CN102140511A - Methylated marker IL-2RG in systemic lupus erythematosus (SLE) whole blood genome and application thereof - Google Patents

Abstract

The invention discloses a methylated marker IL-2RG in a systemic lupus erythematosus (SLE) whole blood genome and application thereof. The sequence of the marker is shown as SEQ ID NO:1. The methylated marker IL-2RG in the SLE whole blood genome is applied to the preparation of a reagent for diagnosing SLE, in particular to a kit for diagnosing SLE. By detecting the methylation level of the methylated marker IL-2RG, a specific methylation locus with a great meaning and a remarkable difference is counted and taken as a basis for early diagnosis of SLE. By adopting the methylated marker, an accurate, cheap and quick clinical tool for early diagnosis of SLE, the disease activity, the curative effect and the prognostic evaluation is provided.

Description

Methylation markers IL-2RG and application thereof in the systemic lupus erythematous whole blood genome

Technical field

The present invention relates to be used for the whole blood genomic methylation biomarker IL-2RG and the application thereof of systemic lupus erythematous early diagnosis.

Background technology

Systemic lupus erythematous (Systemic Lupus Erythematosus is called for short SLE) is the autoimmune disorder that a kind of many organs, multisystem are got involved.As a kind of autoimmune disorder of typical serious harm human health, its cause of disease and pathogenesis are very complicated, and medical circle is still not fully aware of so far.At present, the diagnosis of SLE mainly relies on clinical manifestation and laboratory examination, and clinical manifestation comprises that laboratory examination mainly contains LBT, antinuclear antibodies spectrum etc. as cheek portion butterfly erythema etc.But when making a definite diagnosis according to clinical manifestation and laboratory examination, the patient is often many, and tract is got involved.Therefore,, find a kind ofly can be used for clinical quick diagnosis instrument if the diagnosis of SLE can be risen to gene level, then can be and intervene as early as possible and play an important role to the early diagnosis of this disease.

The DNA hypomethylation plays an important role in the SLE morbidity, the pathogenesis of having discovered at present LFA 1, pore-forming protein, CD40L and CD70 gene hypomethylation and systemic lupus erythematous that the T cell transition is expressed is closely related, and then has influence on reinventing of chromatin Structure. transcribing of regulatory gene.Yet CD 11a, pore-forming protein, the equal overexpression of CD70 are in SLE patient's CD4+T cell, and all there is hypomethylation in regulating and controlling sequence, and be identical with the T cytogene hypomethylation sequence of handling through 5 one poly-cytidines.Their this species diversity also mainly just is present in the genome of CD4+T cell, and experiment needs to extract 40 to the enough CD4+T cells of 60ml milliliter venous blood separation and Extraction, and then extracts DNA and carry out cloning and sequencing.Whole experiment useless power consuming time, and to extract 60ml peripheral vein blood, patient's compliance is often lower.If can in the whole blood genome, find the biomarker that methylates, will shorten test period greatly, the short form test flow process improves patient's compliance.The contriver filters out IKBKG at last by a large amount of pertinent literatures of reading, IL2RG, RB1, ZAP70, FOS3, a series of and immune gene that close association is arranged such as SH2B3C.Draw the average methylation level of IL-2RG at last, performance has evident difference between normal people and lupus patient, can be used as the biomarker that methylates of the early diagnosis of systemic lupus erythematous.

The contriver studies show that: Whole Blood Genomic DNA specific gene hyper-methylation plays an important role in the pathogenesis of SLE.This hyper-methylation shows in IL2-RG obviously.The specific CpG of IL2-RG site is in the hyper-methylation state in the whole blood genome, and it methylates and changes and pattern is expected to become the SLE early diagnosis sign that has future.

Summary of the invention

The object of the present invention is to provide a kind of SLE of being used for early diagnosis methylate biomarker IL-2RG and amplified fragments thereof.

The further purpose of the present invention is to provide the above-mentioned SLE of the being used for early diagnosis application method of biomarker IL-2RG and amplified fragments thereof that methylates, and especially refers to the application on preparation SLE early diagnosis reagent.

The sequence of methylation markers IL-2RG such as SEQ ID NO:1 (seeing Genebank) in a kind of systemic lupus erythematous whole blood genome.

Methylation markers is applied to prepare the reagent of diagnositc system lupus erythematosus in the described systemic lupus erythematous whole blood genome.

Described marker IL-2RG is used to prepare the test kit of diagnositc system lupus erythematosus.

The sequence such as the SEQ IDNO:2 of methylation markers IL-2RG amplified fragments in a kind of systemic lupus erythematous whole blood genome.

Methylation markers IL-2RG amplified fragments is applied to prepare the reagent of diagnositc system lupus erythematosus in the described systemic lupus erythematous whole blood genome.

Described marker IL-2RG amplified fragments is used to prepare the test kit of diagnositc system lupus erythematosus.

The primer of described IL-2RG amplified fragments of increasing is as follows,

The primer of first round PCR is:

SEQ ID NO:3: upstream 5 '-TGGTTATTAGGATTTTTAGTTATTTAG-3 ';

SEQ ID NO:4: downstream 5 '-TATTCACAATAACCCCTTAAAAAAA-3 ';

Second takes turns the PCR primer is:

SEQ ID NO:5: upstream 5 '-TAGATAATTTTTTGAGGTGTGTGTG-3 ';

SEQ ID NO:6: downstream 5 '-CAATCAACCTAACCCTACTAATACC-3 '.

By detecting the methylation level of the biomarker IL-2RG that methylates of the present invention, count meaningfully, difference is the specific site that methylates comparatively significantly, as the foundation of SLE early diagnosis.

The method that the present invention detects IL2RG methylation level in the sample to be checked comprises step: (1) gets sample blood to be checked, therefrom extracts Whole Blood Genomic DNA, and the DNA that extracting is gone out carries out the sodium bisulfite conversion processing.Carry out the nest-type PRC amplification respectively with the primer that methylates, the PCR product purification is reclaimed.(2) the PCR product is connected with p-GEM T carrier after reclaiming purifying, is cloned into the DH5a competent cell, and recombinant clone is checked order.(3) interpretation of result shows as the site that methylates that is of CG on the sequence, TG then is the non-site that methylates.Calculate average methylation level then.

Described when carrying out nest-type PRC at IL2-RG, the primer of first round PCR is:

The upstream ' 5-TGGTTATTAGGATTTTTAGTTATTTAG-3

Downstream 5-TATTCACAATAACCCCTTAAAAAAA-3

Second takes turns the PCR primer is: upstream 5-TAGATAATTTTTTGAGGTGTGTGTG-3

Downstream 5-CAATCAACCTAACCCTACTAATACC-3

The biomarker that methylates that is used for diagnosing the peripheral blood genome of lupus erythematosus of the present invention: IL-2RG can be widely used in the early diagnosis of lupus erythematosus, to reach the raising diagnosis efficiency, reduces the diagnosis cost, shortens the purpose of Diagnostic Time.

The cloning and sequencing that the method that the present invention is used for detection by quantitative sample lupus erythematosus to be checked genes involved methylation level is handled by means of the integrated sodium bisulfite of lupus erythematosus genes involved, for clinical provide a kind of lupus erythematosus early diagnosis, disease activity and curative effect and prognostic evaluation accurately, cheap, instrument fast.

Description of drawings

Fig. 1 is the electrophorogram of nest-type PRC reaction after product;

Fig. 2 reclaims the after product electrophorogram for nest-type PRC reaction after product purifying;

Fig. 3 is the comparison diagram of each methylate site normal people and the average methylation level of lupus patient that draw at last;

Squarely among the figure represent patient, round dot is represented the normal people; 50 routine patient VS 50 normal peoples;

Fig. 4 is site, No. 13 sites to 20, the comparison diagram of patient's average methylation level and normal people's average methylation level;

Squarely among the figure represent patient, round dot is represented the normal people;

Fig. 5 is a methylation level comparison diagram between normal people and the lupus patient.

Embodiment

1 extracts DNA from the peripheral blood tissue

One. from 1ml whole blood or body fluid, extract the step of DNA:

(1) cracking 1: get the 1ml whole blood, blood plasma, serum, lymphocyte are put in the centrifuge tube of 1.5ml, add 400ul lysate 1.Spin upside down, throw out is disperseed, it is centrifugal that rotary pulse was put into whizzer after 15 seconds, and centrifugation rate is 8000rpm, 1min..Outwell upper strata liquid, the color precipitation is arranged at visible centrifuge tube bottom.Repeating this cleavage step once, is to add 1ml lysate 1 specifically.Discard with transfer pipet all upper strata liquid that exhaust at last, lysate 1 arranged so that the color precipitation of centrifuge tube bottom is no longer residual.

(2) cracking 2: add 1ml lysate 2 in the above in the centrifuge tube.Spin upside down, throw out is disperseed, it is centrifugal that rotary pulse was put into whizzer after 15 seconds, 8000rpm, 1min..Outwell supernatant liquor, micro-incarnadine precipitation is arranged at visible centrifuge tube bottom.Repeat this cleavage step once, remain specifically and add 1ml lysate 2, discard with transfer pipet all supernatant liquors that exhaust at last, lysate 2 arranged so that the pale precipitation of centrifuge tube bottom is no longer residual.

(3) digestion: draw Proteinase K 10ul (=0.2mg) join in the top centrifuge tube, blow and beat repeatedly with the transfer pipet tip, make Proteinase K and throw out uniform contact after, adding 320ul Digestive system,

Under the centrifuge tube that overturns, throw out is scattered in the Digestive system.Put into 58C water-bath digestion 15 minutes.Last visible clear and bright digestive fluid.

(4) purifying: add the 110ul refined solution in the superincumbent digestive fluid, spin upside down centrifuge tube several down after, centrifugal, speed is 15000rpm, and 1min puts into the supernatant liquor sucking-off in the 1.5ml centrifuge tube that the 1000ul dehydrated alcohol is housed, spin upside down gently 10 times, visible cotton-shaped DNA separates out.Provoke cotton-shaped DNA with the glass stick of buckle and put into that fork-like farm tool used in ancient China returns rinsing 20 times in 100ul 70% ethanol, hook goes out DNA, and airing is put into once in the 100ul disperse liquid in air.DNA

Diffusing liquid is stored in 4C, spends the night, and makes it to use after the abundant disperse.Extraction finishes.

As doing the PCR experiment with this DNA immediately, DNA disperse liquid is placed on 58C

In, be incubated 30 minutes, pat centrifugal pipe with finger, use after making the DNA disperse.Extraction finishes

(5) collect: (in the DNA minute quantity, under the situation about can not provoke with the buckle glass stick) solution that cotton-shaped DNA is arranged is poured in the micro-column strainer (comprising filter post and collection tube), filter is put into whizzer, centrifugal: 8000rpm, 1min..DNA just attached in the filter desert, discard filtrate, the filter post is put back on the collection tube.

(6) draw 200ul 70% ethanol in the filter post, centrifugal 8000rpm, 1min discards filtrate.The filter post is put back on the collection tube, and centrifugal again 15000rpm, 1min.. make the DNA that is adsorbed on the filter membrane no longer with ethanol.

(7) reclaim DNA:

Adhere to the filter post of DNA above and put into a clean 1.5ml In the core barrel.Draw the disperse liquid that 100ul has been warming to 58C, put into the surface of filter membrane gently, insulation 58C left standstill 10 minutes.Centrifugal 8000rpm, 1min., DNA disperse liquid is just filtered in the clean 1.5ml centrifuge tube.Be stored in-20 degrees centigrade, be used for the PCR experiment.

The order-checking of 2 sodium bisulfites

2.1DNA sodium bisulfite handle

Employing Qiagen company

The Bisulfite test kit is handled the whole blood genome, and the DNA sample extracts gained from first part's experiment, and operation steps is undertaken by the test kit specification sheets:

1) in buffer B W, adds the 30ml dehydrated alcohol;

2) in buffer B D, add the 30ml dehydrated alcohol;

3) 310ul is not had enzyme water and add among the 310ug carrier RNA, obtain the carrier RNA solution of 1ug/ul;

4) by the carrier RNA solution of 1: 100 volume adding 1ug/ul in the buffer B L, the concentration that makes carrierRNA among the buffer B L is 10ug/ml;

5) how many samples of handling as required dissolves Bisulfite Mix, adds the no enzyme water of 800ul among every pipe Bisulfite Mix, concuss dissolving extremely fully in 5 minutes;

6) in the PCR of 200ul pipe, add successively below each composition, fully shake mixing,

Table 2-1 reaction system

7) the according to the form below condition is carried out the sodium bisulfite conversion in the PCR instrument;

Table 2-2 sodium bisulfite processing reaction condition

8) after reaction finishes that the PCR pipe is briefly centrifugal, all reaction liquids are gone in the clean 1.5ml EP pipe;

9) add 560ul buffer B L (contain 10ug/mlcarrier RNA, saw for the 4th step), the concussion mixing, briefly centrifugal;

10) all liquid with the previous step gained all changes in the centrifugal post of EpiTect spin that has collection tube, and centrifugal 1 minute of 13000rpm outwells waste liquid, and centrifugal post is put back in the collection tube;

11) add 500ul elution buffer BW in centrifugal post, centrifugal 1 minute of 13000rpm outwells waste liquid, and centrifugal post is put back in the collection tube;

12) in centrifugal post, add 500ul buffer B D, incubated at room 15 minutes; Centrifugal 1 minute of 13000rpm outwells waste liquid, and centrifugal post is put back in the collection tube;

13) 13000rpm is centrifugal 1 minute, outwells waste liquid, and centrifugal post is put back in the collection tube

14) add 500ul elution buffer BW in centrifugal post, centrifugal 1 minute of 13000rpm outwells waste liquid, and centrifugal post is put back in the collection tube;

15) repeating step 14 once;

16) centrifuge tube is put into the collection tube of a new 2ml, centrifugal 1 minute of 13000rpm;

17) centrifuge tube is put into the EP pipe of a new 1.5ml, added 20ul damping fluid EB, centrifugal 1 minute eluted dna of 12000rpm, the liquid of gained are the DNA after sublimed sodium bisulfite is handled.

2.2 nest-type PRC

The primer of nest-type PRC is a slot type primer sequence mentioned above, and primer is synthetic by the rich still biological company limited in Shanghai.

The primer of first round PCR is:

The upstream ' 5-TGGTTATTAGGATTTTTAGTTATTTAG-3

Downstream 5-TATTCACAATAACCCCTTAAAAAAA-3

Table 2-3 nest-type PRC first round reaction system

Table 2-4 nest-type PRC first round reaction conditions

Second takes turns the PCR primer is: upstream 5-TAGATAATTTTTTGAGGTGTGTGTG-3

Downstream 5-CAATCAACCTAACCCTACTAATACC-3

Table 2-5 nest-type PRC second is taken turns reaction system

Table 2-6 nest-type PRC second is taken turns reaction conditions

2.3PCR the agarose gel electrophoresis of product

1) preparation electrophoretic buffer (50 * TAE), room temperature preservation; Be diluted to 1 * TAE with deionized water before each the use;

2) take by weighing low melting-point agarose 0.75g, add 1 * TAE 50ml, place microwave oven heating 2 times, each 1min;

3) after gel is cooled to about 50 ℃ at room temperature, add bromine second pyridine 3 μ l, shake up, pour into gel into the sample device, be cooled to fully under the room temperature and solidify (＞60min);

4) pull out comb gently, add 1 * TAE, make liquid level be higher than glue face 1～2mm;

5) go up sample: get 50 μ l PCR products, add each well respectively;

6) electrophoresis: adopt the constant voltage mode, voltage is 135V, and the color indicator electrophoresis stops electrophoresis during to 2/3 place of gel, generally needs 30 minutes approximately;

7) after electrophoresis finishes, place gel imaging system to observe, take pictures and preserve gel, see Fig. 1;

8) cut out the sepharose that contains target DNA under the ultraviolet lamp, exhaust the liquid of gel surface with paper handkerchief.Should notice that excision does not as far as possible contain the gel of purpose band this moment, reduce gel volume as far as possible, improve the DNA rate of recovery.Action is wanted to cause damage in order to avoid DNA is exposed under the ultraviolet ray for a long time rapidly when cutting glue.The gel of gained further reclaims;

2.4PCR the purifying of product reclaims

Adopt the product of the QIAquick Gel Extraction Kit test kit recovery purifying slot type PCR gained of Qiagen company, operation steps is undertaken by the test kit specification sheets, and is specific as follows:

1), presses 100mg=100ul and calculate with the glue of being cut scales/electronic balance weighing;

2) add in the glue of QG damping fluid to 1 volume of 3 times of volumes;

3) 50 ℃ of water-baths are 10 minutes, give in the water-bath process every 2-3 minute concussion EP pipe once, to help the gel dissolving;

4) treat that gel dissolves fully after, add the Virahol of 1 volume, and the concussion mixing;

5) the centrifugal post of QIAquick is placed the collection tube of 2ml, all liquid of previous step is added in the centrifugal post centrifugal 1 minute of 13000rpm;

6) discard waste liquid, centrifugal post is put back in the collection tube;

7) the QG damping fluid of adding 0.5ml in centrifugal post, centrifugal 1 minute of 13000rpm outwells waste liquid, and centrifugal post is put back in the collection tube;

8) the PE damping fluid of adding 0.75ml in centrifugal post, centrifugal 1 minute of 13000rpm;

9) outwell waste liquid, centrifugal post is put back in the collection tube, centrifugal again 1 minute of 13000rpm;

10) centrifugal post is put into clean 1.5mlEP pipe, is added the EB damping fluid of 50ul, leave standstill 1 minute after, centrifugal 1 minute of 13000rpm, gained liquid is the PCR product of purifying; See Fig. 2.

2.5 the preparation of intestinal bacteria (DH5 α) competent cell

E. coli strains prepares competent cell in a large number, as the host of recombinant plasmid transformed.Preparation process notes aseptic technique.Its step is as follows:

1) select single bacterium colony: the JM109 bacterial strain is taken out from-70 ℃ of refrigerators, treat to have slightly thaw after, promptly the transfering loop with the calcination postcooling picks a small amount of bacterium liquid, puts the edge of LB agar plate, is the standardized road of starting point cut with it.With transfering loop calcination sterilization postcooling, by the standardized successive wavy line of first diatom.Draw the 3rd wavy line by the second wavy line again, not with former line juxtaposition.Repeat line,, place 37 ℃ of bacteriological incubator overnight incubation then up to drawing full whole culture dish.

2) get the 50ml volumetrical test tube of sterilization, add 5ml LB liquid nutrient medium, with single bacterium colony of growing on the aseptic tip picking flat board, send in the nutrient solution, seal the mouth of pipe, 37 ℃, 300 commentaries on classics/min joltings are cultured to grows saturatedly, needs 6-12 hour approximately, but incubated overnight.

3) get bacterium liquid 0.4ml and be seeded in the 250ml flask that contains 40ml LB liquid nutrient medium, 37 ℃, 300 rev/mins acutely jolt and cultivated about 2-3 hour, when treating that the A600 value reaches 0.3-0.4 flask are taken out, and place immediately ice bath 10-15 minute.

4) under aseptic condition, bacterium transferred in the ice-cold 50ml centrifuge tube that a sterilising treatment crosses, 4 ℃, centrifugal 10 minutes of 4000g.

5) discard nutrient solution, centrifuge tube is inverted in filter paper last 1 minute, so that the nutrient solution of final residual flows to end.

6) add ice-cold 0.1mol/L CaCl ₂The resuspended thalline of 4ml was put ice bath 30 minutes.

7) 4 ℃, centrifugal 10 minutes of 4000g, supernatant discarded is inverted in filter paper last 1 minute.

8) add the ice-cold 0.1mol/L CaCl of 4ml again ₂The resuspended thalline of 4ml.Operation wants light when resuspended.

9) place 4 ℃ of refrigerator 12-24 hours, promptly can be used for transforming.

10) can not use up as the competent cell of preparing, perhaps can not use at once, can carry out frozen reservation, its method is as follows: competent cell is distributed into the 200ul portion, every part of glycerine that adds 30% volume is preserved liquid, puts-80 ℃ of refrigerators, and cryopreservation can be for June.

2.6 connect

This step adopts promega company

Easy Vector Systems is connected to the T carrier with slot type PCR product, and concrete operation steps is as follows:

1) each component of test kit is briefly centrifugal;

2) add each reactive component, the ligation system is as table 2-11;

Table 2-7 ligation system

3) mixing gently places 4 ℃ to spend the night, and promptly finishes ligation, can be used for next step conversion.

2.7 transform

1) will connect product and place 65 ℃ of 10min of PCR instrument, make abundant dissolving.

2) draw 5ul and connect product and add in the 100ul competent cell, fully beat even, 30min on ice, 42 ℃ of water-baths 90 seconds, test tube, 2min are not on ice shaken in attention.

3) add 800ul LB liquid, 37 ℃, 40min vibrates in the 200rpm shaking table.

4) 6, the centrifugal 10min of 000rpm removes supernatant, stays precipitation, beats and spares, and puts in the LB flat board that is coated with X-gal+IPTG (Amp:100ug/ml, X-gal 40ul, IPTG 4ul).Room temperature is put 30min, absorbs cleanly.Be inverted culture dish, 37 ℃ incubator 12-16 hour.

5) set up contrast simultaneously, be about to unconverted DH5 α and be inoculated on Amp+ (100ug/ml) the LB agar plate; Use empty carrier and DH5 α bacterial strain as positive control and negative control respectively.

2.8 the evaluation of recombinant plasmid and extraction

Screen principle in vain according to indigo plant, smear X-gal and IPTG containing on the LB flat board of penbritin, its Laz gene of carrier that does not insert goal gene can generate a segment, produces a complementary effect and X-gal reaction generation blue colonies thereby lack the pulsating β of a-D galactoside with bacterium.And recombinant chou generates the destroyed thereby generation white colony of the pulsating ability of a because goal gene inserts.The positive bacterium colony of white colony on the Amp+LB agar plate is recombinant clone.Plasmid extracts employing Qiagen company

Miniprep plasmid extraction test kit, concrete operations are as follows:

1) select white colony: with at least 10 clones of aseptic tip picking, grow in 3-4ml and contain in the LB training base of Amp on ware, LB can not be too much, otherwise bacteriolyze is insufficient, and 37 ℃, 300rpm shaking table vibration 12-16 hour.

2) with the bacterium of overnight growth, centrifugal 5 minutes of 4000rpm abandons supernatant, is inverted microbial culture pipe 1min;

3) add the resuspended bacterium of 250ulP1 damping fluid;

4) add the 250ulP2 damping fluid, put upside down mixing 4-6 time;

5) add the 350ulN3 damping fluid, put upside down mixing 4-6 time;

6) 13000rpm is centrifugal 10 minutes;

7) supernatant is transferred in the centrifugal post of the QIAprep that has the 2ml collection tube;

8) the centrifugal 30-60 of 13000rpm second, abandon waste liquid, centrifugal post is put back in the collection tube;

9) in centrifugal post, add the 0.5mlPB damping fluid, the centrifugal 30-60 of 13000rpm second abandon waste liquid, centrifugal post is put back in the collection tube;

10) in centrifugal post, add the 0.75mlPE damping fluid, the centrifugal 30-60 of 13000rpm second;

11) abandon waste liquid, centrifugal post is put back in the collection tube, the more centrifugal 30-60 of 13000rpm second;

12) centrifugal post is put into a clean 1.5mlEP pipe, added the 50ulEB damping fluid, left standstill 1 minute, centrifugal 1 minute of 13000rpm, the gained elutriant is plasmid;

13) plasmid DNA that obtains uv-spectrophotometric instrument detectable level and purity.

2.9 the evaluation of plasmid and order-checking

The plasmid of gained identifies that by the method for PCR the PCR primers designed adopts nido second to take turns primer, the reaction conditions that reaction conditions is taken turns with nido second, reaction system such as table 2.12; Added the rearmounted 37 ℃ of water-baths of reaction system 3 hours, electrophoresis on 1.5% sepharose then, voltage 135Vm, 45min, ultraviolet lamp is observed down.Will be after identifying positive clone draws the 10ul plasmid in the PCR pipe, send order-checking.

Table 2-8PCR identifies amplification system

Condition is taken turns PCR with nido second.

3.0 sequencing result statistical study

Be down the extension increasing sequence of IL-2RG, one has 27 sites that methylate.Plus sige represent methylidene as follows site.

2451 TCAGACAACTTTCTGAGGTGTGTGTGGAGGAGGGCGCCTCTGGTGCGGCCCCTACACCA

|:|||:||:|||:|||||||||||||||||||||++::|:|||||++|::::||:|::|

2451 TTAGATAATTTTTTGAGGTGTGTGTGGAGGAGGGCGTTTTTGGTGCGGTTTTTATATTA

2510 CCCCCTATTCATACCTTGGAACCCCCCACCGCCCCCCGTCCTGCCCTCCCACGCCAGCCC

:::::||||:|||::||||||::::::|:++:::::++|::||:::|:::|++::||:::

2510 TTTTTTATTTATATTTTGGAATTTTTTATCGTTTTTCGTTTTGTTTTTTTACGTTAGTTT

2570 ACTTTACTCTTCCCCCTTTCGGGACTTTTGCTCTCACCGAACCGCCCCGCCCCCCATTC

|:||||:|:||:::::|||++|||:|||||:|:|:|:++||:++:::++::::::|||:

2570 ATTTTATTTTTTTTTTTTTCGGGATTTTTGTTTTTATCGAATCGTTTCGTTTTTTATTT

2630 CCAGCCGTCAGTGCCTCCTCCTAGGCTGACCGCGTGCCCCCGGCCCCTCCAGAGCCCCGAT

::||:++|:||||?::|::|::||||:|||:++++||::::++|::::|::||||:::++|

2630 TTAGTCGTTAGTGTTTTTTTTTAGGTTGATCGCGTGTTTTCGGTTTTTTTAGAGTTTCGAT

2690 TTTCGAACGCACCTCCTTCTGTTTGGGGTCCTGAGGGTAAACATCGGGAGGCCCCAGCC

||||++||++:|::|::||:|||||||||::||||||||||:||++|||||::::||:+

2690 TTTCGAACGTATTTTTTTTTGTTTGGGGTTTTGAGGGTAAATATCGGGAGGTTTTAGTC

2750 GCGGCCGCTTCAGGGGCCGGTGTTCGTAGCTCAAGATCCCGAAGGCCGCCATCTTGCCC

+++|:++:||:|||||:++|||||++|||:|:|||||::++||||:++::||:|||:::

2750 GCGGTCGTTTTAGGGGTCGGTGTTCGTAGTTTAAGATTTCGAAGGTCGTTATTTTGTTT

2810 AGCCCGTAGCGCCGGAGGCACCAGCAGGGCCAGGCTGACTG

||::++|||++:++||||:|::||:||||::|||:|||:||

2810 AGTTCGTAGCGTCGGAGGTATTAGTAGGGTTAGGTTGATTG

Because IL-2RG checks order from the M13F direction, thereby can exist a lot of tumor-necrosis factor glycoproteinss to cause peak figure disorder, therefore all be that the requirement order-checking SP16 of company direction checks order.

Use experimental technique normal people mentioned above and patient and respectively done 50 examples, and each picking 10 clones, methylated site is that little point that sequencing result shows as CG is represented with 1, the non-site that methylates is that little point that sequencing result shows as CA is 0, draw each potential in each routine sample at last and methylate the average methylation level in site (27 altogether) (owing to be periphery whole blood tissue, comprise various cells, neutrophil leucocyte, eosinophilic granulocyte, basophilic granulocyte, lymphocyte etc., and what work in the pathogenesis of lupus erythematosus mainly is lymphocyte, so after carrying out interpretation of result, can find the general hyper-methylation of some sample, the general hypomethylation of some sample.In order to make the gained data more genuine and believable, so normal people and patient have respectively done 50 examples, and 10 clones have respectively been chosen, to guarantee to obtain whole blood genome IL-2R.Fig. 3 is the comparison diagram of each methylate site normal people and the average methylation level of lupus patient that draw at last.

With above-mentioned data, draw following result at last with statistics software 16.0 independent sample T check.P=0.642 does not have statistical significance.

Group?Statistics

Independent?Samples?Test

Site, No. 13 sites to 20 as can be seen from Figure 4, patient's average methylation level is higher than normal people's average methylation level always, therefore considers these several sites are taken out, separately relatively.Comparative result is as follows, and P=0.014 has statistical significance.

Group?Statistics

Independent?Samples?Test

By winning comparatively significantly site of part methyl level difference, analyze relatively by SPSSl6.0, P has statistical significance less than 0.05.Therefore can pass through the relatively methylation level in the part site of IL-2RG, illustrate that the methylation level of IL-2RG shows variant between normal people and Patients with SLE.

More than the description of the embodiment of the invention is not limited the present invention, those skilled in the art make various accommodations according to the present invention all should belong to scope under the appended claim of the present invention.

Claims (7)

1. methylation markers IL-2RG in the systemic lupus erythematous whole blood genome is characterized in that the sequence of described IL-2RG such as SEQ ID NO:1.

2. methylation markers is applied to prepare the reagent of diagnositc system lupus erythematosus in the described systemic lupus erythematous whole blood of claim 1 genome.

3. the application method of methylation markers IL-2RG is characterized in that described marker IL-2RG is used to prepare the test kit of diagnositc system lupus erythematosus in the systemic lupus erythematous whole blood genome according to claim 2.

4. methylation markers IL-2RG amplified fragments in the systemic lupus erythematous whole blood genome is characterized in that the sequence of described IL-2RG amplified fragments such as SEQ ID NO:2.

5. methylation markers IL-2RG amplified fragments is applied to prepare the reagent of diagnositc system lupus erythematosus in the described systemic lupus erythematous whole blood of claim 4 genome.

6. the application method of methylation markers IL-2RG amplified fragments is characterized in that in the systemic lupus erythematous whole blood genome according to claim 5, and described marker IL-2RG amplified fragments is used to prepare the test kit of diagnositc system lupus erythematosus.

7. the primer of the described IL-2RG amplified fragments of amplification claim 4 is characterized in that,

The primer of first round PCR is:

SEQ ID NO:3: upstream 5 '-TGGTTATTAGGATTTTTAGTTATTTAG-3 ';

SEQ ID NO:4: downstream 5 '-TATTCACAATAACCCCTTAAAAAAA-3 ';

Second takes turns the PCR primer is:

SEQ ID NO:5: upstream 5 '-TAGATAATTTTTTGAGGTGTGTGTG-3 ';

SEQ ID NO:6: downstream 5 '-CAATCAACCTAACCCTACTAATACC-3 '.

Images