CN100429310C

CN100429310C - Gene for controlling paddy tillering and usage

Info

Publication number: CN100429310C
Application number: CNB2006100185450A
Authority: CN
Inventors: 张启发; 陈志辉; 吴昌银
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2006-03-15
Filing date: 2006-03-15
Publication date: 2008-10-29
Anticipated expiration: 2026-03-15
Also published as: CN101037694A

Abstract

The invention relates to plant gene engineering field, specially relates to a isolation and cloning of Osa-MIR156e gene for controlling rice tillering and application therefor. The Osa-MIR156e gene has a plurality of orthologous genes in rice gene groups in gene family MIR156 same with arabidopsis ath-MIR156 gene. The Osa-MIR156e gene has function of controlling rice tillering, raising or abating expression amount of Osa-MIR156e gene to control plant tillering or branching amount to generate ideal plant type, so the object of increase production is accessed.

Description

The gene and the purposes of control rice tillering

Technical field

The invention belongs to plant genetic engineering field.Be specifically related to a kind of gene Osa-MIR156e that controls rice tillering, relate to the application of this gene in transgenic paddy rice or transgenic paddy rice seed simultaneously.The present invention adopts the genetic method of forward, screening T-DNA inserts the rice mutant storehouse, be cloned into control rice tillering gene Osa-MIR156e, show that by being divided into this gene and the mutant phenotype of tillering are closely linked more from detection, and by overexpression Osa-MIR156e gene, make normal paddy rice many phenotypes of tillering occur, confirmed the function of this gene.Also relate to other member of this gene family of containing this gene and having this gene core sequence, thereby and contain the homogenic carrier of other dna fragmentation of its core sequence and other species and relate to and utilize the tillering ability of this gene or its functional analogue regulation and control plant to improve the output of farm crop.

Background technology

Paddy rice is as important crops, and the people more than 1/3rd is a staple food with it in the world.Simultaneously, because paddy rice has little, the meticulous heredity of genome and physical map, relatively easy transgenic technology reach and the collinearity of other gramineous crop, done model plant and look.Along with finishing of the multiple biological gene group order-checking that comprises paddy rice, the mankind begin to enter the genome times afterwards comprehensively.Carry out functional genome research has become the field, forward position of life science comprehensively.Therefore the research of paddy rice functional gene is significant to socio-economic development and biological study.

For solving the contradiction that population growth and cultivated area reduce, improve paddy rice yield per unit and be still the challenge that people face.50, the cultivation of the hybrid rice of the breeding wheat for semidwarfness of the sixties and the seventies is twice revolution of increasing production of rice, but the volume increase of paddy rice began to pace up and down in recent years.International paddy rice institute (IRRI) proposition Ideal Rice Plant Type breeding in 1994, just be based on and reduce the sum of tillering, improve the percentage of earbearing tiller, mould guiding theory (the Khush G S.Breakingthe yield frontier of rice.Geo Journal of big panicle many grains per panicle one class novel strain type (NPT), 1995,35 (3): 329-332)." super high-yielding rice breeding plan " essence of China also be unable to do without the plant type problem.In yield component spike number, grain number per spike and grain were heavy, what of spike number were limited by the generating capacity of tillering to a great extent, thereby to tiller be one of Main Agronomic Characters that influences staple crops per unit area yields such as paddy rice and wheat.

Tillering is a kind of special branch characteristic that monocotyledons forms in growth and development process.Usually the axil at each joint all has a tiller bud, and the differentiation of tiller bud takes place early, and when leaf primordium grew up to the cap shape, some cells of its base portion quickened the tiller original hase that division forms protuberance.These tiller original hases continue differential growth and become tiller bud.But only be positioned at the stem culm base do not extend tiller bud on the internode can elongation growth for tillering; And the tiller bud on the cane upper extended internode does not generally extend and be in dormant state.If envrionment conditions is suitable, from the bottom joint of rice stem, these tiller buds all can develop into and tiller from bottom to top.Tillering of on stem, forming be called one-level and tiller, can form secondary on one-level is tillered and tiller, and the like.Therefore, the best result tiller number of a strain paddy rice is the summation of tillering and growing up on whole tillers, the tiller position.In normal (wild-type) paddy rice, to tiller based on one-level and secondary, tillering of higher category then seldom forms.Rice seedlings enter tillering phase when growing to 4 blades.It not is The more the better tillering.Later stage tiller generally be can not Cheng Sui ineffective tillering.Kind has the early growth and quick tiller characteristic and then helps improving the quality of tillering, and improves the percentage of earbearing tiller, thereby improves the output of paddy rice.(Li Xueyong etc., the molecular mechanism research of rice tillering.Bulletin of Chinese Academy of Sciences, 2003 (4): 274-276; Ren Xiang etc., the location of rice tillering ability QTL.Wuhan University's journal (version of science), 2003,49 (4): 533-537).

Rice tillering is the development character of a complexity.It is generally acknowledged that tillering number is the quantitative character of controlled by multiple genes, its heritability is often lower, and illumination, irrigation, fertilizer, temperature etc. all can have a significant impact.Application dynamic gene localization methods such as Wu have been located 5 quantitative trait locis (quantitative trait locus in recombinant inbred lines, QTL) (Wu W Ret al., Time-Related Mapping of Quantitative Trait Loci Underlying Tiller Number in Rice.Genetics, 1999,151:297-303.).Application double haploid colonies such as Yan have found a plurality of relevant QTL of tillering, but wherein have only 1 to play a role in whole tillering phase.So far 23 quantitative character QTLs sites that influence tillering number have been found, be distributed in (Yan J Q et al., QuantitativeTrait Loci Analysis for the Developmental Behavior of Tiller Number in Rice (Oryza sativaL.) on all the other 10 karyomit(e)s except that the 9th, No. 10.Theor?Appl?Genet，1998，97：267-274.)。

Study some by mutant and become a kind of important function of gene functional study means with plant-growth, gene that growth is relevant with other proterties.In fact a collection of and the relevant important gene of development of plants adjusting all have been separated to by traditional chemomorphosis, radioinduction and the transposon that adopts recently and T-DNA labeling acts, but most of research is just carried out phenotype description or gene Primary Location to mutant, has only small part to be cloned into gene.John Doebley etc. utilized transposon tagging to be separated to a teosinte stem armpit and give birth to branch amount genes involved TB1 (John Doebley et al. in 1997, The evolution of apical dominance in maize.Nature, 1997,386:485-488; Martienssen R., The origin of maize branches out.Nature, 1997,386:443.).Schumacher K etc. were cloned into control tomato side shoot producer LS (Schumacher K et al. in 1999, The lateral suppressor (LS) gene oftomato encodes a new member of the VHIID protein family.Proc.Natl.Acad.Sci.USA, 1999,96:290-295).Greb T in 2003 etc. are cloned into side shoot suppressor gene LAS (the Greb T et.Molecular analysis of the LATERAL SUPPRESSOR gene in Arabidopsis reveals a conservedcontrol mechanism for axillary meristem formation.Genes Dev. of Arabidopis thaliana, 2003,17:1175-1178.).And the clone of rice tiller control gene MOC 1 be in recent years phytomorph build up particularly side shoot form one of most important progress in the research field (Li X et al., Control oftillering in rice.Nature, 2003,422:618-621).Though be cloned into the gene that some controlling plant are tillered at present, still unclear to the molecule mechanism that plant tillers.Various mutant libraries are all being created by many in the world now countries, and as the platform clone gene, this is a kind of efficient and simple method, and the more plant gene of tillering also is expected to by the separated clone of this method.The present invention utilizes this method to be cloned into the gene Osa-MIR156e of control rice tillering proterties.

Summary of the invention

The objective of the invention is to be to provide a kind of gene Osa-MIR156e that controls rice tillering, nucleotide sequence shown in SEQ.ID.No.1, or have other member of this gene family of its core sequence 5 ' TGACAGAAGAGAGTGAGCAC 3 ' and other dna fragmentation that contains its core sequence.

Another object of the present invention is to provide a kind of application of rice tillering gene Osa-MIR156e in transgenic paddy rice of controlling.

A further object of the present invention is to provide a kind of application of rice tillering gene Osa-MIR156e in transgenic paddy rice seed of controlling.Control the rice tillering number by control Osa-MIR156e gene or the expression amount of its homologous gene in paddy rice, thereby form ideotype, reach the purpose of volume increase.The clone of this gene is also significant and to the molecular mechanism research that plant tillers great pushing effect will be arranged to the biological function of illustrating the MIR156 gene family.

Realize that technology of the present invention is as follows:

1. create mutant library (T0 generation)

Agriculture bacillus mediated method is created paddy rice T-DNA and is inserted mutant library (T0 generation).

The proterties land for growing field crops screening 2.T1 generation tillers

For selecting 3000 parts of seeds (T1 generation) the mutant library, normal field condition is planted every part of kind 20 strains (being called 1 family) down from T0.Observe the mutant tiller number and change, observing about 100 familys altogether has the tiller number sudden change.

3. mutating strain series and T-DNA are divided into from detecting and the initial analysis of T-DNA copy number.

With PCR (polymerase chain reaction) method detect sudden change family and T-DNA whether be divided into from, have in 100 familys of suddenling change 41 for the PCR positive be divided into from.And each is divided into to leave home be that 20 individual plants of being planted are done positive detection, and roughly estimating the T-DNA copy number, can occur separating at 3: 1 according to broad-mouthed receptacle for holding liquid Dare genetic development unit point gene, when the positive: negative=be single the copy 3: 1 the time.

4. separation flanking sequence

41 T-DNA are divided into to leave home be to be Tail-PCR (Liu Y G, Whittier R F.Thermal asymmetricinterlaced PCR:Automatable amplification and sequencing of insert end fragments from P1and YAC clones for chromosome walking.Genomics, 1995,25:674-681) separate flanking sequence, there are 15 familys to be separated to flanking sequence, analyze flanking sequence and find that the flanking sequence of 7 familys can well be positioned on the rice genome.

5. further do according to flanking sequence design primer and be divided into from detection

Do further to be divided into from checking according to flanking sequence design primer, as Fig. 2, A is illustrated in the primer that inserts the site upstream design, and B is illustrated in the primer that inserts the design of downstream, site, and C represents the primer according to the design of T-DNA internal sequence.T1 for plant in, the T-DNA homozygous plants has only going out that A and C pairing can increase, because have T-DNA insertion A and B paired product can't obtain amplified fragments too greatly, the plant of wild-type is not owing to there is the insertion of T-DNA, have only A and B pairing can obtain product, heterozygous plant then can be increased when A and C pairing and A and B pairing and be obtained product.If mutant character is recessive, all mutant strains with A and B pairing can not expand for be divided into from.If mutant character is a dominance, then all sudden change individual plants all expand with B and C pairing, normal individual plant with B and C match all can not expand for be divided into from.Pcr analysis, have only in 7 familys as a result a family be divided into from.Its mutant phenotype such as Fig. 3.PCR result, as Fig. 4: wherein

swimming lane

4,6, and 10,16,19,20 isozygoty for T-DNA; 2,3,7,8,9,12,13,14 is the T-DNA heterozygosis; 1,5,11,15,17,18 is the T-DNA feminine gender.With the contrast of field phenotype,, the dwarfing, sterile many of T-DNA homozygous plants phenotype for tillering; T-DNA heterozygous plant phenotype is many for tillering, downgrade, can educate; The negative plant phenotype of T-DNA is normal, shows separation in 1: 2: 1.

6.T2 in generation, further does and is divided into from checking

For the genetic stability of verifying this mutant and further checking be divided into from situation, having bred a generation again is T2 generation because T1 in generation the T-DNA homozygous mutation do not have seed, can only plant heterozygote, three kinds of phenotypes that expecting appears in the result, and meet separation in 1: 2: 1; Separating does not appear in the next generation of normal individual plant, still acts normally.Simultaneously PCR detect the insertion that shows T-DNA and mutant phenotype be divided into from.Prove that thus this mutant is because this T-DNA inserts the unit point dominant mutation that causes.

7. determine the mutational site, obtain candidate gene

This mutant T-DNA inserts paddy rice the 4th karyomit(e), corresponding clone number in the GenBank Nucleotide database (http://www.ncbi.nlm.nih.gov): AL442115, inserting this clones by the 20054th bit base, analyze and insert near the gene discovery site, a coding miRNA gene Osa-MIR156e is arranged at a distance of the 1156bp place, the miRNA precursor of its coding can form loop-stem structure, as Fig. 5.

8.Osa-MIR156 the functional verification of gene

Overexpression Osa-MIR156 gene is verified its function.Make up overexpression vector pU17310, adopt the genetic transforming method of Agrobacterium EHA105 mediation, overexpression vector imported in the normal japonica rice variety spend 11, obtain tissue cultured seedling 100 strains of overexpression at last, in contrast by young plant 30 strains of spending 11 callus differentiation in the normal japonica rice variety, all plant in the land for growing field crops, the result has 50% overexpression tissue cultured seedling to occur tillering many approximately, half is short, semisterile mutant phenotype.Illustrate that the Osa-MIR156e gene has the function of control rice tillering, also make paddy rice occur downgrading and sterile phenotype simultaneously.

9.Osa-MIR156 the application of gene

For solving the contradiction that population growth and cultivated area reduce, improve paddy rice yield per unit and be still the challenge that people face.50, the cultivation of the hybrid rice of the breeding wheat for semidwarfness of the sixties and the seventies is twice revolution of increasing production of rice, but the volume increase of paddy rice began to pace up and down in recent years.International paddy rice institute (IRRI) proposition Ideal Rice Plant Type breeding in 1994, the guiding theory that just be based on control rice tillering sum, improves the percentage of earbearing tiller, moulds big panicle many grains per panicle one class novel strain type.By agriculture bacillus mediated genetic transforming method also can be the expression amount of particle bombardment or other genetic transforming method overexpression control rice tillering gene Osa-MIR156e in paddy rice improve paddy rice tiller number or suppress to express the expression amount of control rice tillering gene Osa-MIR156e in paddy rice by genetic transforming method and reduce the rice tillering number, reach the purpose of control rice tillering number, form ideotype.So according to the requirement increase of different rice varieties or the tiller number of minimizing paddy rice, form the ideal plant type of rice, reach the purpose of volume increase.Control rice tillering gene Osa-MIR156e can use also in transgenic paddy rice and can use in transgenic paddy rice seed, cultivates to have the kind of good plant type of rice.

Advantage of the present invention and effect:

1. the successful clone of this gene has further confirmed to adopt the feasibility of T-DNA labeling acts clone gene, and this method clone gene speed is fast, the efficient height.

2. though the most gene among the ath-MIR156 of arabidopsis gene family is cloned, but and do not know the biological function that it is concrete, the present invention clone's Osa-MIR156e gene pairs rice tillering has remarkable influence to see Fig. 3, and this is significant to the biological function of illustrating the MIR156 gene family.

Though 3. at present be cloned into the gene that some controlling plant are tillered, still unclear to the molecule mechanism that plant tillers.And the present invention clone's Osa-MIR156 gene can be controlled the tiller number of paddy rice, and this will have great pushing effect to the molecular mechanism research that plant tillers.

4.Osa-MIR156 gene not only influences tiller number, mutant is shown downgrade and sterile phenotype, the functional study of this gene is far-reaching for the Research Significance of plant Main Agronomic Characters.

5. this mutant improves the rice tillering number widely, illustrating that the Osa-MIR156e gene pairs changes tillers that the good results are evident, improve or weaken Osa-MIR156e expression of gene amount and can controlling plant tiller or branched quantity by genetic engineering technique, thereby help forming ideotype, reach the purpose of volume increase.

Description of drawings

Fig. 1. create the used pSMR-J18R carrier of mutant library figure.

Fig. 2. be divided into from synoptic diagram according to inserting the checking of site design primer.A is illustrated in the primer that inserts the site upstream design, and B is illustrated in the primer that inserts the design of downstream, site, and C represents the primer according to the design of T-DNA internal sequence.T1 for plant in, the homozygous mutation body has only going out that A and C pairing can increase, because have T-DNA insertion A and B paired product can't obtain amplified fragments too greatly, the plant of wild-type is not owing to there is the insertion of T-DNA, have only A and B pairing can obtain product, heterozygous plant then can be increased when A and C pairing and A and B pairing and be obtained product.

Fig. 3. the paddy rice mutation type surface of tillering more.A left side: T-DNA homozygous mutation; In: the assorted and sudden change of T-DNA; Right: normal phenotype.

Fig. 4. according to inserting site design primer checking isolating PCR result altogether.Lastrow primer: A+B, next line primer: C+B, M represent 2KB Maker, and wherein

swimming lane

Fig. 5 .Osa-MIR156e gene, the loop-stem structure that the miRNA of its coding forms.

Fig. 6 .T2 is total to isolating PCR result for checking.Lastrow primer: A+B, next line primer: C+B, M represent 2KB Maker,

swimming lane

2,6,7,13,19,20,28,31,37,40 is the T-DNA homozygous plants; 1,3,4,8,10,11,12,15,16,17,21,22,24,25,27,29,32,34,36,38,39 is T-DNA heterozygosis individual plant; 5,9,14,18,23,26,30,33,35, be the negative individual plant of T-DNA.With the contrast of field phenotype,, the dwarfing, sterile many of T-DNA homozygous plants phenotype for tillering; T-DNA heterozygous plant phenotype is many for tillering, downgrade, can educate; The negative plant phenotype of T-DNA is normal, shows separation in 1: 2: 1.

Fig. 7. overexpression is tested used pU1301 carrier figure.

Embodiment

Embodiment 1: separating clone Osa-MIR156e gene

1. create mutant library (T0 generation)

Used carrier pSMR-J18R, (Center for the Application ofMolecular Biology to International Agriculture) is so kind as to give by Australian CAMBIA laboratory, as Fig. 1, in japonica rice variety, spend in No. 11 (Oryza sativa L.subsp.japonica cv.Zhonghua 11) genomes in Agrobacterium EHA105 mediation mode and to insert T-DNA (containing Enhancer Trap) (Springer P S.Gene Traps:Tools for plant development andgenomics.Plant Cell at random, 2000,12:1007-1020) create mutant library.The structure of mutant library is according to (Wu C et al. such as Wu, Development of enhancer trap lines for functional analysis of the rice genome.Plant J, 2003,35:418-427) described method makes up and forms.Obtain 100,000 strain independence transformants at present approximately.

The proterties land for growing field crops screening 2.T1 generation tillers

For selecting 3000 parts of T1 the mutant library, draw 5 * 8 cun grid sowing from T0 earlier in the rice seedling bed, transplant again to the land for growing field crops after 20 days and screen for seed.Every part of material kind 2 row, every row 10 strains, totally 20 strains (being 1 family), row and 8 cun of interline spaces, spacing is 5 cun between strain and strain.After the rice plant of tillering stage end, the sudden change situation that begins to observe each family tiller number.Observe about 100 familys altogether tiller number sudden change (become many or tail off) is arranged.

With PCR method detect sudden change family and T-DNA whether be divided into from, promptly mutant strain must be the T-DNA positive.The primer: GAL4-L 5 ' AGA CCGGCAACAGGATTCAATC 3 ', GAL4-R5 ' TTCGTCCAGGACAACGTGAAC A 3 ', the cumulative volume of reaction system is 20 μ l, dna profiling 1ul (about 50ng), 1 * Taq enzyme reaction buffer solution, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, 10uM primer 0.2ul, 0.3 Taq of unit enzyme, add ddH20 (aseptic deionized water) to 20 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 1min 30cycles, 72 ℃ are extended 5min.Expanding the fragment that is the fragment of T-DNA, and size is 611bp.100 sudden changes have in the familys 41 for the PCR positive be divided into from.And to being divided into to leave home be that 20 individual plants of being planted are done positive detection, roughly estimate the T-DNA copy number, can occur separating at 3: 1 according to mendelian inheritance unit point gene, when the positive: negative=be single the copy 3: 1 the time.

4. separation flanking sequence

41 T-DNA are divided into to leave home be that Tail-PCR method by Liu etc. is separated flanking sequence (Liu Y G, Whittier R F.Thermal asymmetric interlaced PCR:Automatable amplification and sequencingof insert end fragments from P1 and YAC clones for chromosome walking.Genomics, 1995,25:674-681).Utilize the total DNA of CTAB method extracting mutant, (SAGHAI-MAROOF et al. such as method such as SAGHAI-MAROOF, Ribosomal DNA spacer-length polymorphisms in barley:Mendelian inheritance, chromosomal location, and population dynamics.Proc.Natl.Acad.Sci.USA, 1984,81:8014-8018).According to the nested type special primer sequence of the T-DNA left distal end of conversion carrier pSMR-J18R design and the primer corresponding following LSP2 in position (primer) on carrier: 5 '-GAAGTACTC GCC GATAGTGGAAAC C-3 ' 6701-6677; LBT2 (primer): 5 '-ATAGGG TTT CGC TCA TGT GTT GAG CAT-3 ' 6550-6524; LBT3 (primer): 5 '-CCA GTA CTAAAA TCC AGA TCC CCC GAA T-3 ' 6447-6420.The degenerated primer and the sequence thereof that are used to separate flanking sequence are: AD2a (primer): 5 '-(AGCT) GT CGA (GC) is G A (AGCT) A (AT) GA A-3 ' (AT).Reaction system is: the first round: dna profiling 1.0 μ l; 10 * buffer, 2.0 μ l; 2Mm dNTP 2.0 μ l; 25Mm MgCl22.0 μ l; 10 μ M Auele Specific Primers, 0.2 μ l; 100 μ M degenerated primers, 0.2 μ l; Taq enzyme 1u; Add ddH2O to 20 μ l.Second takes turns: dna profiling 1.0 μ l; 10 * buffer, 2.0 μ l; 2Mm dNTP 2.0 μ l; 25Mm MgCl2 2.0 μ l; 50% glycerine, 2.0 μ l; 10 μ M Auele Specific Primers, 0.2 μ l; 100 μ M degenerated primers, 0.2 μ l; Taq enzyme 1u; Add ddH2O to 20 μ l.Third round: dna profiling 1.0 μ l; 10 * buffer, 2.0 μ l; 2Mm dNTP 1.5 μ l; 25Mm MgCl2 1.2 μ l; 50% glycerine, 2.0 μ l; 10 μ M Auele Specific Primers, 0.2 μ l; 100 μ M degenerated primers, 0.2 μ l; Taq enzyme 1u; Add ddH2O to 20 μ l.Response procedures carries out according to the method for Liu etc.After reaction is finished, get third round reaction product 5 μ l and on 0.8% sepharose, detect.Adopt low melting-point agarose to dig the method purifying PCR reaction product that glue reclaims.Purification process is: with third round PCR reaction product electrophoresis on 1% low melting-point agarose, the amplified production band is put into 1.5ml Eppendorf centrifuge tube from the glue cutting-out, 65 ℃ of water-bath 15min, add equal-volume PH7.9 phenol, put upside down and shake up 5min, the centrifugal 8min of 13000r/min, get supernatant, add the equal-volume chloroform: primary isoamyl alcohol (volume ratio 24: 1) is put upside down and is shaken up 5min, the centrifugal 8min of 13000r/min gets supernatant, adds 1/10 volume 3M sodium-acetate (PH5.2), 95% ethanol of 2 times of volume precoolings, in the mixing postposition-20 ℃ refrigerator more than the 20min, the centrifugal 15min of 13000r/min embathes precipitation with 75% ethanol after outwelling 95% ethanol again, natural air drying, the DNA precipitation is dissolved in 20 μ l aseptic deionized waters.Reclaiming the product order-checking, sequencing primer sequence and the position on carrier are: NTLB5 (primer): 5 '-AATCCAGAT CCC CCG AAT TA-3 ' 6437-6418, there are 15 familys to be separated to flanking sequence, analyze flanking sequence and find have the flanking sequence of 7 familys well to be positioned on the rice genome.

Match condition according to flanking sequence and rice genome, can determine to insert the site, design a pair of primer A and B on the both sides of inserting the site, and T-DNA goes up primer C of design, as Fig. 2, A is illustrated in the primer that inserts the site upstream design, and B is illustrated in the primer that inserts the design of downstream, site, and C represents the primer according to the design of T-DNA internal sequence.T1 for plant in, the T-DNA homozygous plants has only going out that A and C pairing can increase, because have T-DNA insertion A and B paired product can't obtain amplified fragments too greatly, the plant of wild-type is not owing to there is the insertion of T-DNA, have only A and B pairing can obtain product, heterozygous plant then can be increased when A and C pairing and A and B pairing and be obtained product.If mutant character is recessive, all mutant strains with A and B pairing can not expand for be divided into from.If mutant character is a dominance, all sudden change individual plants all expand with C and B pairing, normal individual plant with C and B match all can not expand for be divided into from.The ultimate analysis result, have only in 7 familys a family be divided into from.This is divided into and leaves home is mutant phenotype such as Fig. 3, and its isolating flanking sequence total length 902 bp are as follows:

tgccgatatt?agtaattaaa?aaccctggcg?agttgcttcc?gatcttgtac?aggagcccag?caaattaaac

tcaagtaaaa?ctagtggggg?atatatatgg?actctgaacc?gagagagggt?ggtaagtacg?agcaccatga

atggaacagt?ggcccaacag?tatcctacat?ttttggagcc?attgggggac?aatgcatcgt?tgcaccatta

ctccctactt?tgaatgccag?agcgagatgt?gaggtgttaa?ttctcaagaa?catggaggac?cagcaggaca

gcagaagata?actgactgat?gataagggga?agccgctcca?agcagatctg?ggtctcagta?ctgttcctgc

ctgtcctcct?tcctcctcct?ctctctcctc?cgatcctgat?catgtagcta?gctgatcttc?tacacacttg

tgtgcttaat?tacgactgta?acactggatg?gggcgctaca?gtaagatgat?cgaagctatg?tatcaatttc

taaacaagat?taaaaagatg?ctcgatctag?attgacattt?tctgacatgc?ccatgggaga?ttgcctgcga

ctgattctga?ttaataccag?tagcctagat?gcaatcaata?gcactagtat?actagttgca?tgttcctacc

atgatgggga?atgaatagaa?agactgccta?gtactagcta?gctagctagt?cgactagcag?ctacgcactc

ttgcctaaat?gcatgaaaga?aatgtcgtcg?tacttatttg?accgcaggag?tattttgtaa?acacgcaact

gcatggcctg?taccttccta?ccgtttcatt?gcataaaacc?tggattccaa?ttggcaattc?cgtaccctgg

cattgttttt?gactcattcc?cttaattggc?aatatccaaa?gaaaccggaa?cgaattgttt?tc

Adopt BLAST analytical procedure (Altschul S F et al., Basic local alignment search tool.J.Mol.Biol., 1990,215:403-410) the clone in discovery flanking sequence and the GenBank Nucleotide database: AL442115 can be good at coupling, the 24-353 of flanking sequence, 382-478 respectively with the 20054-19726 of AL442115, the 19698-19605 coupling, homology is up to 97%.According to the primer sequence that inserts the site design is A (primer): 5 ' CTTAGCCAAACTTCATTGTTATCTG3 '.B (primer): 5 ' AGTCGGTGTTGATGCCTGTA3 '.C (primer): 5 ' AATCCAGATCCCCCGAATTA3 '.The cumulative volume of PCR reaction system is 20 μ l, dna profiling 1ul (about 50ng), 1 * Taq enzyme reaction buffer solution, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, 10uM primer 0.2ul, 0.3 Taq of unit enzyme, add ddH2O to 20 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 1min 30cycles, 72 ℃ are extended 5min.PCR result, as Fig. 4, wherein swimming lane 4,6, and 10,16,19,20 isozygoty for T-DNA; 2,3,7,8,9,12,13,14 is the T-DNA heterozygosis; 1,5,11,15,17,18 is the T-DNA feminine gender.With the contrast of field phenotype,, the dwarfing, sterile many of T-DNA homozygous plants phenotype for tillering; T-DNA heterozygous plant phenotype is many for tillering, downgrade, can educate; The negative plant phenotype of T-DNA is normal, shows separation in 1: 2: 1.Illustrate that this mutant phenotype is that the T-DNA insertion causes really.

6.T2 in generation, further does and is divided into from checking

For genetic stability and the further checking of verifying this mutant is divided into from situation, having bred a generation again is T2 generation.T1 is withheld the planting seed that obtains obtain T2 generation,, can only plant heterozygote, three kinds of phenotypes that expecting appears in the result, many, the dwarfing, sterile of promptly tillering because the T-DNA homozygous mutation does not have seed in T1 generation; Tiller many, downgrade, can educate and normal 3 kinds, and meet separation in 1: 2: 1.And separating does not appear in the next generation of normal individual plant, still acts normally.Simultaneously PCR detect the insertion that shows T-DNA and mutant phenotype be divided into from, as Fig. 6, swimming lane 2,6,7,13,19,20,28,31,37,40 is the T-DNA homozygous plants; 1,3,4,8,10,11,12,15,16,17,21,22,24,25,27,29,32,34,36,38,39 is T-DNA heterozygosis individual plant; 5,9,14,18,23,26,30,33,35, be the negative individual plant of T-DNA.With the contrast of field phenotype,, the dwarfing, sterile many of T-DNA homozygous plants phenotype for tillering; T-DNA heterozygous plant phenotype is many for tillering, downgrade, can educate; The negative plant phenotype of T-DNA is normal, shows separation in 1: 2: 1.Prove that thus this mutant is because T-DNA inserts the unit point dominant mutation that causes.

7. determine the mutational site, obtain candidate gene, and carry out functional analysis

Adopt the BLAST analytical procedure to find, this mutant T-DNA inserts paddy rice the 4th karyomit(e), clone in the corresponding GenBank Nucleotide database number is: AL442115, inserting this clones by the 20054th bit base, analyze and insert near the gene discovery site, at a distance of the 1156bp place coding miRNA gene Osa-MIR156e is arranged, the miRNA precursor of its coding can form loop-stem structure, as Fig. 5.The Osa-MIR156e gene has a plurality of homologous genes in rice genome, belong to same gene family MIR156 with Arabidopis thaliana ath-MIR156 gene.Though in Arabidopis thaliana, be cloned into the portion gene among the gene family ath-MIR156, but and do not know the biological function that it is concrete, and whether the Osa-MIR156e gene expresses in paddy rice also (the Matthew W.Rhoades et al. of confirmation, Prediction of Plant MicroRNA Targets.Cell, 2002,110:513-520; Brenda J.Reinhart et al., MicroRNAs in plants.GENES ﹠amp; DEVELOPMENT, 2002,1616-1626).The present invention clone's Osa-MIR156e gene pairs rice tillering has remarkable influence, and this is significant to the biological function of illustrating the MIR156 gene family.The Osa-MIR156 gene not only influences tiller number in addition, mutant is shown downgrade and sterile phenotype, illustrates that this gene has multiple function.By the PCR method Osa-MIR156 gene that increases, and be cloned into overexpression vector, see embodiment 2.

The functional verification and the application of embodiment 2:Osa-MIR156 gene

1. the structure of genetic transformation carrier

Used carrier is the pU1301 that this laboratory makes up.PU1301 is plant genetic conversion carrier pCAMBIA1301 (Sun etc. commonly used in the world, 2004, Xa26, a gene conferring resistance to Xanthomonas oryzaepv.oryzae in rice, encoding a LRR receptor kinase-like protein.Plant Journal.37:517-527) reconstructs on the basis, carry the agriculture bacillus mediated genetic transformation carrier (Fig. 7) of corn ubiquitin promoter with composing type and overexpression feature.The pCAMBIA1301 carrier is so kind as to give by Australian CAMBIA laboratory (Center for theApplication of Molecular Biology to International Agriculture).Use PCR method, directly expand target gene SEQ.ID.No.1 from rice genome, the cumulative volume of PCR reaction system is 20 μ l, oryza sativa genomic dna template 1ul (about 50ng), 1 * Taq enzyme reaction buffer solution, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, each 0.2ul of 10uM primer, 50% glycerine 2ul, 0.3 rTaq of unit enzyme (Takara company), add ddH2O to 20 μ l.Response procedures is: 94 ℃ of sex change 3min, 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 1min, 35cycles, 72 ℃ are extended 5min, expand 10 pipes, collect the PCR product in 1.5ml centrifuge tube purifying, add 24: 1 chloroform isoamyl alcohols of equal-volume, jog 5 minutes, centrifugal 15 minutes of 12000rpm sucts clearly, add 2 times of volume 95% ethanol, 1/10 volume, 3 M sodium-acetates (PH5.2) were placed centrifugal 20 minutes of 12000rpm 30 minutes for-20 ℃, abandon supernatant, add 500ul 75% ethanol and place 5min, centrifugal 5 minutes of 12000rpm abandons supernatant, dry, add 75ul ddH ₂The O dissolving.The PCR product of purifying and pU1301 carrier enzyme are cut system: cumulative volume 100ul, PCR product or vector plasmid 75ul, restriction enzyme BamH1 30U, restriction enzyme Kpn1 30U, 10X K buffer 5ul, ddH ₂O 16ul, 37 ℃ of enzymes were cut 5 hours.Purifying enzyme is cut product, and method is the same, adds 10ul ddH at last ₂The O dissolving.Ligation: 10ul PCR product all is used for ligation, carrier 0.5ul, and 2U T4 ligase, 5X buffer 3ul, total 15ul volume connects 24 hours.Get 1ul and connect product, voltage 18000V, electricity forward intestinal bacteria DH10B to, add 800ul LB, recover 45 minutes, get 200ul and are applied to the LA flat board that contains kantlex, 37 ℃, spend the night.Choose mono-clonal, enlarged culturing is taken out plasmid, and enzyme is cut checking, and the enzyme blanking method is the same.The PCR checking, the system program is with identical from rice genome expansion target gene.Choose positive colony, the carrier that builds electricity is changeed Agrobacterium EHA105, take out plasmid, the PCR checking is got 750ul and is contained the Agrobacterium bacterium liquid that builds carrier and add isopyknic 50% glycerine mixing ,-70 ℃ of preservations.The carrier called after pU17310 that builds.

2. genetic transformation

Adopt the genetic transforming method (Hiei etc. of Agrobacterium EHA105 mediation, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of theT-DNA, 1994, Plant Journal 6:271-282) will spend 11 rice varieties in the overexpression vector importing normally.Agriculture bacillus mediated genetic transformation step is as follows:

1) callus of induce

(1) sophisticated rice paddy seed is shelled, used 70% Ethanol Treatment then successively 1 minute, 0.15% mercury chloride (HgCl ₂) 15 minutes;

(2) sterilization washing seed is 4-5 time;

(3) seed is placed on the inducing culture;

(4) place dark place to cultivate 5 weeks, temperature 25-27 ℃.

2) callus subculture

Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark 2 weeks, temperature 25-27 ℃ cultivated down on the subculture medium.

3) the pre-cultivation

Select the embryo callus subculture of consolidation and relatively dry, be put on the pre-culture medium and cultivated 4 days temperature 25-27 ℃ under the dark.

4) Agrobacterium is cultivated

(1) contains the Agrobacterium EHA105 two days that builds carrier, 28 ℃ of temperature having on the LA substratum of kantlex pre-the cultivation;

(2) Agrobacterium is transferred in the suspension culture base, cultivated 2-3 hour on 28 ℃ of shaking tables.

5) Agrobacterium is infected

(1) pre-incubated callus is transferred in the good bottle of sterilization;

(2) regulate the suspension of Agrobacterium to OD ₆₀₀0.8-1.0;

(3) callus was soaked in agrobacterium suspension 30 minutes;

(4) shifting callus blots to the good filter paper of sterilization; Be placed on then on the common substratum and cultivated temperature 19-20 ℃ 3 days.

6) callus washing and selection are cultivated

(1) aqua sterilisa washing callus is to cannot see Agrobacterium;

(2) be immersed in the aqua sterilisa that contains the 400ppm cephamycin 30 minutes;

(3) shifting callus blots to the good filter paper of sterilization;

(4) shift callus to selecting to select 2-3 time each 2 weeks on the substratum.(concentration of cephamycin screening for the first time is 400ppm, is 250ppm later on for the second time)

7) differentiation

(1) kanamycin-resistant callus tissue is transferred to dark cultivation 5-7 days of locating on the pre-differentiation substratum;

(2) callus that shifts pre-differentiation cultivation is to division culture medium, and illumination (2000 lx) is cultivated down, 26 ℃ of temperature, 5-7 week.

8) take root

(1) extracts the good young plant of differentiation, cut the root that differentiation phase produces;

(2) then it is transferred to following 2-3 week, 26 ℃ of the temperature of cultivating of illumination in the root media.

9) transplant

Wash the residual substratum on the root off, the seedling that will have good root system changes the greenhouse over to, divides moistening at initial several Tian Bao water holding simultaneously.

3.Osa-MIR156e gene overexpression result and application

Obtain tissue cultured seedling 100 strains of overexpression at last, in contrast by young plant 30 strains of spending the differentiation of 11 callus in normal, all plant in the land for growing field crops, the result has 50% overexpression tissue cultured seedling to occur tillering many approximately, half is short, and semisterile mutant phenotype is seen overexpression experimental result statistics.Illustrate that the Osa-MIR156e gene has the function of control rice tillering, also has the function of control paddy rice plant height and fertility simultaneously.

Overexpression experimental result statistics

Attached: agriculture bacillus mediated genetic transformation reagent and prescription

(1) reagent and solution abbreviation

6-BA (6-BenzylaminoPurine, 6-benzyladenine); KT (Kinetin, kinetin); NAA (Napthaleneacetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (Casein Enzymatic Hydrolysate, caseinhydrolysate); HN (Hygromycin B, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max (a large amount of composition solution of N6); N6min (N6 is composition solution in a small amount); MSmax (a large amount of composition solution of MS); MSmin (MS is composition solution in a small amount)

(2) solution formula of tissue culture

1) N6max mother liquor [10 times of concentrated solutions (10X)]

Saltpetre (KNO ₃) 28.3g

Potassium primary phosphate (KH ₂PO ₄) 4.0g

Ammonium sulfate ((NH ₄) ₂SO ₄) 4.63g

Sal epsom (MgSO ₄7H ₂O) 1.85g

Calcium chloride (CaCl ₂2H ₂O) 1.66g

Dissolving is settled to 1000ml then under 20-25 ℃ one by one.

2) N6min mother liquor [100 times of concentrated solutions (100X)]

Potassiumiodide (KI) 0.08g

Boric acid (H ₃BO ₃) 0.16g

Manganous sulfate (MnSO ₄4H ₂O) 0.44g

Zinc sulfate (ZnSO ₄7H ₂O) 0.15g

Under 20-25 ℃, dissolve and be settled to 1000ml.

3) Fe ₂EDTA stock solution (100X)

In a big triangular flask, add 300ml distilled water and ferric sulfate (FeSO ₄7H ₂O) 2.78g

In another big triangular flask, add 300ml distilled water and be heated to 70 ℃, add b diammonium disodium edta (Na then ₂EDTA2H ₂O) 3.73g

Mix after they all dissolve, kept 2 hours in 70 ℃ of water-baths, be settled to 1000ml, 4 ℃ of preservations are standby.

4) VITAMIN stock solution (100X)

Nicotinic acid (Nicotinic acid) 0.1g

VITMAIN B1 (Thiamine HCl) 0.1g

Vitamin B6 (Pyridoxine HCl) 0.1g

Glycine (Glycine) 0.2g

Inositol (Inositol) 10g

Add water and be settled to 1000ml, 4 ℃ of preservations are standby.

5) MSmax mother liquor (10X)

Ammonium nitrate (NH ₄NO ₃) 16.5g

Saltpetre 19.0g

Potassium primary phosphate 1.7g

Sal epsom 3.7g

Calcium chloride 4.4g

Under 20-25 ℃, dissolve and be settled to 1000ml.

6) MSmin mother liquor (100X)

Potassiumiodide 0.083g

Boric acid 0.62g

Manganous sulfate (MnSO ₄4H ₂O) 2.23g

Zinc sulfate (ZnSO ₄7H ₂O) 0.86g

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.025g

Copper sulfate (CuSO ₄5H ₂O) 0.0025g

Cobalt chloride (CoCl ₂6H ₂O) 0.0025g

Under 20-25 ℃, dissolve and be settled to 1000ml.

7) 2,4-D stock solution (1mg/ml)

2，4-D 100mg.

1ml 1N potassium hydroxide dissolving 5 minutes adds the 10ml dissolved in distilled water then and is settled to 100ml after fully, preserves down at 20-25 ℃.

8) 6-BA stock solution (1mg/ml)

6-BA 100mg.

9) NAA stock solution (1mg/ml)

NAA 100mg.

1ml 1N potassium hydroxide dissolving 5 minutes adds the 10ml dissolved in distilled water then and is settled to 100ml after fully, and 4 ℃ of preservations are standby.

10) IAA stock solution (1mg/ml)

IAA?100mg.

11) glucose stock solution (0.5g/ml)

Glucose 125g

Dissolved in distilled water is settled to 250ml, and the back 4 ℃ of preservations of sterilizing are standby.

12) AS stock solution

AS 0.392g

DMSO 10ml

Divide to be filled in the 1.5ml centrifuge tube, 4 ℃ of preservations are standby.

13) 1N potassium hydroxide stock solution

Potassium hydroxide 5.6g

Dissolved in distilled water is settled to 100ml, preserves standby down at 20-25 ℃.

14) KT stock solution (1mg/ml)

KT 100mg.

(3) culture medium prescription

1) inducing culture

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

2,4-D stock solution 2.5ml

Proline(Pro) (Proline) 0.3g

CH 0.6g

Sucrose (Sucrose) 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.9, boils (100 ℃) and is settled to 1000ml, divides to install to 50ml triangular flask (25ml/ bottle), seals sterilization.

2) subculture medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

2,4-D stock solution 2.0ml

Proline(Pro) 0.5g

CH 0.6g

Sucrose 30g

Phytagel 3g

3) pre-culture medium

N6max mother liquor (10X) 12.5ml

N6mix mother liquor (100X) 1.25ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.75ml

CH 0.15g

Sucrose 5g

Agar powder (Agarose) 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, seals sterilization.

Use preceding heating for dissolving substratum and add 5ml glucose stock solution and 250 μ l AS stock solutions, (25ml/ ware) in the culture dish poured in packing into.

4) be total to substratum

N6max mother liquor (10X) 12.5ml

N6mix mother liquor (100X) 1.25ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.75ml

CH 0.2g

Sucrose 5g

Agar powder 1.75g

5) suspension culture base

N6max mother liquor (10X) 5ml

N6mix mother liquor (100X) 0.5ml

Fe ²⁺EDTA stock solution (100X) 0.5ml

VITAMIN stock solution (100X) 1ml

2,4-D stock solution 0.2ml

CH 0.08g

Sucrose 2g

Adding distil water is regulated pH value to 5.4 to 100ml, divides to install in the triangular flask of two 100ml, seals sterilization.

Add 1ml glucose stock solution and 100 μ l AS stock solutions before using.

6) select substratum

N6max mother liquor (10X) 25ml

N6mix mother liquor (100X) 2.5ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.625ml

CH 0.15g

Sucrose 7.5g

Agar powder 1.75g

Adding distil water is regulated pH value to 6.0 to 250ml, seals sterilization.

Dissolve substratum before using, add Totomycin and the 400ppm cephamycin of 250 μ l 50mg/ml, (25ml/ ware) in the culture dish poured in packing into.

7) break up substratum in advance

N6max mother liquor (10X) 25ml

N6mix mother liquor (100X) 2.5ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

6-BA stock solution 0.5ml

KT stock solution 0.5ml

NAA stock solution 50 μ l

IAA stock solution 50 μ l

CH 0.15g

Sucrose 7.5g

Agar powder 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.9, seals sterilization.

8) division culture medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

6-BA stock solution 2ml

KT stock solution 2ml

NAA stock solution 0.2ml

IAA stock solution 0.2ml

CH 1g

Sucrose 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 6.0.

Boil (100 ℃) and be settled to 1000ml, divide to install to 100ml triangular flask (50ml/ bottle), seal sterilization.

9) root media

MSmax mother liquor (10X) 50ml

MSmix mother liquor (100X) 5ml

Fe ²⁺EDTA stock solution (100X) 5ml

VITAMIN stock solution (100X) 5ml

Sucrose 20g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.8.

Boil (100 ℃) and be settled to 1000ml, divide to install to (25ml/ pipe) in the pipe of taking root, seal sterilization.

10) LA substratum (the LB substratum does not contain agar powder)

Peptone 2.5g

Yeast powder 1.25g

Sodium-chlor 2.5g

Agar powder 3.2g

Dissolved in distilled water is settled to 250ml, is loaded on the 500ml triangular flask, and sterilization 20-25 ℃ of preservation in back is standby.

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉gene and the purposes of control rice tillering

＜130〉gene and the purposes of control rice tillering

<160>1

<170>Patentln?version?3.1

<210>1

<211>390

<212>DNA

<213>Oryza?sativa

atggcggtgt?ctccggccgg?cgggcgagcg?ggccggtggc?gcgaggtgac?agaagagagt 60

gagcacacgg?ccgggcgtga?cggcaccggc?gggcgtgccg?tcgcggccgc?gtgctcactg 120

ctctttctgt?catccggtgc?cggccgtttt?ctccccctcc?cgcggctagc?taagctggcc 180

tctcggcccc?tcgccggccg?gccggtcgcc?gacggaatcc?cctgtactgc?tccgcgcgcc 240

atgagctgtt?ccgagtctct?aggctcttta?gattaattcg?atcccctctt?ctccggcgca 300

atcgtgcata?ggcgcagttg?ccaggttcta?gatctctcac?aatcgaattg?atgcattctg 360

cgatttttcg?ttcgtgttcc?agcgccgtga 390

Claims

1 one kinds of control rice tillering gene Osa-MIR156e, its sequence is the nucleotide sequence shown in the SEQ.ID.No.1.

The described a kind of application of rice tillering gene Qsa-MIR156e in transgenic paddy rice of controlling of 2 claims 1.

The described a kind of application of rice tillering gene Osa-MIR156e in transgenic paddy rice seed of controlling of 3 claims 1.