CN102146353A

CN102146353A - Gene engineering bacterium capable of both tolerating high-concentration As (Arsenic) (III) and oxidizing As (III) and application thereof

Info

Publication number: CN102146353A
Application number: CN2009102652386A
Authority: CN
Inventors: 徐炎华; 杨春艳; 颜立敏; 许琳; 杨洁
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2009-12-18
Filing date: 2009-12-18
Publication date: 2011-08-10
Anticipated expiration: 2029-12-18
Also published as: CN102146353B

Abstract

The invention belongs to the field of gene engineering and environmental protection, and discloses a gene engineering bacterium capable of both tolerating high-concentration As (Arsenic) (III) and oxidizing As (III) and application thereof. The gene engineering bacterium is named as Pseudomonasputida AS-02 in a classified manner and preserved with a preservation number of CCTCC NO. M209215 in China Center for Type Culture Collection. The tolerance of the gene engineering bacterium to the As (III) reaches 800 mg/L, the oxidability reaches 91.7%, and the genetic stability is better; and the gene engineering bacterium can be used for treating high-concentration arsenic wastewater, and has very important environment-friendly values in reducing toxicity of the wastewater and improving a follow-up treatment effect.

Description

A kind of genetic engineering bacterium and application thereof that can tolerate high density As (III) again can oxidation As (III)

Technical field:

The invention belongs to genetically engineered and field of environment protection, relate to a kind of can resisting high-concentration trivalent arsenic As (III) again can efficient oxidation As (III) genetic engineering bacterium and application thereof.

Background technology:

Arsenic (As) is a kind of carcinogenic substance to human body and the toxic effect of other organism.Arsenic in the water body exists with inorganic states usually, and trivalent arsenic As (III) and two kinds of chemical valence states of pentavalent arsenic As (V) are arranged.The method of processing arsenic-containing waste water commonly used mainly contains at present: precipitation/co-precipitation, absorption, ion exchange method and embrane method.But, these technology are primarily aimed at As (V), because when pH＜9.2, the existence form of As (III) is electric neutrality, its adsorption binding energy power a little less than, and the toxicity of As (III) is more than 100 times, therefore of As (V), when handling arsenic-containing waste water, need As (III) be converted into As (V) by pre-treatment usually.Oxygenant commonly used at present mainly contains chlorine, pure oxygen, ozone, potassium permanganate etc.In recent years, light helps Fenton method and some effective adsorbent to be aided with light-catalysed method and has received concern widely.But all there are some shortcomings in these methods, such as: though chlorine is a kind of fast and effectively oxygenant, can produce carcinogenic by products such as trichloromethane when organism exists, ozone and photochemical catalysis expense are higher.Along with Many researchers separates the bacterial classification with oxidation capacity, the use of biological oxidation process is arisen at the historic moment, and becomes the focus of current research.There is the heterotroph bacterium of the energy oxidation As (III) of report to mainly contain Bacillus foecalis alkaligenes (Alcaligenes faecalis) at present, Cenibacterium arsenoxidans, the hot bacterium HR13 (Thermus HR13) of dwelling, thermus thermophilus HB8 (Thermusthermophilus HB8), agrobacterium tumefaciens (Agrobacterium tumefaciens) and the orange green bacterium Chloroflexusaurantiacus that subdues.These bacterium why can oxidation As (III), be because its contain the trivalent arsenic oxydase can catalyzed oxidation As (III).But their anti-arsenic ability is generally lower, such as: Thermus thermophilus HB8 is higher to the oxidation ratio of As (III), and stability is stronger, but the growth conditions of this bacterium is comparatively extreme, and growth temperature is higher, is not suitable for the cultivation of usual terms.In addition, it only can be grown under the arsenate concentration of 75mg/L.Therefore, it obviously is inappropriate using thermus thermophilus to handle actual high density arsenic-containing waste water.

(TTHB127 TTHB128), is positioned on the plasmid (pTT27) of this bacterium the gene of trivalent arsenic oxydase among the Thermus thermophilus HB8 (comprising big small subunit).The protein of this genes encoding has the effect of catalyzed oxidation As (III).

The anti-arsenic bacterium of a strain has been screened in this laboratory from the high density arsenic-containing waste water, the anti-As of this bacterial strain (III) concentration can reach 500mg/L.Through evaluations such as Biolog automatization identification systems and 16S rDNA sequential analyses, this bacterial strain belongs to pseudomonas putida (pseudomonasputida), called after pseudomonasputida AS-01.This bacterium has been preserved in Chinese typical culture collection center, and (abbreviation CCTCC, the address: Chinese Wuhan Wuhan University), deposit number is: CCTCCNO:M 209296, and preservation date is on December 7th, 2009.This strains A s (III) oxydase The Characteristic Study is found that its oxidation capacity to As (III) is lower, only reaches 29.8%, and less stable, is not enough to oxidation As (III) effectively, thereby reduce the toxicity that high density contains trivalent arsenic waste water.But relevant this bacterium reference: Wang Wei, Wang Junqin, Yang Jie, Xu Yanhua, the screening of trivalent arsenic oxidation bacterial strain and culture condition pre-test thereof, sick magazine, 2006,25 (1): 96～98 learned of place of china.

Document (Fan Qiuyan, Yang Chunyan, Xu Lin, Xu Yanhua, the structure of anti-As (III) and efficient oxidation As (III) genetic engineering bacterium, Nanjing University of Technology's journal (natural science edition), 2009,31 (2): 61～64) reported the method for a kind of structure anti-As (III) and efficient oxidation As (III) genetic engineering bacterium and obtain genetic engineering bacterium 127pBBR128-AS, because this method has adopted method for screening, can not guarantee to filter out of the same race belonging to together with reappearing, the identical microbe of biochemical heritability, do not have the described practicality of patent law, the genetic engineering bacterium 127pBBR128-AS of its acquisition does not carry out preservation, and the public can't obtain, and after this genetic engineering bacterium was transferred to 30 times, the oxydase vigor was parallel with original strain AS-01.

Not having a kind of stability and oxydase vigor better can tolerate the engineering strain that high density As (III) again can efficient oxidation As (III) at present provides.

Summary of the invention:

The object of the present invention is to provide a kind of can resisting high-concentration As (III) again can efficient oxidation As (III) the pseudomonas putida genetic engineering bacterium.

Another object of the present invention provides the application of said gene engineering bacteria in handling arsenic-containing waste water.

The present invention adopts the gene (TTHB127 with trivalent arsenic oxydase (comprising big small subunit) among the above-mentioned Thermus thermophilus HB8, TTHB128) upward (plasmid map is seen Fig. 1 to be inserted into wide host's shuttle expression carrier pBBR1MCS-5, the detailed construction process document M.E.Kovach that sees reference, P.H.Elzer, D.S.Hill, G.T.Robertson, M.A.Farris, R.M.Roop II, K.M.Peterson, Four new derivatives of the broad-host-range cloningvector pBBR1MCS, carrying different antibiotic-resistance cassettes, Gene.166 (1995) 175-176.), transform host bacterium (pseudomonas putida AS-01), obtaining through screening can resisting high-concentration As (III), genetic engineering bacterium that again can efficient oxidation As (III).On this basis, utilization this project bacterium is handled the high density arsenic-containing waste water, to reach efficient oxidation As (III), reduces wastewater toxicity.

The objective of the invention is to be achieved through the following technical solutions:

A kind of pseudomonas putida genetic engineering bacterium, its classification called after pseudomonas putida (Pseudomonasputida) AS-02 has been preserved in Chinese typical culture collection center, and deposit number is: CCTCC NO:M 209215.

The application of described pseudomonas putida genetic engineering bacterium in handling arsenic-containing waste water.Wherein arsenic-containing waste water is preferably and contains the arsenious waste water of 500～800mg/L.

The method that obtains pseudomonas putida genetic engineering bacterium of the present invention is summarized as follows:

1, from thermus thermophilus HB8, extracts plasmid DNA.According to the Thermusthermophilus HB8 that has issued in the gene pool (available from German microbial strains preservation center, DSMZ) the big small ylidene gene sequence of trivalent arsenic oxidase gene (AccessionNo.YP 145366 and YP 145367) design primer in, amplify the big small ylidene gene fragment of trivalent arsenic oxydase, it has SEQ ID No:1 in the sequence table, the described nucleotide sequence of SEQ ID No:2.

2, structure comprises having SEQ ID No:1 in the sequence table, the recombinant vectors of the described nucleotide sequence gene of SEQ ID No:2.It is with SEQ ID No:3, SEQ ID No:4 in the sequence table and SEQ ID No:5, SEQID No:6, increase as big small subunit PCR primer respectively, and cut glue and reclaim the dna fragmentation that obtains 2586bp and 483bp, carry out ligation with pMD18-T respectively, the former makes pMD18-T-TTHB127, and the latter makes pMD18-T-TTHB128.

3, structure comprises having SEQ ID No:1 and the described nucleotide sequence expression carrier of SEQ ID No:2 in the sequence table, with SEQ ID No:7, SEQ ID No:8 in the sequence table and SEQ ID No:9, SEQ ID No:10, increase as big small subunit PCR primer respectively, and be big small subunit amplification template with pMD18-T-TTHB127, pMD18-T-TTHB128 respectively.Cut glue and reclaim the big small ylidene gene fragment that obtains having corresponding restriction enzyme site.The expression vector pBBR1MCS-5 that cuts with small ylidene gene fragment behind EcoRI and the BamH I double digestion and same enzyme carries out ligation, make pBBR1MCS-5-TTHB128, behind the Transformed E .coliDH5 α, extract the plasmid of positive colony, this plasmid is carried out ligation with the big subunit gene fragment after cutting with same enzyme behind PacI and the SpeI single endonuclease digestion respectively again, make TTHB127-pBBR1MCS-5-TTHB128, construction strategy is seen Fig. 3.

Recombinant vectors (the described carrier TTHB127-pBBR1MCS-5-TTHB128 of the step 3) transformed host cell that 4, will contain the trivalent arsenic oxidase gene.The recombinant vectors that will contain the trivalent arsenic oxidase gene by the three close methods that engage imports to the host bacterium, and described host bacterium is pseudomonas putida (pseudomonasputida) AS-01.

5, contain greater concn (〉=500mg/L) on the LB flat board of arsenite, screening obtains number strain bacterial strain, it is carried out arsenite patience respectively, the mensuration of arsenite oxidation capacity and engineering bacteria stability are measured, it is higher to As (III) patience to obtain a strain after more every performance, oxidation capacity is stronger, and the advantage aimed strain that stability is higher carries out preservation with this bacterial strain.

Beneficial effect of the present invention:

Genetic engineering bacterium provided by the invention reaches 800mg/L to the tolerance of As (III), oxidation capacity reaches 91.7%, genetic stability is better, disclosed genetic engineering bacterium 127pBBR128-AS compares with document, have better stability, oxidation capacity, can tolerate higher As (III) concentration, can be used to contain the processing of high density As (III) waste water better, have the better value of environmental protection.

Description of drawings:

Fig. 1 plasmid pBBR1MCS-5 collection of illustrative plates.

The pcr amplification result of the big small ylidene gene of Fig. 2 trivalent arsenic oxidase gene.

Swimming lane M is a dna molecular amount standard (DL-2000); Swimming lane 2 is the PCR product of the big subunit gene of trivalent arsenic oxidase gene; Swimming lane 3 is the PCR product of the small ylidene gene of trivalent arsenic oxidase gene;

A kind of construction strategy figure that contains the expression vector of trivalent arsenic oxidase gene of Fig. 3.

Fig. 4 recombinant plasmid TTHB127-pBBR1MCS-5-TTHB128PCR qualification result

Swimming lane 1 is with the big subunit PCR qualification result of recombinant plasmid as template; Swimming lane 2 is with the small subunit PCR qualification result of recombinant plasmid as template; Swimming lane M is a dna molecular amount standard (DL-2000);

Fig. 5 cuts qualification result for recombinant plasmid pBBR1MCS-5-TTHB128 through the AflIII enzyme.

Swimming lane M is a dna molecular amount standard (DL-2000); Swimming lane 1 is the result of pBBR1MCS-5-TTHB128 through the AflIII single endonuclease digestion;

Fig. 6 recombinant plasmid TTHB127-pBBR1MCS-5-TTHB128HindIII electrophoresis is identified figure.

Swimming lane M is a dna molecular amount standard (DL-15000); Swimming lane 1 is a TTHB127-pBBR1MCS-5-TTHB128HindIII single endonuclease digestion qualification result.

Recombinant plasmid TTHB127-pBBR1MCS-5-TTHB128 is through presenting two bands that reach about 2500bp about 5000bp behind the HindIII single endonuclease digestion

Fig. 7 recombinant plasmid electrophoresis is identified figure.

Swimming lane M is a dna molecular amount standard (DL-15000); Swimming lane 1-5 transforms the plasmid that extracts behind the host pseudomonas putida for recombinant plasmid TTHB127-pBBR1MCS-5-TTHB128, and swimming lane 6 is to insert correct recombinant plasmid TTHB127-pBBR1MCS-5-TTHB128 through identifying.

Fig. 8 AS-01 to the oxidation of As (III) and cell density over time.

Fig. 9 protogene engineering bacteria AS-02 to the oxidation of As (III) and cell density over time.

Among Fig. 8,9: is OD ₆₀₀Change; ■ is As (III) oxidation situation.

Figure 10 protogene engineering bacteria AS-02 bacterium genetic stability figure.

Biomaterial preservation information:

Pseudomonas putida genetic engineering bacterium of the present invention, its classification called after pseudomonas putida (Pseudomonasputida) AS-02, be preserved in Chinese typical culture collection center (abbreviation CCTCC, address: Chinese Wuhan Wuhan University), deposit number is: CCTCC NO:M209215, preservation date are on September 28th, 2009.

Pseudomonas putida (pseudomonas putida) AS-01 that the present invention adopts has been preserved in Chinese typical culture collection center (abbreviation CCTCC, address: Chinese Wuhan Wuhan University), deposit number is: CCTCC NO:M209296, preservation date are on December 7th, 2009.

Embodiment

Below by embodiment the present invention is further elaborated.

Biological material source:

E.coli DH5a is a genetically engineered instrument bacterial classification commonly used, is permitted beautiful jade by Nanjing University of Technology and gives, and preservation is generally also all arranged in the laboratory relevant with genetically engineered research; Thermus thermophilus (Thermus thermophilus HB8) is by being permitted beautiful jade available from German microbial strains preservation center (DSMZ) and represent; PMD18-T is available from precious biotechnology (Dalian) company limited; PBBR1MCS-5 and E.coli WD803 (pRK2013) Lee of Agricultural University Of Nanjing give along roc; PseudomonasputidaAS-01 (CCTCC NO:M209296) is given by Nanjing University of Technology Xu Yan China.

The molecular biology working method: experiment such as plasmid extraction, polymerase chain reaction, restriction endonuclease enzyme are cut, dna fragmentation recovery, connection and intestinal bacteria conversion all is the routine operation method in the genetically engineered research field, if no special instructions all referring to " molecular cloning experiment guide ".

The trivalent arsenic oxidase gene obtains among the embodiment 1Thermus thermophilus HB8

A. the extracting of plasmid (pTT27) in the thermus thermophilus (Thermus thermophilus HB8)

Thermus thermophilus HB8 glycerol stock is seeded in the 400ml LB cultivation, 75 ℃, 200rpm cultivated 2-3 days, collect bacterium mud, 4,500-6,000 * g, 4 ℃ of centrifugal 10min, complete abandoning supernatant, extractive process see the big fragment plasmid extraction specification sheets that German Macherey-Nagel company provides ( Xtra Midi Plus).

B. the pcr amplification of goal gene TTHB127, TTHB128

According to trivalent arsenic oxydase (comprising big small subunit) gene order (SEQ No.1 in the thermus thermophilus of having announced among the NCBI GeneBank (Thermus thermophilus HB8), SEQ ID No.2), utilize primer-design software DNAStar to design from the primer of the big small ylidene gene sequence of plasmid pTT27 amplification of Thermus thermophilus HB8, it is synthetic to transfer to Shanghai Shenergy Biocolor BioScience ﹠ Technology Company.

The primer of the big subunit gene order correspondence that increases:

Upstream primer: 5 '-AGGTAAGGTATGGCGCTCATTC-3 ' (SEQ ID No.3)

Downstream primer: 5 '-GGCTTAGTCAAACTTGTTCTGC-3 ' (SEQ ID No.4)

Plasmid pTT27 with extraction is a template, the big subunit gene of amplification TTHB127, and the PCR reaction conditions is 94 ℃, 5min, 94 ℃, 1min, 52 ℃, 2min, 72 ℃, 2min, after 35 circulations, 72 ℃, 10min, 4 ℃ of preservations.The primer of amplification small ylidene gene sequence correspondence:

Upstream primer: 5 '-ATATGACGCAGACCATGACCCGTAG-3 ' (SEQ ID No.5)

Downstream primer: 5 '-CTCCTCACACGTTCTTCACGC-3 ' (SEQ ID No.6)

Plasmid pTT27 with extraction is a template, amplification TTHB128 small ylidene gene, and the PCR reaction conditions is 94 ℃, 5min, 94 ℃, 1min, 55 ℃, 30s, 72 ℃, 2min, after 35 circulations, 72 ℃, 10min, 4 ℃ of preservations.

C. the recovery of target gene fragment: test kit (the Agarose GelDNA Fragment Recovery Kit VER.2.0) specification sheets that provides according to precious biotechnology (Dalian) company reclaims target gene fragment, and the fragment electrophorogram is seen Fig. 2.

D. target gene fragment connects the pMD18-T carrier: the (test kit (pMD that provides according to precious biotechnology (Dalian) company is provided with the pMD18-T carrier respectively the PCR product of recovery ^TM18-TVector) specification sheets carries out ligation), connect product transformed competence colibacillus cell intestinal bacteria E.coli DH5 α, coating contains the LB flat board of penbritin, selects resistance clone, the G that provides according to Shanghai Shenergy Biocolor BioScience ﹠ Technology Company _OThe centrifugal plasmid a small amount of of 3S post extraction agent box V3.1 specification sheets extracts the laggard performing PCR evaluation of plasmid and enzyme is cut evaluation, screening positive clone, called after TTHB127-pMD18-T and TTHB128-pMD18-T respectively.

E. with the positive colony order-checking of confirming: finish by Nanjing Jin Site company.Find entirely true with trivalent arsenic oxydase (comprising big small subunit) gene order BLAST comparison back in the thermus thermophilus of having issued among the GenBank Database (Thermus thermophilus HB8).

The reorganization of big small ylidene gene fragment of embodiment 2 trivalent arsenic oxydase and expression vector pBBR1MCS-5

The reorganization of big small ylidene gene fragment of trivalent arsenic oxydase and expression vector pBBR1MCS-5 sees Fig. 3 for details, and concrete implementation step is as follows:

A. with the primer PCR big small ylidene gene fragment that increases of band restriction enzyme site

Go up the primer that the design of polyclone restriction enzyme site has restriction enzyme site (lining out below the restriction enzyme site) according to expression vector pBBR1MCS-5.

The restriction enzyme site primer that has of big subunit gene order correspondence is:

Upstream primer: 5 '-

CC TTAATTAATGCGAACTGACAGGATGATTTCTCATGGCGCTCATTCCCCG

TAG-3’(SEQ ID No.7)

Downstream primer: 5 '-GG ACTAGTTTAGTCAAACTTGTTCTGCTGC-3 ' (SEQ ID No.8)

Plasmid TTHB127-pMD18-T with extraction is a template, utilizes above-mentioned primer, and amplification has the big subunit gene of TTHB127 of corresponding restriction enzyme site, and the PCR reaction conditions is 94 ℃, 5min, 94 ℃, 1min, 63 ℃, 2.5min, 72 ℃, 2min, after 35 circulations, 72 ℃, 10min, 4 ℃ of preservations.

The primer that has restriction enzyme site of small ylidene gene sequence correspondence is:

Upstream primer: 5 '-CCG GAATTCATGACGCAGACCATGACCCGTAG-3 ' (SEQ ID No.9)

Downstream primer: 5 '-CGC GGATCCCCTTAATTAATCACACGTTCTTCACGC-3 ' (SEQ ID No.10)

Plasmid TTHB128-pMD18-T with extraction is a template, and amplification has the TTHB128 small ylidene gene of corresponding restriction enzyme site, and the PCR reaction conditions is 94 ℃, 5min, 94 ℃, 1min, 74 ℃, 30s, 72 ℃, 2min, 35 circulations, 72 ℃, 10min, 4 ℃ of preservations.

B. the recovery of target gene fragment: reclaim target gene fragment according to the biological Dalian of treasured company test kit specification sheets.

C. the structure of expression plasmid and conversion

(1) target gene fragment (TTHB128) and expression vector is connected

The small ylidene gene fragment (TTHB128) that will have a restriction enzyme site is with EcoRI and BamHI double digestion, cuts at 37 ℃ of following enzymes and spends the night.Carrier pBBR1MCS-5 is spent the night with EcoRI and BamHI double digestion equally.

The linear carrier fragment of cutting behind the purifying with same enzyme behind the gene fragment purifying after enzyme cut is carried out ligation.Connect product Transformed E .coliDH5 α competent cell, coating contains the LB flat board of gentamicin, selects resistance clone, extracts plasmid, cuts evaluation and screening with PCR evaluation and enzyme and identifies positive colony, and the PCR qualification result is seen accompanying drawing 4 (swimming lane 2); Plasmid obtains the small segment that size is about 1100bp after restriction enzyme A flIII enzyme is cut, the results are shown in accompanying drawing 5.Cut the correct positive colony called after pBBR1MCS-5-TTHB128 of evaluation through PCR evaluation and enzyme.

(2) target gene fragment (TTHB127) and expression vector (pBBR1MCS-5-TTHB128's) is connected

The target gene fragment (TTHB127) that will have a restriction enzyme site is carried out the SpeI single endonuclease digestion after with PacI single endonuclease digestion purifying again, and 37 ℃ of following enzymes are cut and spent the night.Carrier pBBR1MCS-5-TTHB128 cut with same enzyme enzyme spend the night.

The linear carrier fragment of cutting behind the purifying with same enzyme behind the gene fragment purifying after above-mentioned enzyme cut is carried out ligation.Connect product Transformed E .coliDH5 α competent cell, coating contains the LB flat board of gentamicin, selects resistance clone, extracts plasmid, cuts the evaluation positive colony with PCR and enzyme, and the PCR qualification result is seen accompanying drawing 4 (swimming lane 1); Plasmid obtains two fragments that size is about 2800bp and 5000bp after restriction enzyme HindIII enzyme is cut, the results are shown in accompanying drawing 6, cut the correct positive colony called after TTHB127-pBBR1MCS-5-TTHB128 of evaluation through PCR evaluation and enzyme, contain the transformed bacteria E.coli DH5 α called after E.coli DH5 α (TTHB127-pBBR1MCS-5-TTHB128) of plasmid TTHB127-pBBR1MCS-5-TTHB128.

Embodiment 3 is the structure (three close bonding methods) of the genetic engineering bacterium of host bacterium with pseudomonas putida AS-01

(1) cultivation of donor bacterium E.coli DH5 α (TTHB127-pBBR1MCS-5-TTHB128)

Inoculate single bacterium colony and contain in the LB liquid nutrient medium of gentamicin (60mg/L) in 5mL, 37 ℃ of incubated overnight are got 0.5mL bacterium liquid and are inoculated in 3mL and contain in the same antibiotic LB liquid nutrient medium, and 37 ℃ are continued to cultivate 4-5h.

(2) cultivation of auxiliary bacterium E.coli WD803 (pRK2013)

Inoculate single bacterium colony and contain in the LB liquid nutrient medium of kantlex (50mg/L) in 5mL, 37 ℃ of incubated overnight are got 0.5mL bacterium liquid and are inoculated in 3mL and contain in the same antibiotic LB liquid nutrient medium, and 37 ℃ are continued to cultivate 4-5h.

(3) cultivation of recipient bacterium P.putida AS-01

Inoculate single bacterium colony in the 5mLLB substratum, 30 ℃ of cultivation 12h are stand-by.

(4) zygosporic screening

With above-mentioned cultured bacterium liquid with sterilized water washing 2 times after, all be resuspended in the fresh LB substratum of 5mL, bacteria liquid is long-pending than by the donor bacterium: auxiliary bacterium: (this method reference three parents are in conjunction with general method for the ratio of recipient bacterium=2: 1: 1, there is recombinant plasmid in the donor cingula, requirement is more) get three kinds of bacterium liquid and in centrifuge tube, mix, coat after the dilution on the asepsis cellulose filter membrane of the dull and stereotyped central authorities of LB,, engage in 30 ℃ of cultivation 36h.

Above-mentioned filter membrane is taken off, be placed in the suitable sterilized water, wash thalline on the vortex oscillation instrument, suitably after the dilution, coating contains on the LB flat board of 500mg/LAs (III) and gentamicin (60mg/L), cultivates 36h in 30 ℃.

(3) screening of positive colony

From above-mentioned all clones of dull and stereotyped picking, extract plasmid, with among the embodiment 2 through identifying that correct final cloned plasmids does contrast, find the band position consistency, electrophoresis result is seen accompanying drawing 7.

The screening of embodiment 4 advantage aimed strains

With the positive colony that obtains among the embodiment 3, screen containing on the LB flat board of high density arsenite, improve constantly the concentration of arsenite in the substratum, in the concentration range of 500mg/L-800mg/L, gradient is set, screening obtains the engineering bacteria of 5 strain ability greater concns, these a few strain bacterial strains are carried out As (III) patience measure, As (III) oxidation capacity is measured and engineering bacteria stability is measured, and best advantage aimed strain is obtained in screening after more every performance.(annotate: when not specifying, the substratum that contains the genetic engineering bacterium of plasmid TTHB127-pBBR1MCS-5-TTHB128 all adds gentamicin 60mg/L)

(1) each bacterial strain is to the comparison of As (III) patience

OD is measured in experiment when strengthening the content of As in the LB nutrient solution (III) gradually ₆₀₀Detect the microorganism of screening to the tolerance of arsenic, the results are shown in Table 1.

(2) each bacterial strain is to the comparison of As (III) oxidation capacity

The 5 strains reorganization bacterium (01-05) that will obtain from the flat board screening that contains high density As (III) are inoculated in respectively the 50mL LB substratum with the seed liquor of recipient bacterium, add As (III) solution, making its final concentration is that 10mg/L is (because experimental determination As (III) only measures 20 μ g/L levels with interior, excessive concentration may the too high meeting of extension rate be brought the problem of accuracy, what therefore oxidation concentration was established is lower), cultivated 28 hours respectively at 30 ℃, during measured OD every two hours ₆₀₀And get a certain amount of bacterium liquid, behind the centrifugal 2min of 12000r/min, get supernatant, after the dilution certain multiple, with the concentration of As (III) in the hydride generation-aas determination supernatant, and calculating oxidation ratio (concentration of (concentration of culture medium A s (III) behind the concentration of the initial As of substratum (III)-yeast culture some hrs)/initial As of substratum (III)), the results are shown in Table 1, the result shows that No. 01 bacterium oxidation capacity obtaining of screening is the strongest, reaches 91.7%.

(3) each bacterial strain genetic stability is measured

With the screening 5 strain microbial inoculants in the fresh LB substratum that contains gentamicin, overnight incubation, transfer in the fresh LB liquid nutrient medium by 1% inoculum size, cultivate 12h, a generation is once can be regarded as in switching later on, in the LB substratum that contains or do not contain gentamicin (60mg/L), cultivate respectively, take a sample every 10 generations.Get the somatic cells suspension after 10,20,30,40,50 generations are cultivated, after 12000r/min is centrifugal, get supernatant, after the dilution certain multiple, with the concentration of As (III) in the hydride generation-aas determination supernatant, and calculate oxidation ratio (concentration of (concentration of culture medium A s (III) behind the concentration of the initial As of substratum (III)-yeast culture some hrs)/initial As of substratum (III)).Engineering bacteria that screening obtains is found in experiment, and proterties begins to lose after 10 times going down to posterity on the flat board that does not contain the gentamicin resistance, the 02-05 bacterium goes down to posterity on the flat board of gentamicin that proterties begins to lose more than 30 times containing, No. 01 bacterium is gone down to posterity, and the oxidation proterties begins sharply to lose more than 40 times, and concrete data see Table 1.

Comprehensively (1), (2), (3), No. 01 bacterial strain that obtains through screening is the strongest to the tolerance of As (III), is 800mg/L, and oxidation capacity is the highest, be 91.7%, and genetic stability is the strongest, and 40 generation rear oxidation ability shapes begin sharply to lose through going down to posterity.This bacterium called after AS-02, its genetic stability is seen Figure 10.

Table 1: the screening bacterial strain is to As (III) patience, oxidation capacity and genetic stability comparison sheet

Embodiment 5 host bacterium AS-01 compare with the application of engineering strain AS-02 in containing As (III) waste water that screening obtains.

By the method for describing among the embodiment 4-(2) host bacterium AS-01 and AS-02 are cultivated, cultivation through 22 hours, thalli growth enters stable decline phase, centrifugal bacterium liquid, measure the concentration of supernatant As this moment (III), find that host bacterium AS-01 only has 29.8% to the oxidation ratio of As (III), and strains A S-02 can reach 91.7% to the oxidation ratio of As (III), it has tangible effect to the oxidation of As (III) behind 16h, the results are shown in Figure 8,9

According to above-mentioned The selection result, selecting strain number is that 01 bacterial strain (AS-02) send Chinese typical culture collection center to carry out preservation, and deposit number is: CCTCC NO:M 209215.

To deposit number be the bacterial strain of CCTCC NO:M 209215 and the disclosed bacterial strain 127pBBR128-AS of document performance as seen, this bacterial strain all has suitable raising to the stability of 127pBBR128-AS, anti-arsenic concentration, oxidation capacity.

＜110〉Nanjing University of Technology

＜120〉a kind of genetic engineering bacterium and application thereof that can tolerate high density As (III) again can oxidation As (III)

<160>10

<210>1

<211>2586

<212>DNA

＜213〉native sequences derives from Thermus thermophilus HB8

<220>

＜223〉the big subunit gene order of trivalent arsenic oxidase gene

<400>1

atggcgctca ttccccgtag ggaccggctt cccattccgc ctaagaacgc gaaggtctac 60

aaccaggtct gccagtactg caccgtgggg tgcggctaca aggtctacgt gtggcccgtg 120

ggcgaagaag ggggcgtgaa acccgagcag aacgccttcg gcctggacct ctccacgccc 180

cagccccccc tggccggcca gagctacacg gagaccatgc acgccgttac cgtgggcagg 240

gacgggcggc agtataacgt ggtcatcgtc cccgccaagg acagccccat caaccggggc 300

aactactcca tccggggcgg caccaacgcc ctcaccgttt ggagcctgga ccggggcacc 360

caggaccggc tcacctaccc cctcctcagg gtgggcgacc agttccaggc catcacctgg 420

caggacgccc tcaccctcat gggcctcctc atcaagggca tccgggaccg ggacggcaac 480

gacgacaaca tcgccgtgaa gtgcttcgac cacgggggct cgggccaggg ctttgaggac 540

aactacgccg ccgggaagct cttcttcgcc gccctctccg tgaagcacat cgccatccac 600

aaccgccccg cctacaactc cgaggtctgg ggaagccggg agaggggcgt ccacgagctg 660

aactacacct acgaggacgc ccgcctcgcc gacaccatcg tcctctgggg agcgaactcc 720

tacgagacgg ccacggtgtt ctacgtggag cacatgctcc ccaacatcca gggggccacg 780

gtggcggaga agcagcaggc ctttgacccg ggcgagcccg ccgagcccgg ctacctcatc 840

gtcattgacc ccaggaagac cagctcctac accgtggcgg cccaggtggc cccggaccgg 900

gtgatgctcc tccggcccaa cctgggcacg gactacatcc tggccaacgc catcgcccgg 960

gcggtctggg agaagggcta ctacgacatg gcctacctcc aggcccgcac ggacatgacc 1020

ctctttgagg agtacaaggc gaaaagcctc aagctctccg tgccctacga cgagttcatg 1080

gcccaggcgg agcgcatcac cggggtttcc cgggcggaga ttgagaaggc cgccgactgg 1140

atcgccaagc ccaaggcggg ccggttcaag cgccgcaccc tcaccatcta cgagaagggc 1200

atcatctgga acatgaagaa ctacgaccag gtggcggcca tcgttcagct cgccgtcctc 1260

acccacaaca tcggcaggcc cggcacgggc tgcggccgcc agggcgggca ccaggagggt 1320

tacgtccgcc cccccgcccc cacccccggc tccatctacc ggggcggccc ccccgtcaac 1380

gtggacaagt tcctcattga aggcaagggc aagttctact gggtcatcgc caacgacccc 1440

tacctctcca cccccaacaa ccaggtcttc cgcaagcgca tccacgagcg cacggagaag 1500

ctcaccaagg ccctcggcgc cgggggcgag cccgggacca tacaggagcg ggcccaaaag 1560

atcctggaca tcctctacca ggaccccgac gccctcttcc tggtggtcca ggacatctac 1620

atgaccgaga ccgcccggga cgcccacctc atcctccccg ccgccggctg gggcgaggcc 1680

aacgagacct ccatcaactg caacagccgc ctcctccgcc tctacgagaa gttcatggac 1740

ccgcccgggg aggccaagcc cgactgggag atcttcaagt gggtgggcct gcgcatcgcc 1800

gagctttacc gggccgaggg caagtttgag gaggcgaaga agtttgagtt cggcaagaac 1860

tggaagacgg acgaggacgt cttcctcgcc ggggccgagg agttccggga caacaccgtc 1920

tcggaggagg acgaggcggt cctcgaggcc gagaactaca agggggtcac ctacaagctc 1980

ctgaaggagc tgggccagaa gggcatccag accccggtgc gccgcgaccc caagacgggg 2040

aagcttgtgg gcacggtccg ccgctacacc taccgcttcg gcaccgagga cggcaagttc 2100

aagtggtacg gcaccgacga ctgggagggc taccccgcgg aggtggccaa gtacctggag 2160

cccgggatgg cggagaagta ccccttctgg gtcaccaccg gccgggccca gaccatctgg 2220

cagaccgcct accacgaccg ccaccttccc gaaaaggccc tggcccttcc cctcccctac 2280

gtggaggtga accccgagga cgccaagcgc ctcggcctca agtccgggga cctggtggag 2340

gtctacaacg aggaggggaa cggcaccttc ctcgtctacg tcacggacgc ggtgaagccg 2400

ggcaccctct tcctggtgat gtaccactgg cggggcacct ccaactccct ggtcaccggc 2460

tacaccgacc ccaagaccac catcccctgg tacaagggga cgagggccaa cctccgcaag 2520

gtggccgggg ccatcccctc cgtgcagcag acggcgagct tcttgcagca gaacaagttt 2580

gactaa 2586

<210>2

<211>483

<212>DNA

＜213〉native sequences derives from Thermus thermophilus HB8

<220>

＜223〉trivalent arsenic oxidase gene small ylidene gene sequence

<400>2

atgacgcaga ccatgacccg taggcgtttc gtgcagctca ccgccgcggc caccgccctt 60

ttcaccgcag gcggcaaggc ccagctctgg tacgccccga gcctcaccta tccggcggtg 120

aaggtggcca acctctccca ggtcaagacc ggggagccca tcttcttcaa ctaccccgac 180

gcctcctccc cggccgtcct ggtcaagctc ggccggcccg ccatcggggg ggtggggcgg 240

gagcgggaca tcgtggcctt ctccgccctc tgcacccaca tgggctgccc cgtccagtac 300

gaggagggcc gcttcatctg ccgctgccac tactccatgt ttgaccccgc caaggcgggc 360

cagccctacc agggcctggc cagctcctgg ctcccccaga tccccttgcg cattgacggc 420

aagggcgaca tctacgccgt ggccgtggcg ggcctcatct ggggccgcgt gaagaacgtg 480

tga 483

<210>3

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉upstream primer of the big subunit gene of amplification

<400>3

aggtaaggta tggcgctcat tc 22

<210>4

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉downstream primer of the big subunit gene of amplification

<400>4

ggcttagtca aacttgttct gc 22

<210>5

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉upstream primer of amplification small ylidene gene

<400>5

atatgacgca gaccatgacc cgtag 25

<210>6

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉downstream primer of amplification small ylidene gene

<400>6

ctcctcacac gttcttcacg c 21

<210>7

<211>54

<212>DNA

＜213〉artificial sequence

<220>

＜223〉upstream primer of the big subunit gene of amplified band restriction enzyme site

<400>7

ccttaattaa tgcgaactga caggatgatt tctcatggcg ctcattcccc gtag 54

<210>8

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉downstream primer of the big subunit gene of amplified band restriction enzyme site

<400>8

ggactagttt agtcaaactt gttctgctgc 30

<210>9

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the upstream and downstream primer of amplified band restriction enzyme site small ylidene gene

<400>9

ccggaattca tgacgcagac catgacccgt ag 32

<210>10

<211>36

<212>DNA

＜213〉artificial sequence

<220>

<400>10

cgcggatccc cttaattaat cacacgttct tcacgc 36

Claims

1. pseudomonas putida genetic engineering bacterium, its classification called after pseudomonas putida (Pseudomonasputida) AS-02 has been preserved in Chinese typical culture collection center, and deposit number is: CCTCC NO:M209215.

2. the application of the described pseudomonas putida genetic engineering bacterium of claim 1 in handling arsenic-containing waste water.

3. application according to claim 2, wherein arsenic-containing waste water is for containing the arsenious waste water of 500～800mg/L.