CN102149817A - Production of infectious hepatitis c virus particles in cell culture - Google Patents

Abstract

The present invention provides for novel methods of producing high levels of infectious HCV genotype 1 virus particles in cell culture systems. The availability of HCV genotype 1 virus (principally associated with liver disease in most regions of the world) that can undergo the complete viral cycle in cultured cells is beneficial for the discovery and development of novel therapies for the treatment of HCV.

Description

In cell culture, produce infectious hepatitis C virus particle

The present invention relates in cell cultures to produce the novel method of infectious HCV genotype 1 C-type virus C, and in screening, detect and estimate the purposes aspect the multiple HCV inhibitor.

Hepatitis C virus (HCV) is the first cause (Boyer, J.Hepatol.2000 32:98-112 such as N.) of whole world major health and chronic hepatopathy.Subject suffering from HCV infection has the liver cirrhosis of generation liver and the danger of hepatocellular carcinoma subsequently, so HCV is the principal indication of liver transplantation.

According to the World Health Organization (World Health Organization), there is the individuality that infects 200,000,000 in the whole world more, has at least every year 300 ten thousand to 400 ten thousand people to be infected.In case infected, about 20% people can remove virus, but the others may carry HCV throughout one's life.10% to 20% chronic infection individuality finally develops into liver cirrhosis or the cancer of destroying liver.Virus disease is propagated by the blood that polluted or blood products, the pillow stomach other places of having polluted or trafficability characteristic is propagated and vertically propagate offspring to them from mother of having infected or with malicious mother.The treatment of infecting for HCV at present is confined to the only immunotherapy of recombinantinterferon or associating nucleoside analogues 'Libaweilin ', and it has limited clinical benefit, particularly for genotype 1 type.There is exigence in therapeutical agent to improvement that can effectively anti-chronic HCV infection.

HCV has been categorized as the member of Viraceae flaviviridae (Flaviviridae), hepatovirus (the hepaciviruses) (Rice that it comprises Flavivirus (flaviviruses), pestivirus (pestiviruses) and comprises hepatitis C virus, C.M., Flaviviridae:The viruses and theirreplication, in:Fields Virology, Fields, B.N., Knipe, D.M. and Howley, P.M. edit Lippincott-Raven press, Philadelphia, Pa., the 30th chapter, 931-959,1996).HCV is the genomic envelope virus of sense single stranded rna that contains about 9.4kb.Viral genome is made up of the long open reading-frame (ORF) and the short 3 ' UTR of 5 ' non-translational region (UTR), about 3011 the amino acid whose polyprotein precursors of coding.5 ' UTR is the conservative part of HCV genome topnotch, and is important to the initial sum control of polyprotein translation.

6 kinds of main genotype have been identified in the genetic analysis of HCV, demonstrate＞30% dna sequence dna difference.Each genotype contains a series of more closely related hypotypes, and they demonstrate the nucleotide sequence difference (Simmonds, P.2004 J.Gen.Virol.85:3173-88) of 20-25%.Distinguished more than 30 kind of hypotype.In the U.S., about 70% infected individuals has the 1a type and the 1b type infects.The 1b type is most popular hypotype in the Asia.(X.Forn and J.Bukh, Clinics in LiverDisease 1999 3:693-716; J.Bukh etc., Semin.Liv.Dis.1995 15:41-63).Unfortunately, 1 type infects present therapy than 2 types or 3 type genotype more insensitive (N.N.Zein, Clin.Microbiol.Rev., 2000 13:223-235).

The heredity tissue and the polyprotein processing of the nonstructural proteins part of the ORF of pestivirus and hepatovirus are closely similar.These positive chain RNA virus have the single big open reading-frame (ORF) (ORF) of coding to necessary all virus proteins of virus replication.These protein expressions are polyprotein, and post-treatment is translated and translated to its proteolytic enzyme by cell and encoding viral altogether to produce ripe virus protein.The virus protein that responsible virus genome RNA duplicates is towards C-terminal.2/3rds ORF is called non-structure (NS) protein.For pestivirus and hepatovirus for the two, sophisticated non-structure (NS) protein with the sequential order from the N-terminal of nonstructural proteins coding region to the C-terminal of ORF, is made up of p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B.

The NS protein of pestivirus and hepatovirus is total to be the sequence domains of feature with the particular proteins function.For example, to have with serine protease and helicase be aminoacid sequence motif (Gorbalenya etc., Nature 1988 333:22 of feature to the NS3 protein of the virus in two groups; Bazan and Fletterick Virology 1989 171:637-639; Gorbalenya etc., Nucleic Acid Res.1989 17:3889-3897).Similarly, to have the RNA polymerase that instructs with RNA be the motif (Koonin, E.V. and Dolja, V.V.Crit.Rev.Biochem.Molec.Biol.1993 28:375-430) of feature to the NS5B protein of pestivirus and hepatovirus.

Proteinic practical function of the NS of pestivirus and hepatovirus and function are directly similarly in the life history of virus.In two kinds of situations, the NS3 serine protease is responsible among the ORF all proteolysiss processing (Wiskerchen and the Collett Virology 1991184:341-350 at the polyprotein precursor in its downstream, position; J.Virol.1993 67:3835-3844 such as Bartenschlager; Biochem.Biophys.Res.Comm.1993 192:399-406 such as Eckart; J.Virol.199367:2832-2843 such as Grakoui; Proc.Natl.Acad.Sci.USA such as Grakoui 1993 90:10583-10587; J.Virol.1993 67:4665-4675 such as Ilijikata; J.Virol.1993 67:4017-4026 such as Tome).In two kinds of viruses, NS4A protein is as cofactor (the J.Virol.1994 68:5045-5055 such as Bartenschlage of NS3 serine protease; J.Virol.199468:3753-3760 such as Failla; J Virol.1997 71:5312-5322 such as Xu).The NS3 protein of two kinds of viruses also plays helicase (Biochem.Biophys.Res.Comm.1995 215:160-166 such as Kim; Jin and Peterson Arch.Biochem.Bilphys.1995,323:47-53; Warrener and Collett J.Virol.1995 69:1720-1726).At last, the NS5B protein of pestivirus and hepatovirus has the rna polymerase activity that the RNA of prediction relies on ((EMBO 1996 15:12-22 such as Behrens; J.Virol.1997 71:8416-8428 such as Lechmann; Biochem.Biophys.Res.Comm.1997 232:231-235 such as Yuan; Hagedorn, PCT WO97/12033; J.Virol.1998 72:9365-9369 such as Zhong).

At present, the therapy that has limited quantity through the existing available treatment HCV of approval infection.Look back treatment HCV and suppressed new and existing methods of treatment: R.G.Gish, Sem.Liver.Dis., 1999 19:5 of HCV NS5B polysaccharase; Di Besceglie, A.M. and Bacon, B.R., Scientific American, October: 199980-85; G.Lake-Bakaar, Currentand Future Therapy for Chronic hepatitis C virus Liver Disease, Curr.Drug Targ.Infect Dis.2003 3 (3): 247-253; P.Hoffmann etc., Recent patentson experimental therapy for hepatitis C virus infection (1999-2002), Exp.Opin.Ther.Patents 2,003 13 (11): 1707-1723; F.F.Poordad etc., Developments in Hepatitis C therapy during 2000-2002, Exp.Opin.Emerging Drugs 2,003 8 (1): 9-25; M.P.Walke etc., Promising Candidates forthe treatment of chronic hepatitis C, Exp.Opin.Investig.Drugs 2,003 12 (8): 1269-1280; S.-L.Tan etc., Hepatitis C Therapeutics:Current Status andEmerging Strategies, Nature Rev.Drug Discov.2002 1:867-881; R.DeFrancesc etc., Approaching a new era for hepatitis C virus therapy:inhibitors of the NS3-4A serine protease and the NS5B RNA-dependentRNA polymerase, Antiviral Res.2003 58:1-16; Q.M.Wang etc., hepatitisC virus encoded proteins:targets for antiviral therapy, Drugs of the Future2000 25 (9): 933-8-944; J.A.Wu and Z.Hong, Targeting NS5B-DependentRNA Polymerase for Anti-HCV Chemotherapy Cur.Drug Targ.-Inf.Dis.2003 3:207-219.

Although in the function of the genomic organization of understanding virus and virus protein, obtained progress, duplicate with the basic sides of pathogenesis still also unknown at HCV.The main difficulty of the experimental approach that acquisition HCV duplicates is to lack the effective cell culture systems that allows to produce infectious viral particle.Although reported the infection of primary cell culture and some human cell system, the level that the amount of the virus that produces in those systems and HCV duplicate is too low so that can not carry out detail analysis.This is especially true for genotype 1a type HCV virion, although nearest report describe in detail use the HCV RNA contain 5 kinds of cell cultures-adaptive mutation combination to produce low-level infectious gene type 1a C-type virus C (Yi etc., Proc.Natl.Acad.Sci.USA 2,006 103 (7): 2310-2315).

Two study group have reported that the height that uses Huh-7 human liver cancer cell allows subbreed (highpermissive sublines) to produce genotype 1a type dubbing system.Blight etc. (J.Virol.2003 77:3181-3190) can allow to select among the Huh-7 subbreed Huh-7.5 G418 resistance bacterium colony at height, it supports duplicating of genotype 1a type deutero-sub-genome duplication, described Huh-7.5 produces by the G418 resistance replicon clone of having set up of removing subgene group Con1 replicon rna, described subgene group Con1 replicon rna is selected Huh-7.5 (Blight etc., J.Virol.2002 76:13001-13014) by handling with interferon alpha.The sequential analysis of replicability HCV RNA in this type of clone through selecting shows that modal crucial sudden change is positioned amino acid position 470 places (P1496L) of the NS3 in the domain II of NS3 helicase, and NS5A sudden change (S2204I).In another case, (J.Biol.Chem.2003 278:16741-16746) using system mutation method such as Grobler has been obtained similar conclusion: P1496L and S2204I combination all to independent but similarly the height selected of mode allows to obtain in the Huh-7 subbreed that genotype 1a type duplicates is essential.Yet the genotype 1a type RNA with these two kinds enhancing sudden changes does not experience in Huh-7 clone and duplicates, and shows the limitation of this system's purposes.

The present invention is based on end user's serum in cell culture system, to improve the wonderful effect that infectious HCV genotype 1 C-type virus C particle produces.The operability that can experience HCV genotype 1 C-type virus C of complete virus period in cultured cells is favourable to finding and researching and developing the new therapy that is used for the treatment of HCV.

Therefore, the invention provides and be used for increasing the method that HCV genotype 1 C-type virus C particle produces in cultured cells, comprise with the replication competent type HCV genotype 1 type polynucleotide transfection cultured cells that comprises adaptive mutation Q1067R, V1655I, K1691R, K2040R, S2204I, the incubation culturing cell of transfection in having the human serum of 2-10%, and collect substratum the transfection culturing cell from containing infectious HCV genotype 1 C-type virus C particulate.The present invention further provides the method for screening HCV genotype 1 type inhibitor, comprised with the replication competent type HCV genotype 1 type polynucleotide transfection cultured cells that comprises adaptive mutation Q1067R, V1655I, K1691R, K2040R, S2204I; The incubation culturing cell of transfection in having the human serum of 2-10%; Collect substratum the transfection culturing cell from containing infectious HCV genotype 1 C-type virus C particulate; Under the situation that has or do not exist the molecule that is used for HCV inhibition screening active ingredients, infect natural cultured cells with infectious HCV genotype 1 C-type virus C particle; And measure the HCV level in the culturing cell that has infected, exist, wherein the HCV level is compared reduction and is shown that molecule is HCV genotype 1 a type inhibitor under existing under the situation of described molecule than the situation that does not have described molecule.

Consider the appended embodiment of detailed description of the present invention and illustrated example embodiment, will be more readily understood the present invention aforesaid and other advantage and characteristics and the mode that realizes them.

Fig. 1. human serum does not strengthen HCV and duplicates.With the coding HCV strain H77S of in-vitro transcription or the RNA transfection Rof-400c cell of replication defective mutant (GND).RNA also is used to measure the amount of HCV RNA then in the fixed time purifying born of the same parents after transfection.

Fig. 2. human serum does not strengthen the generation of infectious HCV.With the coding HCV strain H77S of in-vitro transcription or the RNA transfection Rof-400c cell of replication defective mutant (GND).Fixed time after transfection collects substratum and is used to infect juvenile cell.After 3 days, RNA also is used to measure the amount of HCV RNA then in the purifying born of the same parents.

Fig. 3. by the HCV core protein of immunofluorescence analysis detection in the cell that infects.The substratum of RNA cells transfected of collecting the in-vitro transcription of personal coding HCV strain H77S is used to infect juvenile cell.After 4 days, by the expression of immunofluorescence analysis HCV core protein.

Fig. 4. by the HCV core protein in the cell of immunoperoxidase analyzing and testing infection.The substratum of RNA cells transfected of collecting the in-vitro transcription of personal coding HCV strain H77S is used to infect juvenile cell.After 4 days, in the expression of immunoperoxidase staining post analysis HCV core protein.

The kinetics that the infectious virus of Fig. 5 .H77S and H77S RO-51-5B is produced.RNA transfection Rof-0c cell with the in-vitro transcription of coding HCV strain H77S or chimeric strain H77S RO-51-5B.At specified time point, to collect substratum and also be used to infect juvenile cell measuring the infectious virus titre, it is measured as the terminal point extent of dilution (tissue culture infective dose TCID50) that causes 50% hole to contain infectious cell.

The effectiveness of Fig. 6 .NS5B inhibitor and the anti-GT 1a of HCV entry inhibitor infectious virus.Infect the Rof-0c cell with H77S or chimeric H77S RO-51-5B.When infecting, handle cell with the serial dilution of NS5B inhibitor HCV-796 or HCV entry inhibitor JS81.After 3 days, RNA and be used to measure the amount of HCV RNA in the purifying born of the same parents.

As in this article used, term " replication competent type polynucleotides " refers to the polynucleotides that copy when existing in cell. For example, synthetic complementary polynucleotide. As in this article used, term " replication in vitro " refers to copy in the cell of polynucleotides in being grown in culture. The cell of cultivating can be the cell of growing in culture of having selected, comprises, for example, immortalized cell or transformant. Alternatively, the cell of cultivation can be the cell of having transplanted from animal. " copy in the body " and refer to that polynucleotides for example copy in the cell in primate (comprising chimpanzee) or the human body animal. In aspect more of the present invention, in cell, copy and can comprise generation " infectivity " virion, namely can infection cell and the virion that causes more infectious viral particle to produce.

The replication competent type polynucleotides comprise at least a adaptive mutation. As in this article used, " adaptive mutation " is the change of the amino acid sequence of polyprotein, compares with the replication competent type polynucleotides that do not have adaptive mutation, and it has increased the ability that the replication competent type polynucleotides copy.

A kind of adaptive mutation of the replication competent type polynucleotides of indication is included in the arginine at about amino acid position 1067 places in the present invention, and it is about 41 amino acids of NS3. Most of clinical HCV separators and molecular cloning laboratory HCV strain comprise glutamine in this position, therefore this sudden change are called Q1067R. The second adaptive mutation is that it is about 629 amino acids of NS3 at the isoleucine at about amino acid position 1655 places. Most of clinical HCV separators and molecular cloning laboratory HCV strain are valine in this position, therefore this sudden change are called V1655I. The third adaptive mutation is that it is about 34 amino acids of NS4A at the arginine at about amino acid position 1691 places. Most of clinical HCV separators and molecular cloning laboratory HCV strain are lysine in this position, therefore this sudden change are called K1691R. The 4th kind of adaptive mutation is that it is about 68 amino acids of NS5A at the arginine at about amino acid position 2040 places. Most of clinical HCV separators and molecular cloning laboratory HCV strain are lysine in this position, therefore this sudden change are called K2040R. The 5th kind of adaptive mutation of the replication competent type polynucleotides that are called in the present invention is that it is about 232 amino acids of NS5A at the isoleucine at about amino acid position 2204 places. Most of clinical HCV separators and molecular cloning laboratory HCV strain comprise serine in this position, and this sudden change is called S2204I in this area.

As used in this article, term " polynucleotide " refers to the polymerized form of the Nucleotide of random length, perhaps ribonucleotide or deoxyribonucleotide, and comprise double-stranded and single stranded DNA and RNA.Polynucleotide can comprise the nucleotide sequence with difference in functionality, comprise for example encoding sequence and non-coding sequence, for example regulate sequence and/or non-translational region.Polynucleotide can perhaps can prepare by the technology of reorganization, zymetology or chemistry available from natural origin.Polynucleotide can be linear or cyclic on the topology, and can for example be that carrier is for example expressed or a part or the fragment of cloning vector.

Term " coding region " and " encoding sequence " can use and refer to the polynucleotide region of coded polypeptide interchangeably, and it is when control expression of the following time encoded polypeptides that places proper regulation sequence.The border of coding region is generally by determining at the translation initiation codon of its 5 ' end with at its 3 ' terminal translation stop codon.Coding region one or more polypeptide of can encoding.For example, the coding region can coded polypeptide, is processed to two kinds or more of polypeptide subsequently.Regulate sequence or regulatory region and be the nucleotide sequence of regulating with the expression of its coding region that effectively is connected.The non-limitative example of regulating sequence comprises promotor, transcription initiation site, translation initiation site, internal ribosome entry site, translation termination site and terminator." effectively connect " and refer to that side by side wherein said component is in and allows them to bring into play in the function relationship in the mode of its expectation.Regulate sequence when in this way in conjunction with the time " effectively be connected " with the coding region, described mode makes being expressed in of coding region and regulate under the compatible condition of sequence and realize.

" polypeptide " refers to amino acid whose polymer as used herein, and is not the amino acid polymer that refers to length-specific.Therefore, for example, term peptide, oligopeptides, protein, polyprotein, proteolytic enzyme and enzyme all are included in the definition of polypeptide.This term is modified after also comprising polypeptide expression, for example, and glycosylation, acetylize, phosphorylation etc." hepatitis C virus polyprotein " refers to that post-translational cleavage is to produce the polypeptide more than a peptide species.

Term " 5 ' untranslatable rna ", " 5 ' non-translational region ", " 5 ' untranslated region " and " 5 ' non-coding region " can use and be the term (referring to Bukh etc., Proc.Nat.Acad.Sci.USA 1992 89:4942-4946) of this area interchangeably.This term refers at 5 ' of the replication competent type polynucleotide terminal Nucleotide.

Term " 3 ' untranslatable rna ", " 3 ' non-translational region " and " 3 ' untranslated region " can use and be the term of this area interchangeably.This term refers at 3 ' of the replication competent type polynucleotide terminal Nucleotide.

When importing to DNA external source or allogenic or RNA in the cell, cell is just by this type of DNA or RNA " conversion " or " transfection ".Conversion or transfection DNA or RNA can or can unconformability (covalently bound) in chromosomal DNA, form the genome of cell.For example, in prokaryotic organism, yeast and mammalian cell, transfering DNA can be retained in free type element for example on the plasmid.As for eukaryotic cell, be incorporated in the karyomit(e) and can have duplicated the cell that entails daughter cell by dyed body to such an extent as to the cell of stable conversion is a transfering DNA.This stability can be set up the clone or the clone that comprise the daughter cell group of containing transfering DNA by eukaryotic cell and illustrate.

As used in this article, term " experimenter " refers to the member of vertebrates, particularly mammalian species and includes but not limited to rodent, rabbit, suslik and primates that the latter comprises the mankind.

Term " sample " refers to separate tissue or the fluid sample from the experimenter, include but not limited to, for example appearance section, respiratory tract, enteron aisle and urogenital tract, tear, saliva, milk, hemocyte, tumour, the organ of blood plasma, serum, spinal fluid, lymph liquid, skin, and refer to that also cell in vitro cultivates the sample of component (including but not limited to the conditioned medium and the cellular component of self-growing culturing cell, the virus infected cell of inferring, reconstitution cell).

Term " HCV genotype 1 type inhibitor " refer to suppress HCV genotype 1 type arbitrary function and can be from beginning to adhere to and enter into the molecule that arbitrary stage of the viral life cycle of release works, and include but not limited to adhere to inhibitor, entry inhibitor, fusion inhibitor, transport inhibitors, replication inhibitors, translational inhibitor, protein processing inhibitor or release inhibitor.Molecule can also can include but not limited to organic molecule, peptide, polypeptide (for example, antibody), polynucleotide (for example, antisense oligonucleotide, siRNA, microRNA) or their combination by wide material sources.

Embodiment

Providing following prepared product and embodiment can make those skilled in the art more be expressly understood and implement the present invention.They should be considered as limiting the scope of the invention, but it is as just explanation of the present invention and representative.

Material and method

Cell cultures

Rof-0 is the human hepatocytes cancerous cell line derived from Huh-7 clone.The Rof-0 cytotostatic keeps HCV genotype (GT) 1b type replicon.By the IFN-of 400 units/ml α 2a (

Hoffmann-LaRoche company) and G418 ((

Invitrogen) keep the Rof-0 cell under the situation of Cun Zaiing and produce the reactive clone that interferon alpha is had minimizing with the selection of keeping replicon.The clone that obtains is called Rof-400.Remove the HCV replicon by culturing cell under the situation about existing from Rof-0 and Rof-400 cell, and obtain clone Rof-0c and Rof-400c at 2 '-C-methyladenosine.Clone is incubated in the Eagle substratum (DMEM) of the Dulbecco improvement that has replenished GlutamaxTM and 100mg/ml Sodium.alpha.-ketopropionate (Invitrogen).Substratum is further used 10% (v/v) foetal calf serum, and (FBS Invitrogen) replenishes with 1% (v/v) penicillin/streptomycin.

Plasmid

It is as follows that coding has the structure of plasmid of total length GT 1a strain H77 of 5 kinds of cell cultures adaptive mutations.With the AsiSI of the TQ-1 plasmid of coding GT 1a H77 sub-genome duplication and also encode H77 sub-genome duplication and the NS5B encoding sequence flank of encoding and TX-2 plasmid the restriction enzyme AgeI and the NsiI digestion of RsrII restriction site.Purifying derives from 6400 base pair fragments of digestion.5100 base pair fragments that obtain with AgeI and NsiI digested plasmid HCV 1a H77 and purifying.Be connected respectively with HCV 1a H77 digestion product with the purifying fragment of TX-2 digestion from TQ-1, obtain plasmid pUC HCV1a H77, it contains 3 kinds of adaptive mutations (K1691R, K2040R and S2204I) and pUC HCV 1a-H77.AsiSIRsrII, and it contains AsiSI and RsrII restriction enzyme site that 3 kinds of identical adaptive mutations add the box that is used for the NS5B sequence.Use the site-directed mutagenesis kit of Quick Change (Stratagene) that two kinds of extra adaptive mutations (Q1067R and V16551) are incorporated in two carriers according to manufacturers instruction.This has obtained plasmid pUCH77S (SEQ ID NO:1) and pUC H77S.AsiSIRsrII (SEQ ID NO:2).Produce the replication defect type construct by using the site-directed mutagenesis kit of Quick Change to introduce sudden change at NS5B avtive spot (D2738N), produce construct pUC H77S GND according to manufacturers instruction (Stratagene).

Coding produces by the PCR product with AsiSI and RsrII digestion pUC H77S.AsiSIRsrII and clinical isolates RO-51NS5B sequence from the chimeric H77S virus of the NS5B sequence of clinical isolates.Fragment is linked together, obtained plasmid pUC H77S RO-51-5B (SEQ IDNO:3).

Virus produces

The genomic plasmid of coding total length HCV is also handled with mung-bean nuclease then with restriction enzyme SpeI linearizing.Use T7 Ribomax Express test kit (Promega) in external rna transcription reaction, to use linearizing template according to manufacturers instruction.For the RNA transfection, with the RNA electroporation of 400 ten thousand Rof-0c or Rof-400c cell usefulness 2-10 μ g in-vitro transcription.Behind the electroporation, cell is resuspended to the human serum that contains 5% (v/v) FBS or 2%-10% (v/v), and (HS is among DMEM Bioreclamation).Collect substratum at specified time point, at 3000RPM rotation and five equilibrium to be used to measure the generation of infectious virus.

Infectious virus is measured

To collect substratum from the Rof-0c of transfection or Rof-400c cell by measuring infectious virus with inmature Rof-0c or Rof-400c incubation.Behind incubation juvenile cell 72-96 hour, extract cell RNA with quantitative HCV RNA or with cell fixation to analyze the HCV protein expression.

After using PerfectPure RNA 96 Cell test kits (5 Prime), check the existence of HCV RNA according to manufacturers instruction purifying whole-cell rna.For the amount of quantitative HCV RNA, use Taqman Universal PCR mixture (Applied Biosystems) or TaqMan EZRT-PCR test kit (Applied Biosystems) primer and probe amplification cDNA with the interior regional complementarity of a cover and 5 ' non-translational region (UTR).Primer and probe sequence are: (HCV20F) CGACACTCCACCATAGATCACT (SEQ ID NO:4); (HCV114R) GAGGCTGCACGACACTCATACT (SEQ ID NO:5); (HCV P43) FAM-CCCTGTGAGGAACTACTGTCTTCACGCAGA-TAMRA (SEQ IDNO:6).

The expression of HCV protein in the cell that infects checked by immunofluorescence assay or immunoperoxidase infectivity assay and is quantitative.Fixed cell in 1 hour by room temperature incubation in 2% formaldehyde.After fixing, cell was changed processing in 5 minutes thoroughly by incubation in the PBS that contains 0.2%TX-100 and 0.1% Trisodium Citrate.For fluorescence imaging, the cell of changing was thoroughly also used the mouse monoclonal antibody special to the HCV core in 30 minutes then with 3% normal goats serum and the sealing of 0.5% bovine serum albumin, and (ab2740, Abcam) dyeing is 20 minutes.After the washing, (A11032, Invitrogen) incubation is 20 minutes with second antibody with cell.With cell fixing and imaging with 1 Permafluor (ThermoScientific).Count the number of infected focus and measure infection titer so that form unit/ml with focus.

Infection titer also can use the immunoperoxidase infectivity assay method to determine.Cell is fixed and saturatingization as mentioned above.Then cell is sealed according to manufacturers instruction with the anti-mouse Ig of ImmPRESS superoxide enzyme reagent kit (MP-7402, Vector Labs).(ab2740 Abcam) dyeed 1 hour by the gross with the cell mouse monoclonal antibody special to the HCV core.After the washing, with cell ImmPRESS peroxidase: anti-mouse conjugate incubation 30 minutes.Painted cell is developing the color by DAB enhancing (H-2200, Vector Labs) after 10 minutes then with ImmPACT DAB substrate (SK-4105, Vector Labs) incubation.Infection titer is defined as causing 50% hole to contain the terminal point extent of dilution (TCID50 of TCID) of cells infected.

HCV infectious virus EC ₅₀ Measure

The susceptibility of infectious HCV enantiopathy toxic agent uses genotype 1a type strain H77S or H77S RO-51-5B to measure.By with the transfection of full-length gene group in the Rof-0c cell, culturing cell and after transfection, collected substratum in 7 days and produce viral original seed in containing the DMEM of 2-10%HS.For EC ₅₀Measure, the Rof-0c cell is inoculated into bag by in 96 orifice plates of poly-D-Methionin (BD Biosciences) with 10,000 every holes of cell.Inoculate back 24 hours, substratum is removed and the viral original seed of 90 μ l is joined in every hole.Add inhibitor then with 3 times of serial dilutions.Infected quantitative as mentioned above HCV RNA back 3 days.EC ₅₀Value defined is 50% a viewed concentration when reducing of the level of the HCV RNA that measures by quantitative RT-PCR.

The result

Human serum does not influence the HCV rna replicon.Study the limitation of the low virus titer that the replication in vitro of infectious GT 1a strain produced at present.Produce in order to improve infectious virus, checked the effect of human serum.Will through the Huh-7 of processing treatment clone Rof-400c with total length GT 1a virus stain H77S transfection and with cell cultures in the substratum that contains 10%FBS or 10%HS.The amount of measuring HCV RNA in the born of the same parents was above 5 days.At all time points of test, the cell of cultivation in HS or FBS contains the HCV RNA (Fig. 1) of analog quantity.Add HS and in cells transfected, as if do not increase duplicating of HCV RNA.

Human serum does not increase the generation of infectious HCV.In above-mentioned identical experiment, checked the effect that human serum produces infectious HCV particle.Removed substratum in per 24 hours after the transfection, continue 5 days, and be seeded in then on the juvenile cell to measure the infectious virus generation.At the appointed time select under the situation that the supernatant liquor collected exists incubation and measure the existence of infectious virus by the amount of HCV RNA in the born of the same parents in the quantitative juvenile cell after 72 hours.The amount of HCV RNA is suitable (Fig. 2) between the cell that infects with the supernatant liquor of having collected from transfection H77S or replication defective mutant and the cell of cultivation in FBS in the detected born of the same parents in the juvenile cell that infects.This shows, the amount of the infectious HCV that discharges from the cell of cultivating among FBS can not be distinguished mutually with the remaining residual HCVRNA of transfection.Yet the amount of HCV RNA exists in the born of the same parents that are used for reclaiming the juvenile cell that has infected of culture medium inoculated of the transfectional cell that personal HS cultivates increases (Fig. 2).The transfectional cell of cultivation in HS discharged infectious HCV, and its amount increases in five days mensuration always.But showing HS, these experiments do not increase the generation that duplicating of HCV RNA increased infectious virus.

In order to confirm that infectious particles discharges from the cells infected of cultivating in HS, juvenile cell is used in the supernatant liquor inoculation that a plurality of time points are collected, and analyzes the expression of HCV core protein then.Exist (Fig. 3 and Fig. 4) that immunofluorescence and peroxidase analysis confirm the HCV core protein carried out in dyeing in cell.These results show, the increase (Fig. 2) of detected HCV RNA is the result that productivity HCV infects in the juvenile cell that the substratum of the transfectional cell that personal HS cultivates infects being used for.

The peak value of infectious HCV produces.Above-mentioned experiment shows that the transfectional cell of cultivating in HS has discharged infectious particles during 5 days.In order to measure the time to peak point that virus produces, transfectional cell is cultivated in HS reached 11 days.Collect from the substratum of transfectional cell and be used to inoculate juvenile cell.The existence of infectious particles is measured quantitatively by the terminal point extent of dilution of measuring TCID50/ml.With H77S transfection Rof-0c cell, and after transfection the 7th day the time, infection titer reaches the peak value (Fig. 5) of about 6000TCID50/ml.(Yi etc., Proc.Natl.Acad.Sci.USA 2,006 103 (7): 2310-2315) high 60 times than the peak value HCV infection titer of the cell of cultivation in FBS of report in the past available from the peak value HCV infection titer of cultivating the transfectional cell in HS.

The generation of NS5B embedded virus.The HCV replicon that use is convenient to clone and analyze arbitrary NS5B sequence has been set up NS5B box system (Le Pogam etc., J.Antimicrob.Chemother.2008 61:1205-1216).NS5B box system has been used to analyze one group of NS5B isolate the phenotype of multiple non-nucleosides and nucleosidic inhibitors has been replied.The AsiSI and the RsrII restriction site that will be used for cloning the NS5B sequence are cloned into total length H77S genome.To be cloned into from the consensus sequence of the known clinical isolates that in H77 box replicon, duplicates in the H77S NS5B box, obtain embedded virus H77S R0-51-5B.Inspection is from the generation of the infectious virus of H77S RO-51-5B cells transfected.Similar with H77S, the time to peak point that infectious virus produces is the 7th day, although compare with H77S, the titre of H77S RO-51-5B has reduced by 3 times (Fig. 5).These data show that NS5B box system can be used to produce chimeric infectious virus.

The HCV inhibitor is to the effectiveness of GT 1a virus.By collecting in the 7th day after the transfection from existing the substratum of cultured cells under the HS to produce viral original seed.Analyze the HCV original seed and whether be enough to measure the effectiveness of HCV inhibitor to measure them.The Rof-0c cell inoculation in 96 orifice plates, is infected with H77S or H77S RO-51-5B, and use known non-nucleosidic inhibitors (HCV-796) or known entry inhibitor (JS81) to handle then.HCV-796 at the effectiveness of infectious H77S be 32 ± 4nM and to similar (Fig. 6) of report.JS81 is 139 ± 23ng/ml and also similar to the data of having reported (Fig. 6) at the effectiveness of infectious H77S RO-51-5B.These experiments provide the GT 1a infectious virus of evidence proof growth in the presence of HS can be used to measure the effectiveness of HCV inhibitor.

Claims (9)

1. be used for increasing the method that infectious HCV genotype 1 C-type virus C particle produces in cultured cells, described method comprises:

With the replication competent type HCV genotype 1 type polynucleotide transfection cultured cells that comprises adaptive mutation Q1067R, V16551, K1691R, K2040R, S2204I;

In the presence of the human serum of 2-10%, cultivate the culturing cell of transfection;

From containing infectious HCV genotype 1 C-type virus C particulate transfection culturing cell collection substratum.

2. the process of claim 1 wherein that the culturing cell of described transfection is derived from Huh-7 clone.

3. the method for claim 1 or claim 2 is wherein cultivated the culturing cell of described transfection in the presence of 10% human serum.

4. be used for increasing the method that infectious HCV genotype 1 C-type virus C particle produces in cultured cells, described method comprises:

With comprising adaptive mutation Q1067R, V16551, K1691R, K2040R, S2204I and further containing the replication competent type HCV genotype 1 type polynucleotide transfection cultured cells of the NS5B polynucleotide sequence of sample among the experimenter who infects from HCV genotype 1 type;

In the presence of the human serum of 2-10%, cultivate the culturing cell of transfection;

Collect substratum the culturing cell of transfection from containing infectious HCV genotype 1 C-type virus C particulate.

5. the method for claim 4, the culturing cell of wherein said transfection is derived from Huh-7 clone.

6. the method for claim 4 or claim 5 is wherein cultivated the culturing cell of described transfection in the presence of 10% human serum.

7. screen the method for HCV genotype 1 type inhibitor, described method comprises:

With the replication competent type HCV genotype 1 type polynucleotide transfection cultured cells that comprises adaptive mutation Q1067R, V16551, K1691R, K2040R, S2204I;

The incubation culturing cell of transfection in the presence of the human serum of 2-10%;

From containing infectious HCV genotype 1 C-type virus C particulate transfection culturing cell collection substratum;

Under the situation that has or do not exist the molecule that is used for HCV inhibition screening active ingredients, infect natural cultured cells with infectious HCV genotype 1 C-type virus C particle; And

Measure the HCV level that exists in the culturing cell that has infected, wherein compare with there not being described molecule, the reduction of HCV level shows that this molecule is HCV genotype 1 a type inhibitor in the presence of described molecule.

8. the method for claim 7, wherein said replication competent type HCV genotype 1 type polynucleotide also comprise the NS5B sequence of the experimenter's who infects from HCV genotype 1 type sample.

9. the method for claim 7 or claim 8, the culturing cell of wherein said transfection and the described culturing cell that has infected are derived from Huh-7 clone.

Images