, 3 months, 5 months, 7 months and 10 months 4 ℃ and-20 ℃ is respectively taken out, according to detection architecture known sample is detected.The result shows that the test kit of preserving for October still can be made accurately sample and detects under 4 ℃ and-20 ℃ of conditions.
Test example 1
Respectively Lan Shi giardia lamblia packing, cryptosporidium parvum egg capsule and the toxoplasma gondii egg capsule preserved are counted according to 1000 egg capsules (packing)/ml, 100 egg capsules (packing)/ml, 10 egg capsules (packing)/ml, 1 egg capsule (packing)/ml is scattered in the tap water, makes water and pollutes sample.
Doing contrast with the microscopic examination method of classics detects in conjunction with multiple fluorescence quantitative PCR:
(1) saturated aqueous common salt floating method
Each sample is floating with saturated aqueous common salt, to get after upper phase adds 5 times of clear water, centrifugation will precipitate smear, 10 * 100 times of oily mirror microscopies.
(2) multiple fluorescence quantitative PCR detects
1, the pre-treatment of sample
Get mixing sample 1ml, horizontal centrifuge 3000g centrifugation, precipitation is standby sample.
2, the extraction of sample DNA
(1) above-mentioned precipitation is transferred in the 1.5ml centrifuge tube, added the 1ml lysate, multigelation is three times in liquid nitrogen and 65 ℃ of water-baths.
(2) sample after the freeze thawing is added 5-6 μ l(20mg/ml) Proteinase K, making its final concentration is 100 μ g/ml.In 65 ℃ of water-baths, soak 1h behind the mixing.
(3) use phenol: chloroform: primary isoamyl alcohol (24:25:1) carries out extracting twice, 12000g centrifugal ten minutes.
(4) in the EP pipe that is drawn to sterilization that top water is careful, note not drawing the egg white layer of medial degeneration.
(5) add 3M sodium-acetate (PH5.2) 60-70 μ l at aqueous phase, the cold ethanol that adds 2 times of volumes again precipitates 1h in-20 ℃ of refrigerators.
(6) will precipitate sample centrifugal 30min in 4 ℃ of refrigerated centrifuges completely, abandon behind the supernatant again with 75% alcohol washing one time.
(7) drying after abandoning alcohol, with the TE damping fluid or sterilize and 4 steam water dissolution and preserve, be sample to be checked.
3, multiple fluorescence quantitative PCR:
(1) gets the PCR reaction solution by the PCR reaction tubes of sample number to be checked+2, add negative and positive control 1 μ l respectively, add sample to be checked and mark, set up 20 μ l systems, mixing.
(2) carry out the multiple fluorescence quantitative PCR augmentation detection according to this detection architecture.
4, result:
The result shows that the floating microscopic examination method of saturated aqueous common salt can detect 100-1000 egg capsule (packing), can not detect the sample below 100 pathogenic agent; But this multiple fluorescence quantitative PCR detection architecture can be simultaneously prepares to detect fast accompanying drawing 4 to 1-10 infected person or other mammiferous Lan Shi giardia lamblia packing, cryptosporidium parvum egg capsule and toxoplasma gondii egg capsule or packing.
＜110〉Jilin University
＜120〉multiple important water people beast suffers from protozoon detection kit and preparation method simultaneously altogether
<210> 1
<211> 25
<212> DNA
＜213〉synthetic
<220>
＜221〉primer (primer)
<222> (1)..(25)
<223>
<400> 1
ggcatcttca ttcatagacc ttctg 25
<210> 2
<211> 25
<212> DNA
＜213〉synthetic
<220>
＜221〉primer (primer)
<222> (1)..(25)
<223>
<400> 2
atatgctgac atctggagga aaatc 25
<210> 3
<211> 25
<212> DNA
＜213〉synthetic
<220>
＜221〉probe (probe)
<222> (1)..(25)
<223>
<400> 3
tcttccgtct cgccgtaact ggtaa 25
<210> 4
<211> 25
<212> DNA
＜213〉synthetic
<220>
＜221〉primer (primer)
<222> (1)..(25)
<223>
<400> 4
attgaaatag attctggtcc tttgg 25
<210> 5
<211> 23
<212> DNA
＜213〉synthetic
<220>
＜221〉primer (primer)
<222> (1)..(23)
<223>
<400> 5
catattccct gtcccttgag ttg 23
<210> 6
<211> 25
<212> DNA
＜213〉synthetic
<220>
＜221〉probe (probe)
<222> (1)..(25)
<223>
<400> 6
ccgacctctc tctcatttgg tgacc 25
<210> 7
<211> 21
<212> DNA
＜213〉synthetic
<220>
＜221〉primer (primer)
<222> (1)..(21)
<223>
<400> 7
atttgccagc gggaaataca g 21
<210> 8
<211> 21
<212> DNA
＜213〉synthetic
<220>
＜221〉primer (primer)
<222> (1)..(21)
<223>
<400> 8
ccacaagacg gctgaagaat g 21
<210> 9
<211> 24
<212> DNA
＜213〉synthetic
<220>
＜221〉probe (probe)
<222> (1)..(24)
<223>
<400> 9
ttcttgtgct gcctcctctc atgg 24
Claims (1)
1. one kind of multiple important water people beasts suffer from protozoon detection kit simultaneously altogether, comprise with the lower section:
(1) sample lysate and DNA extraction reagent:
The mixing solutions of sample lysate: NaCl, Tris-HCl, EDTA, SDS and Proteinase K; Wherein, concentration proportioning is: NaCl 100mM, Tris-HCl (pH 7.5) 20mM, EDTA 25 mM, SDS 2%(w/v) and Proteinase K 0.1 μ g/ μ l;
DNA extraction reagent is phenol: chloroform: primary isoamyl alcohol (24:25:1)
(2) fluorescence quantitative PCR reaction solution: contain 4 kinds of dNTPs of each 100-300 μ M of reaction final concentration, the primer of each 10-100pmol/ μ l of reaction final concentration, the reaction final concentration is the probe of 10-100pmol/ μ l, the Mg of 1.5-4.5mM
2+Concentration; Archaeal dna polymerase, sterile purified water;
(3) multi-primers and probe:
The Lan Shi giardia lamblia:
Ga：5'- GGCATCTTCATTCATAGACCTTCTG -3'
Gs：5'-ATATGCTGACATCTGGAGGAAAATC-3'
G-probe：5'-FAM-TCTTCCGTCTCGCCGTAACTGGTAA-BHQ1-3'
Cryptosporidium parvum:
Ca：5'-ATTGAAATAGATTCTGGTCCTTTGG-3'
Cs：5'-CATATTCCCTGTCCCTTGAGTTG-3'
C-probe：5'-JOE-CCGACCTCTCTCTCATTTGGTGACC-BHQ1-3'
Toxoplasma gondii:
Ta：5'-ATTTGCCAGCGGGAAATACAG-3'
Ts：5'-CCACAAGACGGCTGAAGAATG-3'
T-probe：5'-Cy5-TTCTTGTGCTGCCTCCTCTCATGG-BHQ2-3'；
(4) positive control: Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii detection lug segment standard plasmid;
(5) negative control: the negative check sample of sterile purified water;
(6) multiple fluorescence quantitative PCR typical curve: carry out fluorescent quantitative PCR by the positive criteria plasmid and draw.
2, multiple important water people beast according to claim 1 suffers from protozoon detection kit simultaneously altogether, it is characterized in that: also contain smart cycler system PCR reaction tubes.
3, the described multiple important water people beast of claim 1 suffers from the protozoon preparation method of detection kit simultaneously altogether, may further comprise the steps:
(1) sample lysate and DNA extraction reagent:
Sample lysate: NaCl, Tris-HCl, EDTA, SDS and Proteinase K are made mixing solutions; Wherein, concentration proportioning is: NaCl 100mM, Tris-HCl (pH 7.5) 20mM, EDTA 25 mM, SDS 2%(w/v) and Proteinase K 0.1 μ g/ μ l; DNA extraction reagent is phenol: chloroform: primary isoamyl alcohol (24:25:1);
(2) multiple fluorescence quantitative PCR primer and probe:
Lan Shi giardia lamblia special primer Ga and Gs and probe G-probe, cryptosporidium parvum special primer Ca and Cs and probe C-probe, toxoplasma gondii special primer Ta and Ts and probe T-probe;
(3) fluorescence quantitative PCR reaction solution is 2 * premixed liquid, contains 4 kinds of dNTPs of each 100-300 μ M of reaction final concentration, the primer of each 10-100pmol/ μ l of reaction final concentration, and the reaction final concentration is the probe of 10-100pmol/ μ l, the Mg of 1.5-4.5mM
2+Concentration, archaeal dna polymerase, sterilization distilled water;
(4) positive control is to contain the standard plasmid that Lan Shi giardia lamblia, cryptosporidium parvum and toxoplasma gondii detect fragment;
(5) negative control: get the negative check sample of sterile purified water;
(6) multiple fluorescence quantitative PCR typical curve: carry out fluorescent quantitative PCR by the positive criteria plasmid and draw;
(7) assembling test kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100664348A CN102154496B (en) | 2011-03-19 | 2011-03-19 | Various important aquagenic zoonoses protozoa simultaneous assay kit and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100664348A CN102154496B (en) | 2011-03-19 | 2011-03-19 | Various important aquagenic zoonoses protozoa simultaneous assay kit and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102154496A CN102154496A (en) | 2011-08-17 |
| CN102154496B true CN102154496B (en) | 2013-08-21 |
Family
ID=44436165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100664348A Expired - Fee Related CN102154496B (en) | 2011-03-19 | 2011-03-19 | Various important aquagenic zoonoses protozoa simultaneous assay kit and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102154496B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382500B (en) * | 2013-04-18 | 2014-11-12 | 华南农业大学 | HRM primer for detection of Giardia lamblia zoonotic genotype and application thereof |
| CN103882117B (en) * | 2014-01-29 | 2016-08-17 | 武汉百泰基因工程有限公司 | A kind of for detecting the primer of Giardia lamblia nucleic acid, fluorescence probe and kit |
| CN110967241B (en) * | 2019-12-13 | 2022-07-29 | 扬州大学 | Dyeing method of Eimeria tenella protoplast |
| CN111926007B (en) * | 2020-09-22 | 2020-12-29 | 首都医科大学附属北京友谊医院 | Primer, probe and kit for detecting pneumocystis carinii and toxoplasma and detection method |
| CN112501319B (en) * | 2021-01-05 | 2021-08-24 | 广东美格基因科技有限公司 | Probe, chip, kit and method for detecting 4 food-borne pathogenic parasites |
| CN112795630A (en) * | 2021-03-22 | 2021-05-14 | 吉林大学 | Method for rapidly detecting loop-mediated isothermal amplification nucleic acid product by using magnetic bead probe |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353690A (en) * | 2008-07-11 | 2009-01-28 | 吉林大学 | Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method |
-
2011
- 2011-03-19 CN CN2011100664348A patent/CN102154496B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353690A (en) * | 2008-07-11 | 2009-01-28 | 吉林大学 | Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method |
Non-Patent Citations (1)
| Title |
|---|
| 温少芳.《蓝氏贾第鞭毛虫遗传多样性研究进展》.《国际医学寄生虫病杂志》.2006,第33卷(第1期),44-48. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102154496A (en) | 2011-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154496B (en) | Various important aquagenic zoonoses protozoa simultaneous assay kit and preparation method thereof | |
| Cho et al. | Case–control study of microbiological etiology associated with calf diarrhea | |
| Parsons et al. | Prevalence of Campylobacter spp. in a cross-sectional study of dogs attending veterinary practices in the UK and risk indicators associated with shedding | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| Frickmann et al. | PCR for enteric pathogens in high-prevalence settings. What does a positive signal tell us? | |
| CN102002531B (en) | Toxoplasma gondii detection kit and application thereof | |
| CN101353690B (en) | Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method | |
| CN103436626A (en) | Quadruple fluorescent PCR (Polymerase Chain Reaction) detection kit for common chicken food-borne bacteria and application method thereof | |
| CN103614494B (en) | Two-color fluorogenic quantitative PCR (Polymerase Chain Reaction) detection kit for CDV (canine distemper viruses) and CPV (canine parvo viruses) | |
| CN102367475B (en) | M-PCR (multiplex-polymerase chain reaction) detection kit for different serotype vibrio cholerae and detection method thereof | |
| CN102199665A (en) | LAMP (loop-mediated isothermal amplification) rapid detection kit and detection method for salmonella | |
| CN102191321B (en) | Detection kit for ureaplasma urealyticum (UU) nucleic acid by utilizing RNA constant-temperature amplification | |
| CN101487057A (en) | Loop-mediated isothermal amplification fast detecting reagent kit and method for O157:H7 coliform | |
| CN106399486A (en) | Primer group and kit for detecting diarrhea-causing parasites through multi-PCR technology | |
| CN101113473A (en) | Method for detecting food-derived pathogenic vibrio bacteria by composite fluorescence PCR technique | |
| CN107523619A (en) | The PCR detection kit of drug-fast bacteria comprising mcr genes and its application | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN102952881B (en) | Enterobacter cloacae specific PCR (polymerase chain reaction) detection primer | |
| CN104152582B (en) | Ox lumpy skin disease virus Taqman-MGB probe for real-time fluorescence is primer, kit and detection method for quantitative PCR detection | |
| CN102191324B (en) | Trypanosoma evansi and trypanosoma lewisi dual-polymerase chain reaction (PCR) assay kit and preparation method thereof | |
| Blooi et al. | Combining ethidium monoazide treatment with real-time PCR selectively quantifies viable Batrachochytrium dendrobatidis cells | |
| CN104032023B (en) | A kind of molecular beacon probe of rapid detection non-tuberculous mycobacteria and detection method | |
| CN104328216A (en) | Kit for rapid typing identification detection on Ebola viruses | |
| CN105567821A (en) | Bacillus-anthracis fluorescence PCR detection kit | |
| CN106048051B (en) | A kind of candida krusei fluorescence PCR detection reagent kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130821 Termination date: 20140319 |