CN102154322A - Application of gene GmEXPB2 in improving phosphorus absorption efficiency of soybean plants - Google Patents

Abstract

The invention discloses an application of a gene GmEXPB2 in improving the phosphorus absorption efficiency of soybean plants. According to the invention, a full-length encoding area of the GmEXPB2 gene is amplified through a PCR (polymerase chain reaction) method, driven by a strong starter 35S and connected to an over-expression vector to perform genetic transformation so that the GmEXPB2 gene is over-expressed in the transgenic soybean. According to the T3-generation and T4-generation plants of the transgenic soybean, the over-expression of GmEXPB2 improves the capability of soybean in obtaining a low-phosphorous growth medium, and the biomass and phosphorous absorption amount of the transgenic soybean are increased. In low-phosphorous soil, the biomass of the overground parts of two independent transgenic strains is increased by 47.3% and 30.5% respectively; the biomass of the root parts is increased by 29.9% and 26.8% respectively; the total lengths of the two independent transgenic strains are increased by 39.2% and 24.8% respectively; the root surface areas of the two independent transgenic strains are increased by 40.8% and 32.2% respectively; and the phosphorous absorption amounts of the two independent transgenic strains are increased by 54.0% and 41.3% respectively.

Description

The application of gene GmEXPB2 aspect raising soybean plant strain phosphorus assimilated efficiency

Technical field

The invention belongs to the plant gene engineering technology field, be specifically related to the expansion protein gene of a soybean GmEXPB2Application aspect raising soybean plant strain phosphorus assimilated efficiency.

Background technology

Soybean is important food, oil plant, feed and energy dual-purpose crop.Aspect agriculture production, as leguminous plants with biological nitrogen fixation ability, soybean is a kind of good crop rotation and intercropping and interplanting crop, has fertilizing soil, a structure of improving the soil, fertile increasing soil fertility, and reduces soil erosion, increases significant ecologic effect such as soil multiple crop index.At present, soybean is increasing as the demand of oil crops, and domestic soybean supply and demand occur seriously unbalance.China's year imported soybean was broken through 1,000 ten thousand tons in 2000, became maximum in the world soybean importer.After the entry to WTO, the import paces of Chinese soybean are accelerated, and continuous 5 years soybean imports of 2003-2007 surpass domestic production amount then, and import volume was 2,500 ten thousand tons in 2005, and import volume was 35,000,000 tons in 2007.It is predicted that the requirement of China soybean also can constantly increase, in 5-10 in the future, will reach ten thousand tons of annual 4000-5000 (http://www.jyqh.cn/article.php/24167).Therefore, the production of development soybean not only is related to national economy and grain security in China, also is related to Chinese society economic construction and sustainable development of agriculture.

Yet soybean produces the influence that tends to be subjected to many biologies and abiotic stress, and output is very unstable.Especially on China's South China's characteristic of acid red soil, lacking phosphorus and aluminium poison is the major obstacle factor (Liao et al, 2006) that the restriction soybean produces.Phosphorus is one of essential nutrient element of plant normal growth and growth.Yet the inorganic phosphorus validity that plant can directly absorb in most of soil is lower, and limited phosphorus mainly concentrates in the topsoil soils, reduces along with the increase of the soil profile degree of depth (Lynch and Brown, 1999).The roots of plants configuration, i.e. the spatial distribution of root system in the three dimensional growth medium determined the size of the soil volume that root system of plant touched, and be therefore closely related with the phosphorus assimilated efficiency.And, plant mainly relies on root system to absorb the phosphorus that is touched around it for the absorption of the phosphorus in the soil, root system of plant is many more in the higher relatively areal distribution of soil available phosphorus content, the soil volume that root system touches is big more, help the absorption (Yan Xiaolong etc., 2000) of root system more to phosphorus in the soil.Zhao etc. discover that with (2004 and 2008) such as Liu Ling shallow root type soybean root system has the reasonable three-dimensional spatial distribution, and are more in soil shallow-layer Root Distribution, help the absorption to topsoil soils phosphorus, thereby significantly improved phosphorus efficient and the output of soybean.He etc. (2003) handle rice root by layering phosphorus, find that local phosphorus supply has promoted the differentiation of lateral root branch, thereby have increased the area of root system contact soil, and paddy rice the upperground part biomass of local phosphorus supply is almost suitable with the holostrome phosphorus supply with suction phosphorus amount at the middle and upper levels.Therefore, changing soybean plant strain root configuration by transgenic method, allow more Root Distribution at the relative high more topsoil of available phosphorus content, is effectively to improve crop to absorb soil phosphorus, solve the important channel that lacks the phosphorus problem in the production of restriction soybean.

The crucial new gene that a plurality of regulation and control phosphorus efficiency root configurations build up has been found in present research.Wherein, Lee etc. (2003) on soybean, find a root system specifically expressing α-expansion protein gene ( GmEXP1), may be relevant at this gene of heterogenous expression analysis revealed of tobacco with the elongation of root.Also reported two α-expansion protein gene on the Arabidopis thaliana AtEXP7With AtEXP18Expression pattern, find that they are root hair specifically expressing (Cho and Cosgrove, 2002).The proteic HvEXPB1 gene of barley coding β-expansion also is the root specifically expressing, and be closely connected with being formed with of root hair (Kwasniewski and Szarejko, 2006).In addition, also found the proteic specifically expressing of α-and β-expand respectively at the root of paddy rice (Shin etc., 2005) and corn (Wu etc., 2001).Recently, Guo etc. (2011) on soybean, find a β-expansion protein gene ( GmEXPB2), it belongs to secretory protein, is positioned cell walls.The real-time fluorescence quantitative PCR result shows GmEXPB2Root strongly expressed soybean has low expression amount floral organ, and leaf portion does not then express.Heterogenous expression in Arabidopis thaliana GmEXPB2, the result is presented at and lacks under the phosphorus condition, and the main root of transfer-gen plant is long, lateral root is long and the lateral root number all significantly increases, and leaf area obviously increases, and postpone flowering period.In addition, GmEXPB2Participate in root system to lacking the adaptation reaction of phosphorus, under the insufficient condition of phosphorus supply, can stimulate the formation of main root, lateral root continued growth and lateral-root primordia in vivo, kept root system normal growth (Guo etc., 2011).Overexpression and interference in the compound plant of soybean GmEXPB2The result show that under the low-phosphorous condition, it can significantly promote the growth (Guo etc., 2011) of transgenosis hairly root.

The key gene that builds up about conversion regulation and control root configuration changes transfer-gen plant self root system spatial distribution and configuration, thereby utilizes the report of available phosphorus limited in the medium actually rare.And with the expansion protein gene of soybean itself GmEXPB2Thereby the phosphorus assimilated efficiency of overexpression raising plant yet there are no report in soybean.Right GmEXPB2Research still rest on its expression pattern and action function theoretical research stage, there is no about GmEXPB2In the whole strain of soybean, express the correlation technique report of the technical scheme that improves the absorption of available state inorganic phosphorus in the soybean plant strain soil limited to rhizosphere.

Summary of the invention

The objective of the invention is to overcome the deficiencies in the prior art, gene is provided GmEXPB2Improving

The application of soybean plant strain phosphorus assimilated efficiency aspect.

Another object of the present invention provides described gene GmEXPB2Expression method in soybean plant strain.

Purpose of the present invention is achieved by the following technical programs:

The invention provides gene GmEXPB2Application aspect raising soybean plant strain phosphorus assimilated efficiency.Described application is overexpression coding soybean β-proteic new gene of expansion in soybean GmEXPB2

Described β-expansion protein gene GmEXPB2Describe in the investigative technique document referring to (2011) such as Guo.This full length gene cDNA is 1048bp (EU362626), 227 amino acid of encoding, and molecular weight is 29.5KD.The present invention amplifies by PCR method GmEXPB2The coding region of gene is driven by strong promoter 35S, is connected on the overexpression carrier; Carry out genetic transformation again, this gene of overexpression obtains the overexpression plant in soybean.At transgenosis T ₃And T ₄For finding in the plant that the suction phosphorus amount and the biomass of transfer-gen plant all are significantly higher than negative plant.

The present invention provides the expression method that realizes described application simultaneously, specifically may further comprise the steps:

(1) with GmEXPB2Genomic fragment as applying gene, the design primer, amplify GmEXPB2The coding region of gene is driven by strong promoter 35S, is connected on the overexpression carrier;

(2) carry out genetic transformation, the described gene of overexpression obtains the overexpression soybean plant strain in soybean.

The described primer of step (1) is:

Forward (left end) is (5'-3'):

AAAACCCGGGCTATCAACTACCTATAGGGAAC；

Reverse (right-hand member) primer (5'-3'):

AAAATCTAGACCACAAGCTGATGATAGATCC。

03-3 of preferred Guangdong spring of described soybean varieties.Adopt the soybean cotyledon node method for transformation of agrobacterium tumefaciens EHA101 mediation, in the spring 03-3 of soybean varieties Guangdong, overexpression GmEXPB2Gene obtains overexpression GmEXPB2Soybean plant strain.Described genetic transformation may further comprise the steps:

(1) seed disinfection and seed germination;

(2) agrobacterium tumefaciens EHA101 bacterium liquid preparation;

(3) explant preparation and Transformation Program;

(4) infect cultivation together;

(5) young shoot induces, extends

(6) young shoot is taken root, and obtains transgenosis individual plant T ₀For plant.

Select the plant of overexpression, carry out numerous kind, obtain stable transgenic progeny strain system.

The present invention has made up GmEXPB2The overexpression carrier, in soybean overexpression coding expansion proteic GmEXPB2Gene changes GmEXPB2Gene plant has significantly improved the absorption of soil phosphorus and utilization, and result of study has great importance to cultivating the phosphorus efficiency new soybean varieties, has bigger application prospect on producing.

Beneficial effect of the present invention is summarized as follows:

(1) the invention provides β-expansion protein gene of a kind of soybean GmEXPB2New application.The present invention success is the proteic gene of overexpression coding β-expand in the spring 03-3 of soybean varieties Guangdong GmEXPB2After, evidence, in low-phosphorous soil, two independently the overground part of transgenic line and root biomass contrast soybean and have increased by 47.3%, 30.5% and 29.9,26.8%% respectively; Total root length and root surface area have improved 39.2%, 24.8% and 40.8%, 32.2%; The phosphorus absorbed dose has improved 54.0%, 41.3%.

(2) by the inventive method overexpression GmEXPB2Can change genetically engineered soybean Root morphology configuration, in available phosphorus distributes many more relatively topsoil soils, absorb more phosphorus, improve the assimilated efficiency of phosphorus, thereby promote the growth of soybean.This is that a large amount of uses that can help to reduce phosphate fertilizer threaten environment structure, and the following sustainable agriculture development of country is provided the new technology of favourable support.

(3) the present invention's gene that influences soybean phosphorus assimilated efficiency of overexpression in soybean first GmEXPB2, provide new thinking for cultivating soybean phosphorus efficiency kind, also, other crop utilization transgenic method provides technical support for improving nutrient efficiency.

(4) gene of using among the present invention can provide theoretical the support for the nutrition efficient research of leguminous crop such as soybean and other crop.

Description of drawings

The structural representation of Fig. 1 overexpression conversion elements.

Embodiment

Further describe the present invention below in conjunction with the drawings and specific embodiments.The present invention has described separation in an embodiment GmEXPB2The measuring method and the expression pattern of described gene in soybean of gene, genetic transformation and total root length, root surface area, suction phosphorus amount and biomass, but therefore spirit and scope of the invention is not defined in the specific embodiment.

The structure of embodiment 1 overexpression conversion carrier

From " Guo W, Zhao J, Li X, Qin L, Yan X, Liao H. A soybean β-expansin gene GmEXPB2Intrinsically involved in root system architecture responses to abiotic stresses. doi:10.1111/j.1365-313X.2011.04511.x " the research document in described GmEXPB2Full length gene cDNA sequence (EU362626), this full length gene cDNA is 1048bp, 227 amino acid of encoding, molecular weight is 29.5KD.

The present invention is according to gene GmEXPB2Known full length cDNA sequence design forward primer (5'-3') and reverse primer (5'-3'), be template with soybean cDNA, amplify GmEXPB2The coding region of gene, amplification condition is: 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 60 seconds, 30 circulations; Drive by strong promoter 35S, being connected to the transgenosis center wangkai doctor of the overexpression carrier pTF101.1(U.S. state university in Iowa is so kind as to give, Paz et al, 2004) on, and then with the design forward primer (5'-3') and reverse primer (5'-3') clone who obtains is checked order, determine that gene is connected on the pTF101.1 carrier by correct direction.The pTF101.1 carrier comprises the screening-gene of weedicide, sees accompanying drawing 1, in the accompanying drawing 1, and 1 expression left margin, 2 expression right margins, 3 expressions NO STerminator, 4 expressions BaThe r gene, 5 expressions GmEXPB2Gene; By accompanying drawing 1 as seen GmEXPB2Gene is by the 35S promoter overexpression.

Described forward (left end) primer (5'-3') sequence is:

AAAACCCGGGCTATCAACTACCTATAGGGAAC；

Described oppositely (right-hand member) primer (5'-3') sequence is:

AAAATCTAGACCACAAGCTGATGATAGATCC。

Embodiment 2 overexpressions GmEXPB2Transgenic experiments

It is proteic to comprise the expansion of coding soybean GmEXPB2Gene fragment adopts transgenic method after being connected on the carrier pTF101.1, obtains genetically modified soybean plant strain, and transgenic method concrete steps of the present invention are as follows:

The correct clone's that obtains plasmid is imported among the spring 03-3 of soybean varieties Guangdong by agriculture bacillus mediated soybean cotyledon node genetic conversion system, through seed germination, cotyledonary node infect, cultivate altogether, young shoot is induced and process such as young shoot elongation, young shoot with Herbicid resistant extends, takes root, practices transplantation of seedlings, obtains transfer-gen plant.

People (the Assessment of conditions affecting Agrobacterium-mediated soybean transformation using the cotyledonary node explants such as soybean heredity transformation system main reference Paz of described Agrobacterium (EHA101) mediation, 2004, Euphytica, 136:167-179) technology report and application number are 200910036465.1 patent application document (Wang Xiurong etc.).

The method of the key step of genetic transformation of the present invention, substratum and preparation thereof is as described below:

(1) reagent

The used reagent of substratum is conventional commercial reagent among the present invention, and reagent and solution and abbreviation are expressed as follows: 6-BA(6-BenzylaminoPurine, 6-benzyladenine); ZR(Trans-Zeatin Riboside, ribosylzeatin); NAA(Napthalene acetic acid, naphthylacetic acid); IAA(Indole-3-acetic acid, indolylacetic acid); GA ₃(Gibberellic acid, Plant hormones regulators,gibberellins); AS(Acetosringone, Syringylethanone); DTT(DL-Dithiothreitol, dithiothreitol (DTT)); Glufosinate(Glufosinate-ammonium, weedicide); DMSO(Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); B5max(B5 macroelement composition solution); B5mix(B5 trace element composition solution); B5vit(B5 vitamin ingredients solution); MSmax(MS macroelement composition solution); MSmix(MS trace element composition solution)

(2) solution formula

1) B5 medium macroelement mother liquor (according to 20 times of concentrated solutions (20X) preparation):

Saltpetre (KNO ₃) 50.00 grams

SODIUM PHOSPHATE, MONOBASIC (NaH ₂PO ₄2H ₂O) 3.00 grams

Ammonium sulfate ((NH ₄) ₂SO ₄) 2.68 grams

Sal epsom (MgSO ₄7H ₂O) 5.00 grams

Calcium chloride (CaCl ₂2H ₂O) 3.00 grams

Mentioned reagent is used an amount of dissolved in distilled water one by one, be settled to 1000 milliliters with distilled water then.

2) B5 medium trace element mother liquor (is prepared according to 200 times of concentrated solutions (200X)

Potassiumiodide (KI) 0.15 gram

Boric acid (H ₃BO ₃) 0.60 gram

Manganous sulfate (MnSO ₄4H ₂O) 2.00 grams

Zinc sulfate (ZnSO ₄7H ₂O) 0.40 gram

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.05 gram

Copper sulfate (CuSO ₄5H ₂O) 0.005 gram

Cobalt chloride (CoCl ₂6H ₂O) 0.005 gram

Mentioned reagent is used an amount of dissolved in distilled water down at 20～25 ℃, and be settled to 1000 milliliters with distilled water.

3) molysite (Fe ₂EDTA) stock solution (according to the preparation of 100X concentrated solution)

With 3.73 gram b diammonium disodium edta (Na ₂EDTA2H ₂O) and 2.78 the gram FeSO ₄7H ₂O uses dissolved in distilled water respectively, mixes and is settled to 1000 milliliters with distilled water, puts 70 ℃ of warm water baths 2 hours, and 4 ℃ of preservations are standby.

4) B5 VITAMIN stock solution (according to the preparation of 100X concentrated solution)

Nicotinic acid (Nicotinic acid) 0.01 gram

VITMAIN B1 (Thiamine HCl) 0.10 gram

Vitamin B6 (Pyridoxine HCl) 0.01 gram

Inositol (Inositol) 1.00 grams

An amount of dissolved in distilled water mentioned reagent is settled to 1000 milliliters with distilled water then, and 4 ℃ of preservations are standby.

5) MS substratum macroelement mother liquor (MSmax mother liquor) (according to the preparation of 20X concentrated solution)

Ammonium nitrate (NH ₄NO ₃) 33.0 grams

Saltpetre (KNO ₃) 38.0 gram

Potassium primary phosphate (KH ₂PO ₄) 3.4 grams

Sal epsom (MgSO ₄7H ₂O) 7.4 grams

Calcium chloride (CaCl ₂2H ₂O) 8.8 grams

Mentioned reagent is used an amount of dissolved in distilled water under 20～25 ℃ of temperature, and be settled to 1000 milliliters with distilled water.

6) MS substratum trace element mother liquor (MSmin mother liquor) (according to the preparation of 200X concentrated solution)

Manganous sulfate (MnSO ₄4H ₂O) 4.46 grams

Zinc sulfate (ZnSO ₄7H ₂O) 1.72 grams

Boric acid (H ₃BO ₃) 1.24 grams

Potassiumiodide (KI) 0.166 gram

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.05 gram

Copper sulfate (CuSO ₄5H ₂O) 0.005 gram

Cobalt chloride (CoCl ₂6H ₂O) 0.005 gram

Mentioned reagent is used an amount of dissolved in distilled water under 20～25 ℃ of temperature, and be settled to 1000 milliliters with distilled water.

) main antibiotic formulation

100 mg/mL penbritin stock solutions: 1 gram penbritin+10 mL distilled waters, filtration sterilization ,-20 ℃ of preservations;

50 mg/mL kantlex stock solutions: that mycin of 0.5 gram calorie+10 mL distilled waters, filtration sterilization ,-20 ℃ of preservations;

50 mg/mL paraxin stock solutions: 0.5 gram paraxin+10 mL, 80% ethanol, filtration sterilization ,-20 ℃ of preservations;

100 mg/mL spectinomycin stock solutions: 1 gram spectinomycin+10 mL distilled waters, filtration sterilization ,-20 ℃ of preservations;

200 mg/mL Ticarcillin/Clavulanate Acid stock solutions: 1.6 gram Ticarcillin/Clavulanate Acid+8 mL distilled waters, filtration sterilization, 4 ℃ of preservations;

250 mg/mL cephamycin stock solutions: 0.5 gram cephamycin+2 mL distilled waters, filtration sterilization ,-20 ℃ of preservations.

8) major hormone, amino acid and selective agent prescription

1 mg/mL GA ₃Stock solution: 0.0125 gram GA3+0.25 mL 1N NaOH+12.25 mL distilled water, filtration sterilization, 4 ℃ of preservations;

1 mg/mL 6-BA stock solution: 0.0125 gram 6-BA+0.25 mL 1N NaOH+12.25 mL distilled water, filtration sterilization, 4 ℃ of preservations;

1 mg/mL indolylacetic acid IAA stock solution: 0.0125 gram IAA+0.25 mL 1N NaOH+12.25 mL distilled water, filtration sterilization, 4 ℃ of preservations;

0.5 mg/mL NAA stock solution: 0.005 gram NAA+0.2 mLNaOH+9.8mL distilled water, filtration sterilization, 4 ℃ of preservations;

1 mg/mL ribosylzeatin stock solution: 10 milligrams of zeatin+10 mL distilled waters, filtration sterilization ,-20 ℃ of preservations;

10 mg/mL asparagine stock solutions: 0.5 gram asparagine+50 mL distilled waters, filtration sterilization, 4 ℃ of preservations;

10 mg/mL glutamine stock solutions: 0.5 gram glutamine+50 mL distilled waters, filtration sterilization, 4 ℃ of preservations;

1 mg/mL weedicide stock solution: 0.025 gram Glufosinate+25 mL distilled water, filtration sterilization, 4 ℃ of preservations.

(3) be used for the culture medium prescription that soybean heredity transforms

1) seed germination substratum

50 milliliters in B5max mother liquor (getting the 20X concentrated solution that has prepared, down together)

5 milliliters in B5mix mother liquor (getting the 200X concentrated solution that has prepared, down together)

Fe ²⁺10 milliliters of EDTA stock solutions (getting the 100X concentrated solution that has prepared, down together)

10 milliliters of VITAMIN stock solutions (getting the 100X concentrated solution that has prepared, down together)

Sucrose 20 grams

Phytagel 3 grams

Adding distil water to 1000 milliliter, 1N sodium hydroxide is regulated pH value to 5.8, autoclaving, 121 ℃ of sterilizations 20 minutes down, following medium sterilization method is identical with present embodiment.

2) be total to substratum

5 milliliters in B5max mother liquor (20X)

0.5 milliliter in B5mix mother liquor (200X)

Fe ²⁺1 milliliter of EDTA stock solution (100X)

Sucrose 30 grams

MES 3.9 grams

BBL Agar 5 grams

Adding distil water to 985 milliliter, 1N sodium hydroxide is regulated pH value to 5.4, and the autoclaving substratum adds 10 milliliters of VITAMIN stock solutions (100X) of filtration sterilization, 0.25 milliliter of GA when being cooled to 50 ℃ ₃(1 mg/ml), 1.67 milliliters of 6-BA(1 mg/ml), 400 milligrams of cysteinamines, 154.2 milligrams of dithiothreitol (DTT) and 40 milligrams of AS, packing is poured in the culture dish behind the mixing.

3) young shoot inducing culture

50 milliliters in B5max mother liquor (20X)

5 milliliters in B5mix mother liquor (200X)

Fe ²⁺10 milliliters of EDTA stock solutions (100X)

Sucrose 30 grams

MES 0.59 gram

Phytagel 3 grams

Adding distil water to 985 milliliter, 1N sodium hydroxide is regulated pH value to 5.7, autoclaving.Substratum adds 10 milliliters of VITAMIN stock solutions (100X) of filtration sterilization when being cooled to 50 ℃, 1.67 milliliter 6-BA stock solution (1 mg/ml), 0.5 milliliter Ticarcillin/Clavulanate Acid stock solution (200 mg/ml), 0.8 milliliter cephamycin stock solution (250 mg/ml) and 5.0 milliliters of weedicide stock solutions (1 mg/ml), packing is poured in the culture dish behind the mixing.

4) young shoot elongation medium

50 milliliters in MSmax mother liquor (20X)

5 milliliters in MSmix mother liquor (200X)

Fe ²⁺10 milliliters of EDTA stock solutions (100X)

Sucrose 30 grams

MES 0.59 gram

Phytagel 3 grams

Adding distil water to 975 milliliter, 1N sodium hydroxide is regulated pH value to 5.7, autoclaving.Substratum adds 10 milliliters of VITAMIN stock solutions (100X) of filtration sterilization when being cooled to 50 ℃, 5 milliliters of asparagine stock solutions (10 mg/ml), 5 milliliters of glutamine stock solutions (10 mg/ml), 0.1 milliliter of IAA stock solution (1 mg/ml), 0.5 milliliter of GA ₃Stock solution (1 mg/ml), 1 milliliter of ribosylzeatin stock solution (1 mg/ml), 0.5 milliliter Ticarcillin/Clavulanate Acid stock solution (200 mg/ml), 0.8 milliliter cephamycin stock solution (250 mg/ml) and 2.5 milliliters of weedicide stock solutions (1 mg/ml), packing is poured in the culture dish behind the mixing.

5) root media

25 milliliters in B5max mother liquor (20X)

2.5 milliliters in B5mix mother liquor (200X)

Fe ²⁺5 milliliters of EDTA stock solutions (100X)

10 milliliters of B5 VITAMIN stock solutions (100X)

0.4 milliliter of NAA stock solution (0.5 mg/ml)

Sucrose 10 grams

Phytagel 6 grams

Adding distil water to 1000 milliliter is regulated pH value to 5.8 with 1N sodium hydroxide.Packing is poured in the culturing bottle behind the autoclaving.

(4) agriculture bacillus mediated soybean heredity step of converting

Test methods etc. are 200910036465.1 patent application document (Wang Xiurong etc.) with reference to the Transformation Program (Paz et al, 2004) at the state university in U.S. Iowa transgenosis center and application number.

1) seed disinfection

Seed adopts the desiccated surface sterilization.Sophisticated soybean seeds monolayer alignment in culture dish, is put into the moisture eliminator that 3～4 culture dish are housed in the stink cupboard, and all culture dish are opened, lid is close to culture dish, to guarantee having enough spaces to place the beaker of a 250mL in the centre.In the 250mL beaker, add the clorox (reactive chlorine 〉=7.5%) of 100 mL, slowly add 4.2 mL 12N HCl along wall of cup then, cover the lid of moisture eliminator immediately, standing over night (leaving standstill approximately 13.5 hours).After in chlorine body, exposing whole night, cover culture dish and put it in the laminar flow hood, again culture dish is opened about 30 min so that remove too much chlorine.

2) seed germination

Seed hilum after 10～12 sterilizations is placed in 120 * 25mm culture dish that the seed germination substratum is housed down.Culture dish is placed in the illumination box cultivated 5 days (24 ^oC, 18hr illumination, light intensity 140 m moles/m ²/ sec).

3) bacterium liquid preparation

Picking contains pTF101.1-from the fresh YEP substratum GmEXPB2Several mono-clonals of agrobacterium tumefaciens bacterial strain EHA101 put into the YEP liquid nutrient medium that 2mL has added 100mg/L spectinomycin, 25 mg/L paraxin and 50 mg/L kantlex.(250 rpm, 28 ℃) cultivate bacterium colony on shaking table, grow to saturated (about 12 hours).Getting the saturated bacterium liquid of 0.3 mL adds to and is equipped with in the 1 L triangular flask that adds corresponding antibiotic 200 mL YEP substratum.Cultivate bacterium colony, spend the night (250 rpm, 28 ℃) grow to logarithmic growth (OD in latter stage ₆₅₀=1.0～1.2), centrifugal (3,500 rpm, 10 min, room temperature) collects bacterium colony.Common substratum (CM) suspension Agrobacterium precipitation with liquid.OD during use ₆₅₀Be 1.0.

4) explant preparation and Transformation Program

Seed is cultivated 5 days in illumination box after, check to sprout cultivate box, give up pollution.Downcut seeds germinated with scalpel blade from root system, otch is in the hypocotyl zone of about 0.5 cm in ion leaf segment zone.Vertically cut seed open along the cotyledon hypocotyl, and remove the stem/bud on cotyledon epicotyl (young shoot) and the axle.Cut out 7～8 otch (about 0.5 mm is dark, and 3～4 mm are long) at cotyledon and cotyledon hypocotyl-cotyledonary node regions perpendicular in axle.The explant that cuts is put into culture dish, and is standby.

5) infect cultivation together

30 mL Agrobacterium bacterium liquid are poured in the culture dish of a 25 * 100mm.Each Agrobacterium bacterium liquid culture dish is prepared 50 explants.Guarantee that whole explant is all suspended by bacterium liquid.Infect 30 min, during often stir bacterium liquid so that explant fully contacts fresh bacterium liquid.Afterwards, explant is transferred on the common substratum, 7 explants of every ware, otch is downward, horizontal positioned.Seal culture dish with parafilm, and they are transferred to (24 ℃) in the incubator, secretly cultivated 3 days.

6) young shoot induces

After cultivating 3 days on the common substratum, embathe explant with liquid young shoot inducing culture (SI), afterwards, explant is placed on is added with 3.5mg/L glufosinate(grass ammonium phosphine) as selective agent, on 100mg/L Ticarcillin/Clavulanate Acid and 200mg/L cephamycin the SI substratum (7 explants of every ware) as fungistat.The cotyledon hypocotyl part of explant must be inserted in the substratum, and regenerating tissues then must become 30～45 oblique cutting on the surface with horizontal plane.Culture dish seals with breathable adhesive tape, and 5 culture dish one are folded, cultivate (24 ℃, the periodicity of illumination of 18/6hr).Explantation tissue grew 14 days on the SI substratum.In first week end, rearrange whenever folded culture dish so that top and bottom transposing.After 14 days, the position of the joint in formation cuts the cotyledon hypocotyl with flushing.Fresh cut surface is inserted in the new SI substratum, and the differentiation zone then flushes with media surface; Allow then be organized under the identical growth conditions, in incubator, continued to induce 14 days.

7) elongation of young shoot

The explant of differentiation is transferred on the young shoot elongation medium (SE), abandoned remaining undifferentiated explant.Cut cotyledon from explant, and cut a new otch at the base portion of the joint of growing.Explant transferred to fresh be added with 2.5mg/L glufosinate weedicide, on 100mg/L Ticarcillin/Clavulanate Acid and 200mg/L cephamycin the SE substratum, in the growth case, cultivated for 2～8 weeks as fungistat as selective agent.Every changing once fresh SE substratum 2 weeks.Cut a fresh horizontal cut at the explant base portion when changing substratum each time.

8) take root

Under selective pressure, when young shoot grows at least 3 cm length, they are scaled off from tissue.Then it is transferred to and continue in the vial that root media is housed to cultivate.After two weeks, when stem grows more than 2 roots, plant is taken out from substratum lightly, wash root to remove substratum with tap water.Seedling is transplanted in the basin (diameter 15cm) that matrix is housed.Seedling in incubator, grew for 4 weeks (24 ℃, the 18/6hr intensity of illumination).Water the Hoagland nutritive medium weekly once.Then seedling is transferred to hot-house culture to bearing pods.

Soybean transformation kind Guangdong spring 03-3 obtains transgenosis individual plant T0 for plant.With the integration of goal gene in the southern hybridization detection soybean gene group, use the fluorescence quantitative PCR detection goal gene at the intravital expression amount of plant.Obtain the plant of overexpression, and carry out numerous kind, obtain T3 and T4 for stablizing transgenic line.

Embodiment 3 overexpressions GmEXPB2The Function Identification of transfer-gen plant

Measure soybean and stablize transgenic line biomass, phosphorus absorbed dose and the long and root surface area of total root, the discovery transfer-gen plant is compared with the contrast soybean plant strain, the phenotype that shows expectation changes, and promptly total root length and root surface area are significantly higher than contrast, and biomass and phosphorus absorbed dose also are higher than contrast.Proved that this gene can change the Root morphology configuration by genetic transforming method realization of the present invention and improve the assimilated efficiency of soybean plant strain to phosphorus in the medium, this mechanism of action with the gene that the applicant formerly studies is significantly different, gene of the present invention is by promoting root growth, increase the soil area that root system touches, thus the amount of available state inorganic phosphorus in the soil that the increase root system absorbs.

1, total root is long measures

Whole root system takes out from nutritive medium, after cleaning, scans two-dimentional root system with desktop scanners, calculates morphological parameters such as total root length, root surface area respectively through WinRhizo software.

, the plant content of tatal phosphorus measures

Overground part, root sample are pulverized with sample mill, adopt dry ashing, and molybdenum blue colorimetric method is measured plant content of tatal phosphorus (Murphy and Riley, 1963), and measuring wavelength is 700 nm.

Table 1 the present invention obtains GmEXPB2In T4 generation, stablizes the genetically engineered soybean strain and ties up to growth performance results in the low-phosphorous soil

	Root dry weight (gram/strain)	The per-cent % that rises
			The negative plant of transgenosis	0.14±0.02	?
Transgenic line 1	0.21±0.02	47.3
			Transgenic line 2	0.18±0.01	30.5
?	?	?
			?	The upperground part biomass (gram/strain)	?
The negative plant of transgenosis	2.86±0.06	?
			Transgenic line 1	3.72±0.40	29.9
Transgenic line 2	3.63±0.24	26.8
			?	?	?
?	Total root long (cm/ strain)	?
			The negative plant of transgenosis	930.82±77.28	?
Transgenic line 1	1295.58±92.57	39.2
			Transgenic line 2	1161.40±90.47	24.8
?	?	?
			?	Root surface area (cm 3/ strain)	?
The negative plant of transgenosis	124.34±5.89	?
			Transgenic line 1	116.74±10.02	40.8
Transgenic line 2	88.31±8.93	32.2
			?	?	?
?	Overground part phosphorus absorbed dose (milligram/strain)	?
			The negative plant of transgenosis	5.90±0.65	?

Transgenic line 1	9.09±1.02	54.0
			Transgenic line 2	8.34±0.75	41.3

Annotate: data are three multiple mean value and standard error thereof in the table.

By data in the table as seen, two independently the overground part of transgenic line and root biomass contrast soybean and have increased by 47.3%, 30.5% and 29.9,26.8%% respectively; Total root length and root surface area have improved 39.2%, 24.8% and 40.8%, 32.2%; The phosphorus absorbed dose has improved 54.0%, 41.3%.

SEQUENCE?LISTING

 

＜110〉Agricultural University Of South China

 

＜120〉application of gene GmEXPB2 aspect raising soybean plant strain phosphorus assimilated efficiency

 

<130>

 

<160> 2

 

<170> PatentIn?version?3.5

 

<210> 1

<211> 32

<212> DNA

＜213〉forward primer sequence

 

<400> 1

aaaacccggg?ctatcaacta?cctataggga?ac 32

 

 

<210> 2

<211> 31

<212> DNA

＜213〉reverse primer sequence

 

<400> 2

aaaatctaga?ccacaagctg?atgatagatc?c 31

Claims (5)

1. gene GmEXPB2Application improving aspect the soybean plant strain phosphorus assimilated efficiency is characterized in that it being overexpression coding soybean β in soybean-expand proteic gene GmEXPB2Realize; Described gene GmEXPB2Be numbered EU362626, full length gene cDNA is 1048bp, 227 amino acid of encoding; Described overexpression is by PCR method, with GmEXPB2Genomic fragment as applying gene, the design primer, amplify GmEXPB2The full length coding region of gene is driven by strong promoter 35S, is connected on the overexpression carrier, carries out genetic transformation; Described primer is:

Forward primer (5'-3'):

AAAACCCGGGCTATCAACTACCTATAGGGAAC；

Reverse primer (5'-3'):

AAAATCTAGACCACAAGCTGATGATAGATCC。

2. application according to claim 1 is characterized in that it being overexpression gene in soybean GmEXPB2Promote plant root growth, the amount of available state inorganic phosphorus in the soil that the increase root system absorbs.

3. application according to claim 1 is characterized in that the amplification condition of described PCR method is: 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 60 seconds, 30 circulations.

4. application according to claim 1 and 2 is characterized in that described soybean varieties is Guangdong spring 03-3.

5. application according to claim 1 is characterized in that described genetic transformation may further comprise the steps:

(1) seed disinfection and seed germination;

(2) agrobacterium tumefaciens EHA101 bacterium liquid preparation;

(3) explant preparation and Transformation Program;

(4) infect cultivation together;

(5) young shoot induces, extends;

(6) take root, obtain transgenosis individual plant T ₀For plant.

Images