CN102154309B - Application of chilli DN (dominant negative) mutant to bacterial wilt resistance gene engineering of tobacco - Google Patents

Abstract

The invention provides application of a chilli DN (dominant negative) mutant to the bacterial wilt gene engineering of tobacco. The chilli DN mutant is a DN-CaROP1 mutant. A gene of the mutant at least comprises a nucleotide sequence shown as SEQ ID No.1. A construction method comprises a step of fusing the chilli DN-CaROP1 mutant with a core sequence of a CaMV35S promoter to construct a DN-CaROP1 over-expression carrier. Compared with wild tobacco, by over-expression of the chilli DN-CaROP1 mutant in tobacco, the bacterial wilt resistance capability of the transgenic tobacco is obviously improved. The mutant has very important application value in the bacterial wilt gene engineering of plants.

Description

The application of a kind of capsicum DN two mutants in tobacco resistance to bacterial wilt genetically engineered

Technical field

The present invention relates to the structure of a kind of capsicum DN-CaROP1 two mutants and overexpression vector thereof and the application in genetically engineered thereof; Relate more specifically to the application of this capsicum gene in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered, belonged to the plant gene engineering technology field.

Background technology

Plant-growth, growth and environment is replied is that its specific genetic system and residing envrionment conditions interact and realize through the complex physical biological process down; Always receive comparatively tight regulation and control so that the enough photosynthates of its generation also reasonably distribute and use these photosynthates, finally make plant under particular environment, obtain the existence of maximum and the chance that biography is spread out.The signal of being made up of calcium messenger system, plant endogenous hormones, phosphokinase system, transcription factor etc. conducts the important step that is plant-growth, grows and conform and; But the various information of vegetable cell perception external environment are also carried out integration, the transmission of signal; The signal transmission gets into nucleus and regulates Expression of Related Genes the most at last, the biochemical reactions that plant is produced help its existence and biography to be spread out.

Capsicum (Capsicum annuum L.) is typical plant of Solanaceae, also is the vegetables with important economic worth.The production of capsicum receives the puzzlement of disease and other various adverse circumstances for a long time; The environment that the undue dependence of agricultural chemicals and chemical fertilizer etc. is caused, the hidden danger of healthy aspect impel people from genetic improvement or from cultivation management, to take more continuable, practicable countermeasure, need from molecular level, do more deep analysis and understanding to the degeneration-resistant molecular mechanism of plants of Solanaceae such as capsicum.Starting with from the signal transmission of replying adverse circumstance is the important channel of the degeneration-resistant molecular mechanism of analysis capsicum; Therefore; The degeneration-resistant signal of capsicum transmits Study on Molecular Mechanism and has caused people's great attention; And in film location associated receptor albumen (An et al., 2008), calcium courier GAP-associated protein GAP (Choi et al., 2009), kinases (Chung et al.; 2004), a plurality of signal transmission such as transcription factor (Lee at al.) connect and have carried out a large amount of research, but people to capsicum degeneration-resistant and and grow between relation and understanding of molecular mechanism thereof also quite limited.

Be positioned at the upper reaches of regulating growth of plants and degeneration-resistant signal pipeline in view of ROP; The important regulating effect of performance at growth and development of plants and in to the environmental stress stress response separates from the ROP of capsicum that to start with Function Identification possibly be that the important contract of the degeneration-resistant molecular mechanisms of plant of Solanaceae such as announcement capsicum is gone into a little.

Found since the ROP in the comfortable plant materials; Existing getting more and more discovers that ROP plays a crucial role in the multiple signal pathway in plant materials; Each member possibly act on different approach, and several kinds of different approach possibly be blended in same ROP (Jones et al., 2005; Yalovsky et al., 2008), in plant, also there is the functional redundancy of ROP simultaneously, seldom has obvious phenotypes to change when causing lacking a certain ROP, so when research ROP, seldom only adopt the gene function method of knocking out to study separately.One of important means of research ROP function is exactly to make up DN (dominant negative) and CA (constitutive active) two mutants; The former makes ROP be locked in the GDP combined to form inactivation type two mutants; The latter is locked in the GTP bound state with ROP to form activated form two mutants (Kost et al., 1999; Li et al., 1999; Lemichez et al., 2001; Li et al., 2001), the expression of this mutant protein has upset the balance between proteic activated state of endogenous ROP and the inactivation attitude, helps the proteic functional analysis of ROP (Yang, 2002).The bibliographical information that utilizes DN two mutants research plant resistance to bacterial wilt is not arranged at present as yet.

Summary of the invention

This discovery provides the application of a kind of capsicum DN two mutants in tobacco resistance to bacterial wilt genetically engineered, will make greater efforts to promote engineered development of tobacco resistance to bacterial wilt and application.

Capsicum DN two mutants of the present invention is the DN-CaROP1 two mutants, and this mutant gene contains just like the nucleotide sequence shown in the SEQ ID No.1 at least.

Construction process is following:

Capsicum DN-CaROP1 two mutants and CaMV35S promotor core sequence are merged, be built into the overexpression vector of DN-CaROP1.Described CaMV35S promotor core sequence does

CGACCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAC。Said capsicum DN-CaROP1 is the DN two mutants that from the cDNA library of uv b radiation capsicum blade, separates the CaROP1 gene that obtains.

The application of overexpression vector in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered that makes up.With said overexpression vector Transformed E HA105 Agrobacterium, adopt leaf dish genetic transformation method to infect tobacco and obtain transgene tobacco, can improve the resistance that infect of transgene tobacco to the pepper ralstonia solanacearum pathogenic bacteria.

Remarkable advantage of the present invention:

The overexpression of capsicum DN-CaROP1 two mutants of the present invention in tobacco compared the bacterial wilt resistance that significantly improves transgene tobacco with wild-type tobacco, this two mutants has important application in plant resistance to bacterial wilt genetically engineered.

Description of drawings

Fig. 1 is the conservative domain among the CaROP1;

Fig. 2 is CaROP1 and other ROP family member's a phylogenetic tree;

Fig. 3 is CaROP1 rite-directed mutagenesis figure;

Fig. 4 is entry vector pDONR207;

Fig. 5 is overexpression vector pK7WG2;

Fig. 6 is the comparison to the Ralstonia solanacearum resistance of DN-CaROP1 transfer-gen plant and wild-type plant.

Embodiment

1 vector construction process

1.1 material

Capsicum variety is the local capsicum variety 120 of Lianhua County, Jiangxi Province ^#, preserve by life science institute of University Of Agriculture and Forestry In Fujian laboratory; Flue-cured tobacco cultivars K326 kind is so kind as to give by University Of Agriculture and Forestry In Fujian's virus; The cDNA library of the capsicum blade that UV – B handles (UV-B UV treatment: plant placed from uv lamp (UV-B) shine 2h, 6h, 12h, 24h and 48h respectively in the 25cm place down; The plant that all different treatment time periods handle carries out putting into after quick-frozen is handled-80 ℃ of refrigerators preservations with liquid nitrogen) for life science institute of University Of Agriculture and Forestry In Fujian laboratory makes up (according to the description operation on the Invitrogen company test kit), titre is up to 1 * 10 ⁷CloneMiner ^TMCDNA Library Construction Kit and Gateway vector construction test kit are all available from American I nvitrogen company.The Type B plasmid in a small amount the rapid extraction test kit available from vast Tyke, Beijing biological gene technology Ltd, PCR be correlated with dNTP, TaqEnzyme, PCR buffer are available from Dalian TaKaRa Company products, and reverse transcription and Real-Time PCR test kit are available from Dalian TaKaRa company.Qingfengmeisu qiong, kantlex, Rifampin, carboxylic Bian penicillium mould etc. are the Sigma Company products.Other chemical reagent is homemade CP.

1.2 method

1.2.1 capsicum CaROP1 is selected the separation of gene

At first with the aminoacid sequence (NP_190698) of Arabidopis thaliana ROP as probe sequence; Capsicum est database among the GenBank is carried out homology relatively; Capsicum EST to obtaining carries out contig analysis and the conservative territory of definite ROP consensus sequence with DNAMAN; According to consensus sequence, carry out the Auele Specific Primer design with synthetic, primer sequence is P1 5'AGGCAACAACCTATTCAACAGCAG-3'; P2:GTTCCAACAAGCACTATTGGGA

C-3'。Adopt 96 well plate method of PCR-based technology from the cDNA library, to screen the cDNA positive colony then; Sequencing result shows; The length of this cDNA positive colony is 1149 bp, contains 1 length and be 197 amino acid whose opening code-reading frames (shown in the SEQ.NO.2) (DQ257288).

The Blastp Search Results shows; Contain all conservative ROP domain (Li et al. in the putative amino acid sequence of this cDNA positive colony; 2001); With the homology of the small G-protein of being identified in other plant up to (Fig. 1) more than 70%, with the temporary called after CaROP1 of this cDNA positive colony.Further between the ROP gene family member of isolation identification bigger variety is arranged in other plants such as the C end of sequential analysis discovery CaROP1 and its Arabidopis thaliana.And be though that the phylogenetic tree analysis of reference can be with CaROP1 type of being classified as IV group (Winge et al., 2000 with Arabidopis thaliana ROP family; Zheng ang Yang, 2000b; Christensen et al.; 2003); But the distance in the branch of phylogenetic tree between CaROP1 and other member on the same group is (Fig. 2) far away obviously; These differences mean that CaROP1 had both existed and other homologous gene similarity on function and molecular mechanism thereof, possibly have self particular functionality (Nibau et al., 2006) again.

1.2.2 the structure of capsicum DN-CaROP1 two mutants

Give research ROP the influence that function is brought in order to get rid of functional redundancy, the present invention has made up DN (dominant negative) two mutants of CaROP1.

When making up two mutants, at first with reference to (Li et al., 1999; Valster et al., 2000; Zheng and Yang, 2000) method etc. designs rite-directed mutagenesis primer DN-F, DN-R respectively, in conjunction with the inboard special primer of CaROP1 gene (seeing 1.2.1 primer sequence P1 and P2) carry out pcr amplification (94 ℃, 5 min; 94 ℃, 30s, 55 ℃, 30s, 68 ℃, 1min, 35cycles; 68 ℃, 7min) the PCR product (the PCR product here is DN two mutants DN-CaROP1) of generation T20N site mutation, the T20N site mutation makes ROP be in the GDP combined all the time and promptly obtains DN two mutants DN-CaROP1.The rite-directed mutagenesis primer sequence is following:

DN-F 5’-CAATAAACAA TTCTTGCCAAC-3’

DN-R 5’-gttggcaaga Attgtttattg-3’

Rite-directed mutagenesis amplification scheme such as Fig. 3.

1.2.3 capsicum DN-CaROP1 gene overexpression vector makes up

The present invention adopts gateway technology (Walhout et al., 2000), makes up the dicotyledons transgenic and uses overexpression vector.

At first according to gateway vector construction technical project and synthetic inboard special primer ROPF 5 '-AAAA AGCAGGCTTTATGAGTGCTTCCAGGTT-3 '; ROPR 5 '-AGAAAGCTGGGTATCACAATATCGA GCAGGC-3 ' (first round) and lateral joint primer AttB1 5 '-G GGG ACA AGT TTG TAC AAA AAA GCA GGC T-3 '; AttB2 5 '-GGG GAC CAC TTT GTA CAA GAA AGC TGG GT-3 ' (second takes turns).Then according to interpolation AttThe two-wheeled pcr amplification program of B joint is added the attB joint in DN-CaROP1 gene both sides, and two-wheeled pcr amplification procedure is following:

The first round adds in order fully to obtain AttThe PCR product of B joint, inboard special primer can only add 10 pmoles at most for every kind in 50 μ l PCR reaction systems, and the amplification parameter is:

Preparatory 95 ° of C 1 cycle of sex change 2min

94 ° of C of sex change 15 s

55 ° of C of annealing 30s

Extend 68 ° of C 10 cycles of 1 min

Second takes turns transfer first round PCR product 10 μ l to containing 40pmoles AttB1 with AttIn the 40 μ lPCR mixed solutions of B2 lateral joint primer, use the first low temperature special annealed of the high temperature two cover amplification parameters of annealing again to be continuously:

Preparatory 95 ° of C 1 cycle of sex change 1min

94 ° of C of sex change 15 s

45 ° of C of 30 s anneal

Extend 68 ° of C 5 cycles of 1 min

94 ° of C of sex change 15 s

55 ° of C of 30 s anneal

Extend 68 ° of C 15-20 of 1 min cycles

Agarose gel electrophoresis test strip quality and glue reclaim purifying AttThe B-PCR product.

Through the BP reaction system goal gene is cloned into then and forms the clone that crosses the threshold on the entry vector pDONR207 (see figure 4); PDONR207-ROP; After order-checking testing goal gene order is errorless, through the LR reaction system goal gene clone is transferred to overexpression vector pk7WG2 (like Fig. 5) again, so also just goal gene is cloned in the CaMV35S of Ti-plasmids promotor downstream; Formation contains the overexpression vector of goal gene; Its overexpression in transfer-gen plant can be realized, the further Transformed E HA105 Agrobacterium of overexpression vector of goal gene will be contained at last with reference to the molecular cloning guide, to be ready for use on the tobacco genetic transformation.The BP reaction system:

PCR products 100 ng

Vector (pDONR207) 30-50 ng

5×Buffer 1 μl

BP enzyme mix 0.3 μl

Add water to total 5μl

25 ℃ of temperature are bathed and are spent the night, and reaction finishes the back and adds Proteinase K, and 37 ℃ of digestion 10min transform DH5 α competent cell with reaction product.

The LR reaction system:

Entry clone 50-100 ng

Destination vector 100 ng

LR Enzyme mix 0. 5 μl

Add water to total 5 μl

25 ℃ of temperature are bathed and are spent the night, and reaction finishes the back and adds Proteinase K, and 37 ℃ of digestion 10min transform DH5 α competent cell with reaction product.

The acquisition of tobacco transfer-gen plant and resistance analysis

2.1 tobacco genetic transformation and T1 are for the results of transgenic seed

Adopt leaf dish genetic transformation method (Xu Gangbiao etc., 2007; Plant genetic engineering (second edition)), utilizes the Agrobacterium of the overexpression vector that contains goal gene constructed among the 1.2.3, infect the leaf dish (0.5cm * 0.5cm) of 2 months aseptic wild-type tobacco K326 seedling.Screening resistance seedling on the MS substratum that contains kantlex (100 mg/L), and the genomic dna of antagonism seedling carries out PCR and detects, to confirm the safety of kantlex screening.Obtain a series of transgenic line, wherein obtain DN 36 strains.All DN strain systems all gather in the crops T1 for transgenic seed with the bagging selfing.Utilize T1 to carry out transgene tobacco phenotype analytical and Function Identification for transgenic seed.

2.2 CaROP1 participates in regulation and control phytopathogen defensive raction process

The present invention uses the bacterial wilt pathogenic bacteria and (takes from the local pepper ralstonia solanacearum bacterium in Fuqing; Be stored in life science institute of University Of Agriculture and Forestry In Fujian laboratory at present) the DN-CaROP1 wild-type is contrasted carry out the inoculation of pepper ralstonia solanacearum pathogenic bacteria live body; Find behind the 5-7d that DN-CaROP1 transgene tobacco two mutants reveals the obvious resistance to pathogen infection with respect to the wild-type synopsis; Produce stronger anaphylaxis necrotic plaque (Fig. 6) at contrast tobacco inoculation position, explain that DN-CaROP1 can significantly improve the resistance that infect of transgene tobacco to the pepper ralstonia solanacearum pathogenic bacteria.

The result

The present invention finds that DN-CaROP1 can significantly improve the resistance that infect of transgene tobacco to the pepper ralstonia solanacearum pathogenic bacteria, and this gene has important application in plant resistance to bacterial wilt genetically engineered.

< 110>University Of Agriculture and Forestry In Fujian

< 120>application of a kind of capsicum DN two mutants in tobacco resistance to bacterial wilt genetically engineered

<160> 2

<210> 1

<211> 1149

<212> DNA

< 213>artificial sequence

<400> 1

ttacggccgg ggaatacaaa acacttctct tcttcatccc tttgtctcac acacaaacat 60

acatagtttt tttttttcag gcaacaacct attcaacagc agtattttca ggcaacaaaa 120

aagatggggt attgaaagga agcattacat tgtttgtttt attgagcagg tcttctaaag 180

aagatctgat aagaagtggg tcattgttag tttaccgttt tatcccccta caacagcaag 240

aagaagagga gaattatgag tgcttccagg tttattaagt gtgttacagt gggtgatggt 300

gctgttggca agaattgttt attgatttct tacacaagca atactttccc tacggactat 360

gtgcccaccg tgttcgacaa tttcagcgca aatgtggttg tcaatggagc cactgtcaac 420

ctagggttgt gggatactgc tggacaggag gactacaata ggttaagacc cctgagttac 480

cgtggggccg atgttttcat tttggcattc tctctcatta gtaaagccag ctatgagaat 540

gtctccaaga agtggattcc tgagttgaag cactatgctc ctggtgtccc aatagttctt 600

gttggaacaa aacttgatct tcgggatgac aagcaattct tcgtagacca tcctggtgct 660

gtgccaattg ctactgctca gggcgaggag ctaaggaaaa caatcggtgc accatcttac 720

gttgaatgta gttcaaaaac acagcagaat gtgaaagcag tctttgatgc tgccattaag 780

ggtcgtcctc cagcctccca agacgaagaa aagaagggga aatctcaaaa ggcctgctcg 840

atattgtgat caactgtagt aggaccaacc aacgatatgg ctcgtcacaa ttcccgttgt 900

aacatccccc cgtaatatcc tttgtcttct ttcgtcctcg gaggaagtag aggtcttcgt 960

cttgttcttt tcgactacta cgatcctcct cgaaagtgtc aggtggctga tttatgtata 1020

attgtgtcat ccacttgtaa gccactctaa gttgccattt gtttgatcgt ttatgtatta 1080

acactggatg atccagtaga agcgtcttcc gcagagatga caaaactgtg gggcctcttg 1140

gtaagttat 1149

<210> 2

<211> 1149

<212> DNA

<213>Capsicum ( Capsicum annuum L.)

<400> 2

ttacggccgg ggaatacaaa acacttctct tcttcatccc tttgtctcac acacaaacat 60

acatagtttt tttttttcag gcaacaacct attcaacagc agtattttca ggcaacaaaa 120

aagatggggt attgaaagga agcattacat tgtttgtttt attgagcagg tcttctaaag 180

aagatctgat aagaagtggg tcattgttag tttaccgttt tatcccccta caacagcaag 240

aagaagagga gaatt atg agt gct tcc agg ttt att aag tgt gtt aca gtg 291

Met Ser Ala Ser Arg Phe Ile Lys Cys Val Thr Val

1 5 10

ggt gat ggt gct gtt ggc aag act tgt tta ttg att tct tac aca agc 339

Gly Asp Gly Ala Val Gly Lys Thr Cys Leu Leu Ile Ser Tyr Thr Ser

15 20 25

aat act ttc cct acg gac tat gtg ccc acc gtg ttc gac aat ttc agc 387

Asn Thr Phe Pro Thr Asp Tyr Val Pro Thr Val Phe Asp Asn Phe Ser

30 35 40

gca aat gtg gtt gtc aat gga gcc act gtc aac cta ggg ttg tgg gat 435

Ala Asn Val Val Val Asn Gly Ala Thr Val Asn Leu Gly Leu Trp Asp

45 50 55 60

act gct gga cag gag gac tac aat agg tta aga ccc ctg agt tac cgt 483

Thr Ala Gly Gln Glu Asp Tyr Asn Arg Leu Arg Pro Leu Ser Tyr Arg

65 70 75

ggg gcc gat gtt ttc att ttg gca ttc tct ctc att agt aaa gcc agc 531

Gly Ala Asp Val Phe Ile Leu Ala Phe Ser Leu Ile Ser Lys Ala Ser

80 85 90

tat gag aat gtc tcc aag aag tgg att cct gag ttg aag cac tat gct 579

Tyr Glu Asn Val Ser Lys Lys Trp Ile Pro Glu Leu Lys His Tyr Ala

95 100 105

cct ggt gtc cca ata gtt ctt gtt gga aca aaa ctt gat ctt cgg gat 627

Pro Gly Val Pro Ile Val Leu Val Gly Thr Lys Leu Asp Leu Arg Asp

110 115 120

gac aag caa ttc ttc gta gac cat cct ggt gct gtg cca att gct act 675

Asp Lys Gln Phe Phe Val Asp His Pro Gly Ala Val Pro Ile Ala Thr

125 130 135 140

gct cag ggc gag gag cta agg aaa aca atc ggt gca cca tct tac gtt 723

Ala Gln Gly Glu Glu Leu Arg Lys Thr Ile Gly Ala Pro Ser Tyr Val

145 150 155

gaa tgt agt tca aaa aca cag cag aat gtg aaa gca gtc ttt gat gct 771

Glu Cys Ser Ser Lys Thr Gln Gln Asn Val Lys Ala Val Phe Asp Ala

160 165 170

gcc att aag ggt cgt cct cca gcc tcc caa gac gaa gaa aag aag ggg 819

Ala Ile Lys Gly Arg Pro Pro Ala Ser Gln Asp Glu Glu Lys Lys Gly

175 180 185

aaa tct caa aag gcc tgc tcg ata ttg tga tcaactgtag taggaccaac 869

Lys Ser Gln Lys Ala Cys Ser Ile Leu

190 195

caacgatatg gctcgtcaca attcccgttg taacatcccc ccgtaatatc ctttgtcttc 929

tttcgtcctc ggaggaagta gaggtcttcg tcttgttctt ttcgactact acgatcctcc 989

tcgaaagtgt caggtggctg atttatgtat aattgtgtca tccacttgta agccactcta 1049

agttgccatt tgtttgatcg tttatgtatt aacactggat gatccagtag aagcgtcttc 1109

cgcagagatg acaaaactgt ggggcctctt ggtaagttat 1149

Claims (1)

1. the application of capsicum DN two mutants in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered, it is characterized in that: said capsicum DN two mutants is the DN-CaROP1 two mutants, and the nucleotide sequence of this mutant gene is shown in SEQ ID No.1.

Images