CN111273026B - Novel rapid detection test strip for coronavirus and application thereof - Google Patents
Novel rapid detection test strip for coronavirus and application thereof Download PDFInfo
- Publication number
- CN111273026B CN111273026B CN202010107401.2A CN202010107401A CN111273026B CN 111273026 B CN111273026 B CN 111273026B CN 202010107401 A CN202010107401 A CN 202010107401A CN 111273026 B CN111273026 B CN 111273026B
- Authority
- CN
- China
- Prior art keywords
- coronavirus
- novel
- virus
- test strip
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/08—RNA viruses
- G01N2333/165—Coronaviridae, e.g. avian infectious bronchitis virus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a novel rapid detection test strip for coronavirus and application thereof, belonging to the field of biotechnology detection. Specifically, the novel coronapneumovirus is combined with an immobilized N95-like membrane with ACE2 receptor activity to form an ACE2 receptor and virus immobilized conjugate, and a specific probe complementary to a viral RNA sequence is added to form a three-molecule compound of the ACE2 receptor-virus-probe, and a chromogenic reagent is marked on the probe, so that the virus is positive when chromogenic, and the virus is negative when chromogenic is not performed. The invention has the characteristics of simplicity, rapidness, no need of blood drawing, realization of home or field detection, specificity and sensitivity, no need of auxiliary reagents and instruments, naked eye observation of results and the like, and becomes the fastest and simple novel coronavirus detection technology at present.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a novel rapid detection test strip for coronavirus and application thereof.
Background
The novel coronapneumovirus coronavirus is a non-segmented single-stranded positive-strand RNA virus belonging to the order nidoviridae (Nidovirales) Coronaviridae (Coronaviridae) subfamily (Orthosporavirinae) which is divided into four genera α, β, γ and δ according to serotype and genomic characteristics. There are 6 coronaviruses known to infect humans, including 229E and NL63 for the alpha genus, OC43 and HKU1 for the beta genus, middle east respiratory syndrome associated coronavirus (MERSr-CoV) and severe acute respiratory syndrome associated coronavirus (SARSr-CoV). The coronavirus separated from the lower respiratory tract of the patients with the pneumonia caused by the unknown cause in the Wuhan city at this time is a novel coronavirus belonging to the genus beta.
Coronaviruses are enveloped and the particles are round or oval, often polymorphic, and 50-200 nm in diameter. The S protein is located on the surface of the virus to form a rod-shaped structure, and is one of main antigen proteins of the virus, and is a main gene for typing. The N protein encapsulates the viral genome and can be used as a diagnostic antigen. The recognition of the physicochemical properties of coronaviruses has come from studies on SARS-CoV and MERS-CoV. The virus can be transmitted by air spray and other ways, has high pathogenicity and can cause death, and no effective therapeutic medicine exists at present, mainly by means of early diagnosis and symptomatic treatment. The clinical findings show that the patient has no obvious symptoms or fever at early stage, but the patient has extremely strong transmission force at this time, so that a novel early diagnosis method of coronapneumovirus appears.
The novel early diagnosis method of coronavirus is more, mainly relates to the fields of serology and molecular biology, and is more commonly used with methods such as RT-PCR nucleic acid molecule detection, serum IgM antibody ELISA detection and the like, but the methods have certain defects:
the RT-PCR nucleic acid molecule detection is the method with highest sensitivity in the novel early detection method of coronavirus, and the infection condition is judged by detecting the throat swab virus of a patient, so that professional technicians and an expensive fluorescence PCR amplification instrument are required, and the diagnostic method is difficult to develop in basic medical departments. In addition, when the pharyngeal cells of the patient are collected, the patient discomfort is easy to cause the occurrence of retching or vomiting, the difficulty is increased for the work of medical staff, and the risk of virus pollution of the sampling room is also easy to increase. Finally, the novel coronavirus mainly has high false negatives in the lower respiratory tract, and even reports that 7 times of throat swab nucleic acid detection are negative and the 8 th time of throat cell collection is positive.
The ELISA detection of the serology IgM/IgG antibody mainly detects novel coronavirus IgM antibody in serum to know the recent infection of a patient, but blood drawing is needed to be completed, igM/IgG generally appears after 2 weeks of infection, which is unfavorable for early diagnosis and brings a certain difficulty to the operation of clinical medical staff.
Disclosure of Invention
The first object of the invention is to provide a novel rapid detection test strip for coronavirus, which is used for realizing the on-site rapid detection of the novel coronavirus.
The second object of the invention is to provide an application of the novel rapid detection test strip for coronavirus in rapid detection of coronavirus, which has the characteristics of simplicity, rapidness, no need of blood drawing, capability of realizing home or on-site detection, specificity and sensitivity, no need of auxiliary reagents and instruments, naked eye observation results and the like.
In order to achieve the above object, the present invention adopts the following technical scheme:
a novel rapid coronavirus detection test strip, comprising: a solid-phase binding membrane, a specific probe for detecting novel coronavirus and a buffer solution;
the solid-phase binding membrane is a melt-blown polypropylene membrane, and ACE2 receptor protein is loaded on the melt-blown polypropylene membrane.
Further, the specific probe sequence for detecting the novel coronavirus is a fluorescent probe for detecting the ORF1ab gene of the novel coronavirus or a fluorescent probe for detecting the N gene of the novel coronavirus.
Further, the sequence of the fluorescent probe for detecting the ORF1ab gene of the novel coronapneumovirus is as follows:
5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'。
further, the sequence of the fluorescent probe for detecting the N gene of the novel coronapneumovirus is as follows:
5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'。
further, the buffer consists of pH7.0-9.2 mM Tris-HCl buffer, 10-20mM Mg 2+ 300-500mM KCl.
Further, the detection test strip also comprises a lysis flushing fluid, wherein the lysis flushing fluid consists of a Tris-HCl buffer solution with the pH of 7.5-8.3-80 mM, naCl with the concentration of 100-200mM, sodium deoxycholate with the concentration of 0.1% and NP-40 with the concentration of 1%.
The application of the detection test strip in the novel rapid detection of coronavirus.
Further, the application is that the detection test strip is put into a sample to be detected, the novel coronavirus in the sample to be detected is combined with a solid-phase binding membrane loaded with ACE2 receptor protein to form an ACE2 receptor and virus solid-phase conjugate, then a specific probe for detecting the novel coronavirus is added to form a three-molecule compound of the ACE2 receptor-virus-probe, and the rapid detection of the novel coronavirus can be realized through a chromogenic group carried by the probe.
Further, after the formation of the immobilized conjugate of ACE2 receptor and virus, the immobilized conjugate is washed with a lysis washing solution, and then a specific probe for detecting novel coronapneumovirus is added to form a three-molecule complex of ACE2 receptor-virus-probe.
The beneficial effects are that:
the invention uses a brand new detection technology, the novel coronapneumovirus is combined through the immobilized N95-like membrane with ACE2 receptor activity, viruses blocked on the membrane can be captured by ACE2 receptor to form ACE2 receptor and virus immobilized conjugate, the immobilized membrane is washed by a cleavage washing liquid drop to promote exposure of virus RNA, a chromogenic group or biological enzyme is marked on the probe through adding a specific probe with the complementary virus RNA sequence to form a three-molecule compound of ACE2 receptor-virus-probe, the immobilized membrane is washed by a buffer liquid drop to remove the probe with non-specific binding, and finally, a certain device is used for directly detecting chromogenic or enzymatic substrate chromogenic, developing or chromogenic, namely, virus positive, and non-chromogenic is the virus negative. The method has the characteristics of simplicity, rapidness, no need of blood drawing, realization of home or field detection, specificity and sensitivity, no need of auxiliary reagents and instruments, naked eye observation results and the like, becomes the fastest and simple novel coronavirus detection technology at present, and is particularly suitable for time-critical examination and large-area census in hospitals, basic units, home and field operations.
Detailed Description
The invention discloses a brand new detection technology, novel coronapneumovirus is combined through an ACE2 receptor active solid-phase melt-blown polypropylene film (N95-like film), viruses blocked on the film can be captured by ACE2 receptors to form ACE2 receptors and virus solid-phase conjugates, a splitting flushing liquid (A reagent) is used for dropwise washing the solid-phase films to promote exposure of virus RNA, a chromogenic group or biological enzyme is marked on the probes through adding a virus RNA sequence complementary specific probe (B reagent), a three-molecule compound of ACE2 receptors-viruses-probes is formed, buffer solution (C reagent) is used for dropwise washing the solid-phase films to remove non-specific binding probes, and finally a certain device is used for directly detecting chromogenic or enzyme substrate chromogenic, developing or chromogenic, namely virus positive, and non-chromogenic is a virus negative method.
Firstly, the invention designs a solid-phase melt-blown polypropylene membrane (N95-like membrane) with ACE2 receptor activity, viruses can be blocked on the membrane, clean air can be filtered, viruses blocked on the membrane can be captured by ACE2 receptors to form an ACE2 receptor and virus solid-phase conjugate, and the solid-phase membrane is washed by adopting a cleavage washing liquid drop to promote exposure of virus RNA.
The melt-blown polypropylene film (similar to N95 film) can intercept viruses, is transparent or semitransparent, can coat solid-phase ACE 2-loaded proteins, keeps the activity of receptor proteins, and has the characteristic of proving that the combined viruses cannot penetrate through a result observation surface. Meanwhile, the melt-blown polypropylene film has semi-permeability, so that the buffer solution can permeate the film and a certain liquid flow speed can be maintained.
Active ACE2 protein preparation: according to the characteristic of protein activity, a polypropylene film (N95-like film) is melt-blown to be beneficial to maintaining the protein activity.
The lysis flushing liquid consists of pH 7.5-8.3-80 mM Tris-HCl buffer solution, 100-200mM NaCl, 0.1% sodium deoxycholate and 1% NP-40. The lysate employed may facilitate partial exposure of the viral RNA without disrupting the ACE2 receptor and viral immobilization conjugate that has formed.
Secondly, according to the virus RNA specific probe in the existing fluorescent quantitative PCR detection method, the sequence with highest specificity is screened, and the combination rate and the detection rate can be increased by adopting a multiple sequence probe.
Aiming at open reading frame 1a/b (open reading frame 1ab, ORF1 ab) and nucleocapsid protein (nucleocapsid protein, N) in the novel coronavirus genome, the primers and probes of the ORF1ab gene region and the N gene region of the novel coronavirus with highest specificity are obtained by combining the existing fluorescence quantitative PCR detection method.
The novel coronavirus gene sequence is shown as SEQ ID NO. 1.
The primers and probes for the ORF1ab and N gene regions of the novel coronapneumovirus are shown below:
target one (ORF 1 ab):
forward primer (F): CCCTGTGGGTTTTACACTTAA (SEQ ID NO. 2)
Reverse primer (R): ACGATTGTGCATCAGCTGA (SEQ ID NO. 3)
Fluorescent probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3' (SEQ ID NO. 4)
Target two (N):
forward primer (F): GGGGAACTTCTCCTGCTAGAAT (SEQ ID NO. 5)
Reverse primer (R): CAGACATTTTGCTCTCAAGCTG (SEQ ID NO. 6)
Fluorescent probe (P): 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3' (SEQ ID NO. 7).
The probes are specifically complementary to viral RNA sequences and further bind to ACE2 receptor and viral immobilization conjugates to form an ACE2 receptor-viral-probe trimolecular complex. Because the probes are marked with chromogenic groups or biological enzymes, the three-molecule complex can directly detect chromogenic or enzyme substrate chromogenic through certain devices, thereby realizing novel biological detection of coronapneumovirus.
Finally, in order to avoid interference of non-specific binding probes, after forming a three-molecule complex of ACE2 receptor-virus-probes, melt-blown polypropylene film (N95-like film) was washed with buffer droplets to remove the non-specific binding probes, and then color development judgment was performed.
The buffer solution consists of 100mM Tris-HCl buffer solution with pH of 7.0-9.2 and 10-20mM Mg 2+ 300-500mM KCl.
The test strip can be of a crown structure, and keeps an internal sealing state during detection, and the N95-like film is a semi-permeable characteristic, so that the washing liquid can permeate the film and keep a certain liquid flow speed.
The following examples further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention. The experimental procedures and reagents not shown in the formulation of the examples were all in accordance with the conventional conditions in the art.
Example 1
First, with an ACE2 receptor active immobilized melt blown polypropylene membrane (N95-like membrane), viruses can be blocked on the membrane, clean air can be filtered, and viruses blocked on the membrane can be captured by ACE2 receptors to form an ACE2 receptor and virus immobilized conjugate.
Thereafter, the immobilized membrane is rinsed dropwise with lysis rinse (reagent A) to facilitate viral RNA exposure.
Then, a specific probe (reagent B) with complementary viral RNA sequences is added, and a chromogenic group or a biological enzyme is marked on the probe to form an ACE2 receptor-virus-probe three-molecule complex.
Finally, the immobilized membrane is washed dropwise with buffer (reagent C) to remove non-specifically bound probes.
The detection device is used for directly detecting and developing or adding enzyme substrate to develop, developing or developing is positive to the virus, and the non-developing is negative to the virus, so that the result can be directly judged through positive control and negative control lines.
The novel rapid detection test strip method for coronavirus of the invention is adopted to compare with a fluorescence PCR method.
100 parts of simulation samples are selected, and are respectively tested by the novel rapid coronavirus detection test strip method and the fluorescence PCR method, and the results are shown in the following table:
as can be seen from the table, the novel rapid detection test strip method for coronavirus has the characteristics of simplicity, rapidness, no need of blood drawing, capability of realizing home or field detection, specificity and sensitivity, no need of auxiliary reagents and instruments, naked eye observation results and the like, becomes the most rapid and simple novel detection technology for coronavirus at present, and is particularly suitable for hospitals, basic units, home and field operations and time-critical examination and large-area screening.
Sequence listing
<110> tin-free City people Hospital
<120> novel rapid detection test strip for coronavirus and application thereof
<130> 20200220
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29903
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct 60
gttctctaaa cgaactttaa aatctgtgtg gctgtcactc ggctgcatgc ttagtgcact 120
cacgcagtat aattaataac taattactgt cgttgacagg acacgagtaa ctcgtctatc 180
ttctgcaggc tgcttacggt ttcgtccgtg ttgcagccga tcatcagcac atctaggttt 240
cgtccgggtg tgaccgaaag gtaagatgga gagccttgtc cctggtttca acgagaaaac 300
acacgtccaa ctcagtttgc ctgttttaca ggttcgcgac gtgctcgtac gtggctttgg 360
agactccgtg gaggaggtct tatcagaggc acgtcaacat cttaaagatg gcacttgtgg 420
cttagtagaa gttgaaaaag gcgttttgcc tcaacttgaa cagccctatg tgttcatcaa 480
acgttcggat gctcgaactg cacctcatgg tcatgttatg gttgagctgg tagcagaact 540
cgaaggcatt cagtacggtc gtagtggtga gacacttggt gtccttgtcc ctcatgtggg 600
cgaaatacca gtggcttacc gcaaggttct tcttcgtaag aacggtaata aaggagctgg 660
tggccatagt tacggcgccg atctaaagtc atttgactta ggcgacgagc ttggcactga 720
tccttatgaa gattttcaag aaaactggaa cactaaacat agcagtggtg ttacccgtga 780
actcatgcgt gagcttaacg gaggggcata cactcgctat gtcgataaca acttctgtgg 840
ccctgatggc taccctcttg agtgcattaa agaccttcta gcacgtgctg gtaaagcttc 900
atgcactttg tccgaacaac tggactttat tgacactaag aggggtgtat actgctgccg 960
tgaacatgag catgaaattg cttggtacac ggaacgttct gaaaagagct atgaattgca 1020
gacacctttt gaaattaaat tggcaaagaa atttgacacc ttcaatgggg aatgtccaaa 1080
ttttgtattt cccttaaatt ccataatcaa gactattcaa ccaagggttg aaaagaaaaa 1140
gcttgatggc tttatgggta gaattcgatc tgtctatcca gttgcgtcac caaatgaatg 1200
caaccaaatg tgcctttcaa ctctcatgaa gtgtgatcat tgtggtgaaa cttcatggca 1260
gacgggcgat tttgttaaag ccacttgcga attttgtggc actgagaatt tgactaaaga 1320
aggtgccact acttgtggtt acttacccca aaatgctgtt gttaaaattt attgtccagc 1380
atgtcacaat tcagaagtag gacctgagca tagtcttgcc gaataccata atgaatctgg 1440
cttgaaaacc attcttcgta agggtggtcg cactattgcc tttggaggct gtgtgttctc 1500
ttatgttggt tgccataaca agtgtgccta ttgggttcca cgtgctagcg ctaacatagg 1560
ttgtaaccat acaggtgttg ttggagaagg ttccgaaggt cttaatgaca accttcttga 1620
aatactccaa aaagagaaag tcaacatcaa tattgttggt gactttaaac ttaatgaaga 1680
gatcgccatt attttggcat ctttttctgc ttccacaagt gcttttgtgg aaactgtgaa 1740
aggtttggat tataaagcat tcaaacaaat tgttgaatcc tgtggtaatt ttaaagttac 1800
aaaaggaaaa gctaaaaaag gtgcctggaa tattggtgaa cagaaatcaa tactgagtcc 1860
tctttatgca tttgcatcag aggctgctcg tgttgtacga tcaattttct cccgcactct 1920
tgaaactgct caaaattctg tgcgtgtttt acagaaggcc gctataacaa tactagatgg 1980
aatttcacag tattcactga gactcattga tgctatgatg ttcacatctg atttggctac 2040
taacaatcta gttgtaatgg cctacattac aggtggtgtt gttcagttga cttcgcagtg 2100
gctaactaac atctttggca ctgtttatga aaaactcaaa cccgtccttg attggcttga 2160
agagaagttt aaggaaggtg tagagtttct tagagacggt tgggaaattg ttaaatttat 2220
ctcaacctgt gcttgtgaaa ttgtcggtgg acaaattgtc acctgtgcaa aggaaattaa 2280
ggagagtgtt cagacattct ttaagcttgt aaataaattt ttggctttgt gtgctgactc 2340
tatcattatt ggtggagcta aacttaaagc cttgaattta ggtgaaacat ttgtcacgca 2400
ctcaaaggga ttgtacagaa agtgtgttaa atccagagaa gaaactggcc tactcatgcc 2460
tctaaaagcc ccaaaagaaa ttatcttctt agagggagaa acacttccca cagaagtgtt 2520
aacagaggaa gttgtcttga aaactggtga tttacaacca ttagaacaac ctactagtga 2580
agctgttgaa gctccattgg ttggtacacc agtttgtatt aacgggctta tgttgctcga 2640
aatcaaagac acagaaaagt actgtgccct tgcacctaat atgatggtaa caaacaatac 2700
cttcacactc aaaggcggtg caccaacaaa ggttactttt ggtgatgaca ctgtgataga 2760
agtgcaaggt tacaagagtg tgaatatcac ttttgaactt gatgaaagga ttgataaagt 2820
acttaatgag aagtgctctg cctatacagt tgaactcggt acagaagtaa atgagttcgc 2880
ctgtgttgtg gcagatgctg tcataaaaac tttgcaacca gtatctgaat tacttacacc 2940
actgggcatt gatttagatg agtggagtat ggctacatac tacttatttg atgagtctgg 3000
tgagtttaaa ttggcttcac atatgtattg ttctttctac cctccagatg aggatgaaga 3060
agaaggtgat tgtgaagaag aagagtttga gccatcaact caatatgagt atggtactga 3120
agatgattac caaggtaaac ctttggaatt tggtgccact tctgctgctc ttcaacctga 3180
agaagagcaa gaagaagatt ggttagatga tgatagtcaa caaactgttg gtcaacaaga 3240
cggcagtgag gacaatcaga caactactat tcaaacaatt gttgaggttc aacctcaatt 3300
agagatggaa cttacaccag ttgttcagac tattgaagtg aatagtttta gtggttattt 3360
aaaacttact gacaatgtat acattaaaaa tgcagacatt gtggaagaag ctaaaaaggt 3420
aaaaccaaca gtggttgtta atgcagccaa tgtttacctt aaacatggag gaggtgttgc 3480
aggagcctta aataaggcta ctaacaatgc catgcaagtt gaatctgatg attacatagc 3540
tactaatgga ccacttaaag tgggtggtag ttgtgtttta agcggacaca atcttgctaa 3600
acactgtctt catgttgtcg gcccaaatgt taacaaaggt gaagacattc aacttcttaa 3660
gagtgcttat gaaaatttta atcagcacga agttctactt gcaccattat tatcagctgg 3720
tatttttggt gctgacccta tacattcttt aagagtttgt gtagatactg ttcgcacaaa 3780
tgtctactta gctgtctttg ataaaaatct ctatgacaaa cttgtttcaa gctttttgga 3840
aatgaagagt gaaaagcaag ttgaacaaaa gatcgctgag attcctaaag aggaagttaa 3900
gccatttata actgaaagta aaccttcagt tgaacagaga aaacaagatg ataagaaaat 3960
caaagcttgt gttgaagaag ttacaacaac tctggaagaa actaagttcc tcacagaaaa 4020
cttgttactt tatattgaca ttaatggcaa tcttcatcca gattctgcca ctcttgttag 4080
tgacattgac atcactttct taaagaaaga tgctccatat atagtgggtg atgttgttca 4140
agagggtgtt ttaactgctg tggttatacc tactaaaaag gctggtggca ctactgaaat 4200
gctagcgaaa gctttgagaa aagtgccaac agacaattat ataaccactt acccgggtca 4260
gggtttaaat ggttacactg tagaggaggc aaagacagtg cttaaaaagt gtaaaagtgc 4320
cttttacatt ctaccatcta ttatctctaa tgagaagcaa gaaattcttg gaactgtttc 4380
ttggaatttg cgagaaatgc ttgcacatgc agaagaaaca cgcaaattaa tgcctgtctg 4440
tgtggaaact aaagccatag tttcaactat acagcgtaaa tataagggta ttaaaataca 4500
agagggtgtg gttgattatg gtgctagatt ttacttttac accagtaaaa caactgtagc 4560
gtcacttatc aacacactta acgatctaaa tgaaactctt gttacaatgc cacttggcta 4620
tgtaacacat ggcttaaatt tggaagaagc tgctcggtat atgagatctc tcaaagtgcc 4680
agctacagtt tctgtttctt cacctgatgc tgttacagcg tataatggtt atcttacttc 4740
ttcttctaaa acacctgaag aacattttat tgaaaccatc tcacttgctg gttcctataa 4800
agattggtcc tattctggac aatctacaca actaggtata gaatttctta agagaggtga 4860
taaaagtgta tattacacta gtaatcctac cacattccac ctagatggtg aagttatcac 4920
ctttgacaat cttaagacac ttctttcttt gagagaagtg aggactatta aggtgtttac 4980
aacagtagac aacattaacc tccacacgca agttgtggac atgtcaatga catatggaca 5040
acagtttggt ccaacttatt tggatggagc tgatgttact aaaataaaac ctcataattc 5100
acatgaaggt aaaacatttt atgttttacc taatgatgac actctacgtg ttgaggcttt 5160
tgagtactac cacacaactg atcctagttt tctgggtagg tacatgtcag cattaaatca 5220
cactaaaaag tggaaatacc cacaagttaa tggtttaact tctattaaat gggcagataa 5280
caactgttat cttgccactg cattgttaac actccaacaa atagagttga agtttaatcc 5340
acctgctcta caagatgctt attacagagc aagggctggt gaagctgcta acttttgtgc 5400
acttatctta gcctactgta ataagacagt aggtgagtta ggtgatgtta gagaaacaat 5460
gagttacttg tttcaacatg ccaatttaga ttcttgcaaa agagtcttga acgtggtgtg 5520
taaaacttgt ggacaacagc agacaaccct taagggtgta gaagctgtta tgtacatggg 5580
cacactttct tatgaacaat ttaagaaagg tgttcagata ccttgtacgt gtggtaaaca 5640
agctacaaaa tatctagtac aacaggagtc accttttgtt atgatgtcag caccacctgc 5700
tcagtatgaa cttaagcatg gtacatttac ttgtgctagt gagtacactg gtaattacca 5760
gtgtggtcac tataaacata taacttctaa agaaactttg tattgcatag acggtgcttt 5820
acttacaaag tcctcagaat acaaaggtcc tattacggat gttttctaca aagaaaacag 5880
ttacacaaca accataaaac cagttactta taaattggat ggtgttgttt gtacagaaat 5940
tgaccctaag ttggacaatt attataagaa agacaattct tatttcacag agcaaccaat 6000
tgatcttgta ccaaaccaac catatccaaa cgcaagcttc gataatttta agtttgtatg 6060
tgataatatc aaatttgctg atgatttaaa ccagttaact ggttataaga aacctgcttc 6120
aagagagctt aaagttacat ttttccctga cttaaatggt gatgtggtgg ctattgatta 6180
taaacactac acaccctctt ttaagaaagg agctaaattg ttacataaac ctattgtttg 6240
gcatgttaac aatgcaacta ataaagccac gtataaacca aatacctggt gtatacgttg 6300
tctttggagc acaaaaccag ttgaaacatc aaattcgttt gatgtactga agtcagagga 6360
cgcgcaggga atggataatc ttgcctgcga agatctaaaa ccagtctctg aagaagtagt 6420
ggaaaatcct accatacaga aagacgttct tgagtgtaat gtgaaaacta ccgaagttgt 6480
aggagacatt atacttaaac cagcaaataa tagtttaaaa attacagaag aggttggcca 6540
cacagatcta atggctgctt atgtagacaa ttctagtctt actattaaga aacctaatga 6600
attatctaga gtattaggtt tgaaaaccct tgctactcat ggtttagctg ctgttaatag 6660
tgtcccttgg gatactatag ctaattatgc taagcctttt cttaacaaag ttgttagtac 6720
aactactaac atagttacac ggtgtttaaa ccgtgtttgt actaattata tgccttattt 6780
ctttacttta ttgctacaat tgtgtacttt tactagaagt acaaattcta gaattaaagc 6840
atctatgccg actactatag caaagaatac tgttaagagt gtcggtaaat tttgtctaga 6900
ggcttcattt aattatttga agtcacctaa tttttctaaa ctgataaata ttataatttg 6960
gtttttacta ttaagtgttt gcctaggttc tttaatctac tcaaccgctg ctttaggtgt 7020
tttaatgtct aatttaggca tgccttctta ctgtactggt tacagagaag gctatttgaa 7080
ctctactaat gtcactattg caacctactg tactggttct ataccttgta gtgtttgtct 7140
tagtggttta gattctttag acacctatcc ttctttagaa actatacaaa ttaccatttc 7200
atcttttaaa tgggatttaa ctgcttttgg cttagttgca gagtggtttt tggcatatat 7260
tcttttcact aggtttttct atgtacttgg attggctgca atcatgcaat tgtttttcag 7320
ctattttgca gtacatttta ttagtaattc ttggcttatg tggttaataa ttaatcttgt 7380
acaaatggcc ccgatttcag ctatggttag aatgtacatc ttctttgcat cattttatta 7440
tgtatggaaa agttatgtgc atgttgtaga cggttgtaat tcatcaactt gtatgatgtg 7500
ttacaaacgt aatagagcaa caagagtcga atgtacaact attgttaatg gtgttagaag 7560
gtccttttat gtctatgcta atggaggtaa aggcttttgc aaactacaca attggaattg 7620
tgttaattgt gatacattct gtgctggtag tacatttatt agtgatgaag ttgcgagaga 7680
cttgtcacta cagtttaaaa gaccaataaa tcctactgac cagtcttctt acatcgttga 7740
tagtgttaca gtgaagaatg gttccatcca tctttacttt gataaagctg gtcaaaagac 7800
ttatgaaaga cattctctct ctcattttgt taacttagac aacctgagag ctaataacac 7860
taaaggttca ttgcctatta atgttatagt ttttgatggt aaatcaaaat gtgaagaatc 7920
atctgcaaaa tcagcgtctg tttactacag tcagcttatg tgtcaaccta tactgttact 7980
agatcaggca ttagtgtctg atgttggtga tagtgcggaa gttgcagtta aaatgtttga 8040
tgcttacgtt aatacgtttt catcaacttt taacgtacca atggaaaaac tcaaaacact 8100
agttgcaact gcagaagctg aacttgcaaa gaatgtgtcc ttagacaatg tcttatctac 8160
ttttatttca gcagctcggc aagggtttgt tgattcagat gtagaaacta aagatgttgt 8220
tgaatgtctt aaattgtcac atcaatctga catagaagtt actggcgata gttgtaataa 8280
ctatatgctc acctataaca aagttgaaaa catgacaccc cgtgaccttg gtgcttgtat 8340
tgactgtagt gcgcgtcata ttaatgcgca ggtagcaaaa agtcacaaca ttgctttgat 8400
atggaacgtt aaagatttca tgtcattgtc tgaacaacta cgaaaacaaa tacgtagtgc 8460
tgctaaaaag aataacttac cttttaagtt gacatgtgca actactagac aagttgttaa 8520
tgttgtaaca acaaagatag cacttaaggg tggtaaaatt gttaataatt ggttgaagca 8580
gttaattaaa gttacacttg tgttcctttt tgttgctgct attttctatt taataacacc 8640
tgttcatgtc atgtctaaac atactgactt ttcaagtgaa atcataggat acaaggctat 8700
tgatggtggt gtcactcgtg acatagcatc tacagatact tgttttgcta acaaacatgc 8760
tgattttgac acatggttta gccagcgtgg tggtagttat actaatgaca aagcttgccc 8820
attgattgct gcagtcataa caagagaagt gggttttgtc gtgcctggtt tgcctggcac 8880
gatattacgc acaactaatg gtgacttttt gcatttctta cctagagttt ttagtgcagt 8940
tggtaacatc tgttacacac catcaaaact tatagagtac actgactttg caacatcagc 9000
ttgtgttttg gctgctgaat gtacaatttt taaagatgct tctggtaagc cagtaccata 9060
ttgttatgat accaatgtac tagaaggttc tgttgcttat gaaagtttac gccctgacac 9120
acgttatgtg ctcatggatg gctctattat tcaatttcct aacacctacc ttgaaggttc 9180
tgttagagtg gtaacaactt ttgattctga gtactgtagg cacggcactt gtgaaagatc 9240
agaagctggt gtttgtgtat ctactagtgg tagatgggta cttaacaatg attattacag 9300
atctttacca ggagttttct gtggtgtaga tgctgtaaat ttacttacta atatgtttac 9360
accactaatt caacctattg gtgctttgga catatcagca tctatagtag ctggtggtat 9420
tgtagctatc gtagtaacat gccttgccta ctattttatg aggtttagaa gagcttttgg 9480
tgaatacagt catgtagttg cctttaatac tttactattc cttatgtcat tcactgtact 9540
ctgtttaaca ccagtttact cattcttacc tggtgtttat tctgttattt acttgtactt 9600
gacattttat cttactaatg atgtttcttt tttagcacat attcagtgga tggttatgtt 9660
cacaccttta gtacctttct ggataacaat tgcttatatc atttgtattt ccacaaagca 9720
tttctattgg ttctttagta attacctaaa gagacgtgta gtctttaatg gtgtttcctt 9780
tagtactttt gaagaagctg cgctgtgcac ctttttgtta aataaagaaa tgtatctaaa 9840
gttgcgtagt gatgtgctat tacctcttac gcaatataat agatacttag ctctttataa 9900
taagtacaag tattttagtg gagcaatgga tacaactagc tacagagaag ctgcttgttg 9960
tcatctcgca aaggctctca atgacttcag taactcaggt tctgatgttc tttaccaacc 10020
accacaaacc tctatcacct cagctgtttt gcagagtggt tttagaaaaa tggcattccc 10080
atctggtaaa gttgagggtt gtatggtaca agtaacttgt ggtacaacta cacttaacgg 10140
tctttggctt gatgacgtag tttactgtcc aagacatgtg atctgcacct ctgaagacat 10200
gcttaaccct aattatgaag atttactcat tcgtaagtct aatcataatt tcttggtaca 10260
ggctggtaat gttcaactca gggttattgg acattctatg caaaattgtg tacttaagct 10320
taaggttgat acagccaatc ctaagacacc taagtataag tttgttcgca ttcaaccagg 10380
acagactttt tcagtgttag cttgttacaa tggttcacca tctggtgttt accaatgtgc 10440
tatgaggccc aatttcacta ttaagggttc attccttaat ggttcatgtg gtagtgttgg 10500
ttttaacata gattatgact gtgtctcttt ttgttacatg caccatatgg aattaccaac 10560
tggagttcat gctggcacag acttagaagg taacttttat ggaccttttg ttgacaggca 10620
aacagcacaa gcagctggta cggacacaac tattacagtt aatgttttag cttggttgta 10680
cgctgctgtt ataaatggag acaggtggtt tctcaatcga tttaccacaa ctcttaatga 10740
ctttaacctt gtggctatga agtacaatta tgaacctcta acacaagacc atgttgacat 10800
actaggacct ctttctgctc aaactggaat tgccgtttta gatatgtgtg cttcattaaa 10860
agaattactg caaaatggta tgaatggacg taccatattg ggtagtgctt tattagaaga 10920
tgaatttaca ccttttgatg ttgttagaca atgctcaggt gttactttcc aaagtgcagt 10980
gaaaagaaca atcaagggta cacaccactg gttgttactc acaattttga cttcactttt 11040
agttttagtc cagagtactc aatggtcttt gttctttttt ttgtatgaaa atgccttttt 11100
accttttgct atgggtatta ttgctatgtc tgcttttgca atgatgtttg tcaaacataa 11160
gcatgcattt ctctgtttgt ttttgttacc ttctcttgcc actgtagctt attttaatat 11220
ggtctatatg cctgctagtt gggtgatgcg tattatgaca tggttggata tggttgatac 11280
tagtttgtct ggttttaagc taaaagactg tgttatgtat gcatcagctg tagtgttact 11340
aatccttatg acagcaagaa ctgtgtatga tgatggtgct aggagagtgt ggacacttat 11400
gaatgtcttg acactcgttt ataaagttta ttatggtaat gctttagatc aagccatttc 11460
catgtgggct cttataatct ctgttacttc taactactca ggtgtagtta caactgtcat 11520
gtttttggcc agaggtattg tttttatgtg tgttgagtat tgccctattt tcttcataac 11580
tggtaataca cttcagtgta taatgctagt ttattgtttc ttaggctatt tttgtacttg 11640
ttactttggc ctcttttgtt tactcaaccg ctactttaga ctgactcttg gtgtttatga 11700
ttacttagtt tctacacagg agtttagata tatgaattca cagggactac tcccacccaa 11760
gaatagcata gatgccttca aactcaacat taaattgttg ggtgttggtg gcaaaccttg 11820
tatcaaagta gccactgtac agtctaaaat gtcagatgta aagtgcacat cagtagtctt 11880
actctcagtt ttgcaacaac tcagagtaga atcatcatct aaattgtggg ctcaatgtgt 11940
ccagttacac aatgacattc tcttagctaa agatactact gaagcctttg aaaaaatggt 12000
ttcactactt tctgttttgc tttccatgca gggtgctgta gacataaaca agctttgtga 12060
agaaatgctg gacaacaggg caaccttaca agctatagcc tcagagttta gttcccttcc 12120
atcatatgca gcttttgcta ctgctcaaga agcttatgag caggctgttg ctaatggtga 12180
ttctgaagtt gttcttaaaa agttgaagaa gtctttgaat gtggctaaat ctgaatttga 12240
ccgtgatgca gccatgcaac gtaagttgga aaagatggct gatcaagcta tgacccaaat 12300
gtataaacag gctagatctg aggacaagag ggcaaaagtt actagtgcta tgcagacaat 12360
gcttttcact atgcttagaa agttggataa tgatgcactc aacaacatta tcaacaatgc 12420
aagagatggt tgtgttccct tgaacataat acctcttaca acagcagcca aactaatggt 12480
tgtcatacca gactataaca catataaaaa tacgtgtgat ggtacaacat ttacttatgc 12540
atcagcattg tgggaaatcc aacaggttgt agatgcagat agtaaaattg ttcaacttag 12600
tgaaattagt atggacaatt cacctaattt agcatggcct cttattgtaa cagctttaag 12660
ggccaattct gctgtcaaat tacagaataa tgagcttagt cctgttgcac tacgacagat 12720
gtcttgtgct gccggtacta cacaaactgc ttgcactgat gacaatgcgt tagcttacta 12780
caacacaaca aagggaggta ggtttgtact tgcactgtta tccgatttac aggatttgaa 12840
atgggctaga ttccctaaga gtgatggaac tggtactatc tatacagaac tggaaccacc 12900
ttgtaggttt gttacagaca cacctaaagg tcctaaagtg aagtatttat actttattaa 12960
aggattaaac aacctaaata gaggtatggt acttggtagt ttagctgcca cagtacgtct 13020
acaagctggt aatgcaacag aagtgcctgc caattcaact gtattatctt tctgtgcttt 13080
tgctgtagat gctgctaaag cttacaaaga ttatctagct agtgggggac aaccaatcac 13140
taattgtgtt aagatgttgt gtacacacac tggtactggt caggcaataa cagttacacc 13200
ggaagccaat atggatcaag aatcctttgg tggtgcatcg tgttgtctgt actgccgttg 13260
ccacatagat catccaaatc ctaaaggatt ttgtgactta aaaggtaagt atgtacaaat 13320
acctacaact tgtgctaatg accctgtggg ttttacactt aaaaacacag tctgtaccgt 13380
ctgcggtatg tggaaaggtt atggctgtag ttgtgatcaa ctccgcgaac ccatgcttca 13440
gtcagctgat gcacaatcgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca 13500
ccgtgcggca caggcactag tactgatgtc gtatacaggg cttttgacat ctacaatgat 13560
aaagtagctg gttttgctaa attcctaaaa actaattgtt gtcgcttcca agaaaaggac 13620
gaagatgaca atttaattga ttcttacttt gtagttaaga gacacacttt ctctaactac 13680
caacatgaag aaacaattta taatttactt aaggattgtc cagctgttgc taaacatgac 13740
ttctttaagt ttagaataga cggtgacatg gtaccacata tatcacgtca acgtcttact 13800
aaatacacaa tggcagacct cgtctatgct ttaaggcatt ttgatgaagg taattgtgac 13860
acattaaaag aaatacttgt cacatacaat tgttgtgatg atgattattt caataaaaag 13920
gactggtatg attttgtaga aaacccagat atattacgcg tatacgccaa cttaggtgaa 13980
cgtgtacgcc aagctttgtt aaaaacagta caattctgtg atgccatgcg aaatgctggt 14040
attgttggtg tactgacatt agataatcaa gatctcaatg gtaactggta tgatttcggt 14100
gatttcatac aaaccacgcc aggtagtgga gttcctgttg tagattctta ttattcattg 14160
ttaatgccta tattaacctt gaccagggct ttaactgcag agtcacatgt tgacactgac 14220
ttaacaaagc cttacattaa gtgggatttg ttaaaatatg acttcacgga agagaggtta 14280
aaactctttg accgttattt taaatattgg gatcagacat accacccaaa ttgtgttaac 14340
tgtttggatg acagatgcat tctgcattgt gcaaacttta atgttttatt ctctacagtg 14400
ttcccaccta caagttttgg accactagtg agaaaaatat ttgttgatgg tgttccattt 14460
gtagtttcaa ctggatacca cttcagagag ctaggtgttg tacataatca ggatgtaaac 14520
ttacatagct ctagacttag ttttaaggaa ttacttgtgt atgctgctga ccctgctatg 14580
cacgctgctt ctggtaatct attactagat aaacgcacta cgtgcttttc agtagctgca 14640
cttactaaca atgttgcttt tcaaactgtc aaacccggta attttaacaa agacttctat 14700
gactttgctg tgtctaaggg tttctttaag gaaggaagtt ctgttgaatt aaaacacttc 14760
ttctttgctc aggatggtaa tgctgctatc agcgattatg actactatcg ttataatcta 14820
ccaacaatgt gtgatatcag acaactacta tttgtagttg aagttgttga taagtacttt 14880
gattgttacg atggtggctg tattaatgct aaccaagtca tcgtcaacaa cctagacaaa 14940
tcagctggtt ttccatttaa taaatggggt aaggctagac tttattatga ttcaatgagt 15000
tatgaggatc aagatgcact tttcgcatat acaaaacgta atgtcatccc tactataact 15060
caaatgaatc ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc 15120
tctatctgta gtactatgac caatagacag tttcatcaaa aattattgaa atcaatagcc 15180
gccactagag gagctactgt agtaattgga acaagcaaat tctatggtgg ttggcacaac 15240
atgttaaaaa ctgtttatag tgatgtagaa aaccctcacc ttatgggttg ggattatcct 15300
aaatgtgata gagccatgcc taacatgctt agaattatgg cctcacttgt tcttgctcgc 15360
aaacatacaa cgtgttgtag cttgtcacac cgtttctata gattagctaa tgagtgtgct 15420
caagtattga gtgaaatggt catgtgtggc ggttcactat atgttaaacc aggtggaacc 15480
tcatcaggag atgccacaac tgcttatgct aatagtgttt ttaacatttg tcaagctgtc 15540
acggccaatg ttaatgcact tttatctact gatggtaaca aaattgccga taagtatgtc 15600
cgcaatttac aacacagact ttatgagtgt ctctatagaa atagagatgt tgacacagac 15660
tttgtgaatg agttttacgc atatttgcgt aaacatttct caatgatgat actctctgac 15720
gatgctgttg tgtgtttcaa tagcacttat gcatctcaag gtctagtggc tagcataaag 15780
aactttaagt cagttcttta ttatcaaaac aatgttttta tgtctgaagc aaaatgttgg 15840
actgagactg accttactaa aggacctcat gaattttgct ctcaacatac aatgctagtt 15900
aaacagggtg atgattatgt gtaccttcct tacccagatc catcaagaat cctaggggcc 15960
ggctgttttg tagatgatat cgtaaaaaca gatggtacac ttatgattga acggttcgtg 16020
tctttagcta tagatgctta cccacttact aaacatccta atcaggagta tgctgatgtc 16080
tttcatttgt acttacaata cataagaaag ctacatgatg agttaacagg acacatgtta 16140
gacatgtatt ctgttatgct tactaatgat aacacttcaa ggtattggga acctgagttt 16200
tatgaggcta tgtacacacc gcatacagtc ttacaggctg ttggggcttg tgttctttgc 16260
aattcacaga cttcattaag atgtggtgct tgcatacgta gaccattctt atgttgtaaa 16320
tgctgttacg accatgtcat atcaacatca cataaattag tcttgtctgt taatccgtat 16380
gtttgcaatg ctccaggttg tgatgtcaca gatgtgactc aactttactt aggaggtatg 16440
agctattatt gtaaatcaca taaaccaccc attagttttc cattgtgtgc taatggacaa 16500
gtttttggtt tatataaaaa tacatgtgtt ggtagcgata atgttactga ctttaatgca 16560
attgcaacat gtgactggac aaatgctggt gattacattt tagctaacac ctgtactgaa 16620
agactcaagc tttttgcagc agaaacgctc aaagctactg aggagacatt taaactgtct 16680
tatggtattg ctactgtacg tgaagtgctg tctgacagag aattacatct ttcatgggaa 16740
gttggtaaac ctagaccacc acttaaccga aattatgtct ttactggtta tcgtgtaact 16800
aaaaacagta aagtacaaat aggagagtac acctttgaaa aaggtgacta tggtgatgct 16860
gttgtttacc gaggtacaac aacttacaaa ttaaatgttg gtgattattt tgtgctgaca 16920
tcacatacag taatgccatt aagtgcacct acactagtgc cacaagagca ctatgttaga 16980
attactggct tatacccaac actcaatatc tcagatgagt tttctagcaa tgttgcaaat 17040
tatcaaaagg ttggtatgca aaagtattct acactccagg gaccacctgg tactggtaag 17100
agtcattttg ctattggcct agctctctac tacccttctg ctcgcatagt gtatacagct 17160
tgctctcatg ccgctgttga tgcactatgt gagaaggcat taaaatattt gcctatagat 17220
aaatgtagta gaattatacc tgcacgtgct cgtgtagagt gttttgataa attcaaagtg 17280
aattcaacat tagaacagta tgtcttttgt actgtaaatg cattgcctga gacgacagca 17340
gatatagttg tctttgatga aatttcaatg gccacaaatt atgatttgag tgttgtcaat 17400
gccagattac gtgctaagca ctatgtgtac attggcgacc ctgctcaatt acctgcacca 17460
cgcacattgc taactaaggg cacactagaa ccagaatatt tcaattcagt gtgtagactt 17520
atgaaaacta taggtccaga catgttcctc ggaacttgtc ggcgttgtcc tgctgaaatt 17580
gttgacactg tgagtgcttt ggtttatgat aataagctta aagcacataa agacaaatca 17640
gctcaatgct ttaaaatgtt ttataagggt gttatcacgc atgatgtttc atctgcaatt 17700
aacaggccac aaataggcgt ggtaagagaa ttccttacac gtaaccctgc ttggagaaaa 17760
gctgtcttta tttcacctta taattcacag aatgctgtag cctcaaagat tttgggacta 17820
ccaactcaaa ctgttgattc atcacagggc tcagaatatg actatgtcat attcactcaa 17880
accactgaaa cagctcactc ttgtaatgta aacagattta atgttgctat taccagagca 17940
aaagtaggca tactttgcat aatgtctgat agagaccttt atgacaagtt gcaatttaca 18000
agtcttgaaa ttccacgtag gaatgtggca actttacaag ctgaaaatgt aacaggactc 18060
tttaaagatt gtagtaaggt aatcactggg ttacatccta cacaggcacc tacacacctc 18120
agtgttgaca ctaaattcaa aactgaaggt ttatgtgttg acatacctgg catacctaag 18180
gacatgacct atagaagact catctctatg atgggtttta aaatgaatta tcaagttaat 18240
ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt 18300
ggcttcgatg tcgaggggtg tcatgctact agagaagctg ttggtaccaa tttaccttta 18360
cagctaggtt tttctacagg tgttaaccta gttgctgtac ctacaggtta tgttgataca 18420
cctaataata cagatttttc cagagttagt gctaaaccac cgcctggaga tcaatttaaa 18480
cacctcatac cacttatgta caaaggactt ccttggaatg tagtgcgtat aaagattgta 18540
caaatgttaa gtgacacact taaaaatctc tctgacagag tcgtatttgt cttatgggca 18600
catggctttg agttgacatc tatgaagtat tttgtgaaaa taggacctga gcgcacctgt 18660
tgtctatgtg atagacgtgc cacatgcttt tccactgctt cagacactta tgcctgttgg 18720
catcattcta ttggatttga ttacgtctat aatccgttta tgattgatgt tcaacaatgg 18780
ggttttacag gtaacctaca aagcaaccat gatctgtatt gtcaagtcca tggtaatgca 18840
catgtagcta gttgtgatgc aatcatgact aggtgtctag ctgtccacga gtgctttgtt 18900
aagcgtgttg actggactat tgaatatcct ataattggtg atgaactgaa gattaatgcg 18960
gcttgtagaa aggttcaaca catggttgtt aaagctgcat tattagcaga caaattccca 19020
gttcttcacg acattggtaa ccctaaagct attaagtgtg tacctcaagc tgatgtagaa 19080
tggaagttct atgatgcaca gccttgtagt gacaaagctt ataaaataga agaattattc 19140
tattcttatg ccacacattc tgacaaattc acagatggtg tatgcctatt ttggaattgc 19200
aatgtcgata gatatcctgc taattccatt gtttgtagat ttgacactag agtgctatct 19260
aaccttaact tgcctggttg tgatggtggc agtttgtatg taaataaaca tgcattccac 19320
acaccagctt ttgataaaag tgcttttgtt aatttaaaac aattaccatt tttctattac 19380
tctgacagtc catgtgagtc tcatggaaaa caagtagtgt cagatataga ttatgtacca 19440
ctaaagtctg ctacgtgtat aacacgttgc aatttaggtg gtgctgtctg tagacatcat 19500
gctaatgagt acagattgta tctcgatgct tataacatga tgatctcagc tggctttagc 19560
ttgtgggttt acaaacaatt tgatacttat aacctctgga acacttttac aagacttcag 19620
agtttagaaa atgtggcttt taatgttgta aataagggac actttgatgg acaacagggt 19680
gaagtaccag tttctatcat taataacact gtttacacaa aagttgatgg tgttgatgta 19740
gaattgtttg aaaataaaac aacattacct gttaatgtag catttgagct ttgggctaag 19800
cgcaacatta aaccagtacc agaggtgaaa atactcaata atttgggtgt ggacattgct 19860
gctaatactg tgatctggga ctacaaaaga gatgctccag cacatatatc tactattggt 19920
gtttgttcta tgactgacat agccaagaaa ccaactgaaa cgatttgtgc accactcact 19980
gtcttttttg atggtagagt tgatggtcaa gtagacttat ttagaaatgc ccgtaatggt 20040
gttcttatta cagaaggtag tgttaaaggt ttacaaccat ctgtaggtcc caaacaagct 20100
agtcttaatg gagtcacatt aattggagaa gccgtaaaaa cacagttcaa ttattataag 20160
aaagttgatg gtgttgtcca acaattacct gaaacttact ttactcagag tagaaattta 20220
caagaattta aacccaggag tcaaatggaa attgatttct tagaattagc tatggatgaa 20280
ttcattgaac ggtataaatt agaaggctat gccttcgaac atatcgttta tggagatttt 20340
agtcatagtc agttaggtgg tttacatcta ctgattggac tagctaaacg ttttaaggaa 20400
tcaccttttg aattagaaga ttttattcct atggacagta cagttaaaaa ctatttcata 20460
acagatgcgc aaacaggttc atctaagtgt gtgtgttctg ttattgattt attacttgat 20520
gattttgttg aaataataaa atcccaagat ttatctgtag tttctaaggt tgtcaaagtg 20580
actattgact atacagaaat ttcatttatg ctttggtgta aagatggcca tgtagaaaca 20640
ttttacccaa aattacaatc tagtcaagcg tggcaaccgg gtgttgctat gcctaatctt 20700
tacaaaatgc aaagaatgct attagaaaag tgtgaccttc aaaattatgg tgatagtgca 20760
acattaccta aaggcataat gatgaatgtc gcaaaatata ctcaactgtg tcaatattta 20820
aacacattaa cattagctgt accctataat atgagagtta tacattttgg tgctggttct 20880
gataaaggag ttgcaccagg tacagctgtt ttaagacagt ggttgcctac gggtacgctg 20940
cttgtcgatt cagatcttaa tgactttgtc tctgatgcag attcaacttt gattggtgat 21000
tgtgcaactg tacatacagc taataaatgg gatctcatta ttagtgatat gtacgaccct 21060
aagactaaaa atgttacaaa agaaaatgac tctaaagagg gttttttcac ttacatttgt 21120
gggtttatac aacaaaagct agctcttgga ggttccgtgg ctataaagat aacagaacat 21180
tcttggaatg ctgatcttta taagctcatg ggacacttcg catggtggac agcctttgtt 21240
actaatgtga atgcgtcatc atctgaagca tttttaattg gatgtaatta tcttggcaaa 21300
ccacgcgaac aaatagatgg ttatgtcatg catgcaaatt acatattttg gaggaataca 21360
aatccaattc agttgtcttc ctattcttta tttgacatga gtaaatttcc ccttaaatta 21420
aggggtactg ctgttatgtc tttaaaagaa ggtcaaatca atgatatgat tttatctctt 21480
cttagtaaag gtagacttat aattagagaa aacaacagag ttgttatttc tagtgatgtt 21540
cttgttaaca actaaacgaa caatgtttgt ttttcttgtt ttattgccac tagtctctag 21600
tcagtgtgtt aatcttacaa ccagaactca attaccccct gcatacacta attctttcac 21660
acgtggtgtt tattaccctg acaaagtttt cagatcctca gttttacatt caactcagga 21720
cttgttctta cctttctttt ccaatgttac ttggttccat gctatacatg tctctgggac 21780
caatggtact aagaggtttg ataaccctgt cctaccattt aatgatggtg tttattttgc 21840
ttccactgag aagtctaaca taataagagg ctggattttt ggtactactt tagattcgaa 21900
gacccagtcc ctacttattg ttaataacgc tactaatgtt gttattaaag tctgtgaatt 21960
tcaattttgt aatgatccat ttttgggtgt ttattaccac aaaaacaaca aaagttggat 22020
ggaaagtgag ttcagagttt attctagtgc gaataattgc acttttgaat atgtctctca 22080
gccttttctt atggaccttg aaggaaaaca gggtaatttc aaaaatctta gggaatttgt 22140
gtttaagaat attgatggtt attttaaaat atattctaag cacacgccta ttaatttagt 22200
gcgtgatctc cctcagggtt tttcggcttt agaaccattg gtagatttgc caataggtat 22260
taacatcact aggtttcaaa ctttacttgc tttacataga agttatttga ctcctggtga 22320
ttcttcttca ggttggacag ctggtgctgc agcttattat gtgggttatc ttcaacctag 22380
gacttttcta ttaaaatata atgaaaatgg aaccattaca gatgctgtag actgtgcact 22440
tgaccctctc tcagaaacaa agtgtacgtt gaaatccttc actgtagaaa aaggaatcta 22500
tcaaacttct aactttagag tccaaccaac agaatctatt gttagatttc ctaatattac 22560
aaacttgtgc ccttttggtg aagtttttaa cgccaccaga tttgcatctg tttatgcttg 22620
gaacaggaag agaatcagca actgtgttgc tgattattct gtcctatata attccgcatc 22680
attttccact tttaagtgtt atggagtgtc tcctactaaa ttaaatgatc tctgctttac 22740
taatgtctat gcagattcat ttgtaattag aggtgatgaa gtcagacaaa tcgctccagg 22800
gcaaactgga aagattgctg attataatta taaattacca gatgatttta caggctgcgt 22860
tatagcttgg aattctaaca atcttgattc taaggttggt ggtaattata attacctgta 22920
tagattgttt aggaagtcta atctcaaacc ttttgagaga gatatttcaa ctgaaatcta 22980
tcaggccggt agcacacctt gtaatggtgt tgaaggtttt aattgttact ttcctttaca 23040
atcatatggt ttccaaccca ctaatggtgt tggttaccaa ccatacagag tagtagtact 23100
ttcttttgaa cttctacatg caccagcaac tgtttgtgga cctaaaaagt ctactaattt 23160
ggttaaaaac aaatgtgtca atttcaactt caatggttta acaggcacag gtgttcttac 23220
tgagtctaac aaaaagtttc tgcctttcca acaatttggc agagacattg ctgacactac 23280
tgatgctgtc cgtgatccac agacacttga gattcttgac attacaccat gttcttttgg 23340
tggtgtcagt gttataacac caggaacaaa tacttctaac caggttgctg ttctttatca 23400
ggatgttaac tgcacagaag tccctgttgc tattcatgca gatcaactta ctcctacttg 23460
gcgtgtttat tctacaggtt ctaatgtttt tcaaacacgt gcaggctgtt taataggggc 23520
tgaacatgtc aacaactcat atgagtgtga catacccatt ggtgcaggta tatgcgctag 23580
ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat 23640
tgcctacact atgtcacttg gtgcagaaaa ttcagttgct tactctaata actctattgc 23700
catacccaca aattttacta ttagtgttac cacagaaatt ctaccagtgt ctatgaccaa 23760
gacatcagta gattgtacaa tgtacatttg tggtgattca actgaatgca gcaatctttt 23820
gttgcaatat ggcagttttt gtacacaatt aaaccgtgct ttaactggaa tagctgttga 23880
acaagacaaa aacacccaag aagtttttgc acaagtcaaa caaatttaca aaacaccacc 23940
aattaaagat tttggtggtt ttaatttttc acaaatatta ccagatccat caaaaccaag 24000
caagaggtca tttattgaag atctactttt caacaaagtg acacttgcag atgctggctt 24060
catcaaacaa tatggtgatt gccttggtga tattgctgct agagacctca tttgtgcaca 24120
aaagtttaac ggccttactg ttttgccacc tttgctcaca gatgaaatga ttgctcaata 24180
cacttctgca ctgttagcgg gtacaatcac ttctggttgg acctttggtg caggtgctgc 24240
attacaaata ccatttgcta tgcaaatggc ttataggttt aatggtattg gagttacaca 24300
gaatgttctc tatgagaacc aaaaattgat tgccaaccaa tttaatagtg ctattggcaa 24360
aattcaagac tcactttctt ccacagcaag tgcacttgga aaacttcaag atgtggtcaa 24420
ccaaaatgca caagctttaa acacgcttgt taaacaactt agctccaatt ttggtgcaat 24480
ttcaagtgtt ttaaatgata tcctttcacg tcttgacaaa gttgaggctg aagtgcaaat 24540
tgataggttg atcacaggca gacttcaaag tttgcagaca tatgtgactc aacaattaat 24600
tagagctgca gaaatcagag cttctgctaa tcttgctgct actaaaatgt cagagtgtgt 24660
acttggacaa tcaaaaagag ttgatttttg tggaaagggc tatcatctta tgtccttccc 24720
tcagtcagca cctcatggtg tagtcttctt gcatgtgact tatgtccctg cacaagaaaa 24780
gaacttcaca actgctcctg ccatttgtca tgatggaaaa gcacactttc ctcgtgaagg 24840
tgtctttgtt tcaaatggca cacactggtt tgtaacacaa aggaattttt atgaaccaca 24900
aatcattact acagacaaca catttgtgtc tggtaactgt gatgttgtaa taggaattgt 24960
caacaacaca gtttatgatc ctttgcaacc tgaattagac tcattcaagg aggagttaga 25020
taaatatttt aagaatcata catcaccaga tgttgattta ggtgacatct ctggcattaa 25080
tgcttcagtt gtaaacattc aaaaagaaat tgaccgcctc aatgaggttg ccaagaattt 25140
aaatgaatct ctcatcgatc tccaagaact tggaaagtat gagcagtata taaaatggcc 25200
atggtacatt tggctaggtt ttatagctgg cttgattgcc atagtaatgg tgacaattat 25260
gctttgctgt atgaccagtt gctgtagttg tctcaagggc tgttgttctt gtggatcctg 25320
ctgcaaattt gatgaagacg actctgagcc agtgctcaaa ggagtcaaat tacattacac 25380
ataaacgaac ttatggattt gtttatgaga atcttcacaa ttggaactgt aactttgaag 25440
caaggtgaaa tcaaggatgc tactccttca gattttgttc gcgctactgc aacgataccg 25500
atacaagcct cactcccttt cggatggctt attgttggcg ttgcacttct tgctgttttt 25560
cagagcgctt ccaaaatcat aaccctcaaa aagagatggc aactagcact ctccaagggt 25620
gttcactttg tttgcaactt gctgttgttg tttgtaacag tttactcaca ccttttgctc 25680
gttgctgctg gccttgaagc cccttttctc tatctttatg ctttagtcta cttcttgcag 25740
agtataaact ttgtaagaat aataatgagg ctttggcttt gctggaaatg ccgttccaaa 25800
aacccattac tttatgatgc caactatttt ctttgctggc atactaattg ttacgactat 25860
tgtatacctt acaatagtgt aacttcttca attgtcatta cttcaggtga tggcacaaca 25920
agtcctattt ctgaacatga ctaccagatt ggtggttata ctgaaaaatg ggaatctgga 25980
gtaaaagact gtgttgtatt acacagttac ttcacttcag actattacca gctgtactca 26040
actcaattga gtacagacac tggtgttgaa catgttacct tcttcatcta caataaaatt 26100
gttgatgagc ctgaagaaca tgtccaaatt cacacaatcg acggttcatc cggagttgtt 26160
aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220
gcacaagctg atgagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280
atagttaata gcgtacttct ttttcttgct ttcgtggtat tcttgctagt tacactagcc 26340
atccttactg cgcttcgatt gtgtgcgtac tgctgcaata ttgttaacgt gagtcttgta 26400
aaaccttctt tttacgttta ctctcgtgtt aaaaatctga attcttctag agttcctgat 26460
cttctggtct aaacgaacta aatattatat tagtttttct gtttggaact ttaattttag 26520
ccatggcaga ttccaacggt actattaccg ttgaagagct taaaaagctc cttgaacaat 26580
ggaacctagt aataggtttc ctattcctta catggatttg tcttctacaa tttgcctatg 26640
ccaacaggaa taggtttttg tatataatta agttaatttt cctctggctg ttatggccag 26700
taactttagc ttgttttgtg cttgctgctg tttacagaat aaattggatc accggtggaa 26760
ttgctatcgc aatggcttgt cttgtaggct tgatgtggct cagctacttc attgcttctt 26820
tcagactgtt tgcgcgtacg cgttccatgt ggtcattcaa tccagaaact aacattcttc 26880
tcaacgtgcc actccatggc actattctga ccagaccgct tctagaaagt gaactcgtaa 26940
tcggagctgt gatccttcgt ggacatcttc gtattgctgg acaccatcta ggacgctgtg 27000
acatcaagga cctgcctaaa gaaatcactg ttgctacatc acgaacgctt tcttattaca 27060
aattgggagc ttcgcagcgt gtagcaggtg actcaggttt tgctgcatac agtcgctaca 27120
ggattggcaa ctataaatta aacacagacc attccagtag cagtgacaat attgctttgc 27180
ttgtacagta agtgacaaca gatgtttcat ctcgttgact ttcaggttac tatagcagag 27240
atattactaa ttattatgag gacttttaaa gtttccattt ggaatcttga ttacatcata 27300
aacctcataa ttaaaaattt atctaagtca ctaactgaga ataaatattc tcaattagat 27360
gaagagcaac caatggagat tgattaaacg aacatgaaaa ttattctttt cttggcactg 27420
ataacactcg ctacttgtga gctttatcac taccaagagt gtgttagagg tacaacagta 27480
cttttaaaag aaccttgctc ttctggaaca tacgagggca attcaccatt tcatcctcta 27540
gctgataaca aatttgcact gacttgcttt agcactcaat ttgcttttgc ttgtcctgac 27600
ggcgtaaaac acgtctatca gttacgtgcc agatcagttt cacctaaact gttcatcaga 27660
caagaggaag ttcaagaact ttactctcca atttttctta ttgttgcggc aatagtgttt 27720
ataacacttt gcttcacact caaaagaaag acagaatgat tgaactttca ttaattgact 27780
tctatttgtg ctttttagcc tttctgctat tccttgtttt aattatgctt attatctttt 27840
ggttctcact tgaactgcaa gatcataatg aaacttgtca cgcctaaacg aacatgaaat 27900
ttcttgtttt cttaggaatc atcacaactg tagctgcatt tcaccaagaa tgtagtttac 27960
agtcatgtac tcaacatcaa ccatatgtag ttgatgaccc gtgtcctatt cacttctatt 28020
ctaaatggta tattagagta ggagctagaa aatcagcacc tttaattgaa ttgtgcgtgg 28080
atgaggctgg ttctaaatca cccattcagt acatcgatat cggtaattat acagtttcct 28140
gtttaccttt tacaattaat tgccaggaac ctaaattggg tagtcttgta gtgcgttgtt 28200
cgttctatga agacttttta gagtatcatg acgttcgtgt tgttttagat ttcatctaaa 28260
cgaacaaact aaaatgtctg ataatggacc ccaaaatcag cgaaatgcac cccgcattac 28320
gtttggtgga ccctcagatt caactggcag taaccagaat ggagaacgca gtggggcgcg 28380
atcaaaacaa cgtcggcccc aaggtttacc caataatact gcgtcttggt tcaccgctct 28440
cactcaacat ggcaaggaag accttaaatt ccctcgagga caaggcgttc caattaacac 28500
caatagcagt ccagatgacc aaattggcta ctaccgaaga gctaccagac gaattcgtgg 28560
tggtgacggt aaaatgaaag atctcagtcc aagatggtat ttctactacc taggaactgg 28620
gccagaagct ggacttccct atggtgctaa caaagacggc atcatatggg ttgcaactga 28680
gggagccttg aatacaccaa aagatcacat tggcacccgc aatcctgcta acaatgctgc 28740
aatcgtgcta caacttcctc aaggaacaac attgccaaaa ggcttctacg cagaagggag 28800
cagaggcggc agtcaagcct cttctcgttc ctcatcacgt agtcgcaaca gttcaagaaa 28860
ttcaactcca ggcagcagta ggggaacttc tcctgctaga atggctggca atggcggtga 28920
tgctgctctt gctttgctgc tgcttgacag attgaaccag cttgagagca aaatgtctgg 28980
taaaggccaa caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcttctaa 29040
gaagcctcgg caaaaacgta ctgccactaa agcatacaat gtaacacaag ctttcggcag 29100
acgtggtcca gaacaaaccc aaggaaattt tggggaccag gaactaatca gacaaggaac 29160
tgattacaaa cattggccgc aaattgcaca atttgccccc agcgcttcag cgttcttcgg 29220
aatgtcgcgc attggcatgg aagtcacacc ttcgggaacg tggttgacct acacaggtgc 29280
catcaaattg gatgacaaag atccaaattt caaagatcaa gtcattttgc tgaataagca 29340
tattgacgca tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaagaaggc 29400
tgatgaaact caagccttac cgcagagaca gaagaaacag caaactgtga ctcttcttcc 29460
tgctgcagat ttggatgatt tctccaaaca attgcaacaa tccatgagca gtgctgactc 29520
aactcaggcc taaactcatg cagaccacac aaggcagatg ggctatataa acgttttcgc 29580
ttttccgttt acgatatata gtctactctt gtgcagaatg aattctcgta actacatagc 29640
acaagtagat gtagttaact ttaatctcac atagcaatct ttaatcagtg tgtaacatta 29700
gggaggactt gaaagagcca ccacattttc accgaggcca cgcggagtac gatcgagtgt 29760
acagtgaaca atgctaggga gagctgccta tatggaagag ccctaatgtg taaaattaat 29820
tttagtagtg ctatccccat gtgattttaa tagcttctta ggagaatgac aaaaaaaaaa 29880
aaaaaaaaaa aaaaaaaaaa aaa 29903
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
ccctgtgggt tttacactta a 21
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
acgattgtgc atcagctga 19
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
ccgtctgcgg tatgtggaaa ggttatgg 28
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
ggggaacttc tcctgctaga at 22
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
cagacatttt gctctcaagc tg 22
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ttgctgctgc ttgacagatt 20
Claims (4)
1. A novel rapid detection test strip for coronavirus is characterized in that: comprising the following steps: a solid-phase binding membrane, a specific probe for detecting novel coronavirus and a buffer solution;
the solid-phase bonding membrane is a melt-blown polypropylene membrane, and ACE2 receptor protein is loaded on the melt-blown polypropylene membrane;
the specific probe sequence for detecting the novel coronavirus is a fluorescent probe for detecting the ORF1ab gene of the novel coronavirus or a fluorescent probe for detecting the N gene of the novel coronavirus;
the buffer solution consists of Tris-HCl buffer solution with pH of 7.0-9.2100mM and Mg with pH of 10-20mM 2+ 300-500mM KCl.
2. The test strip of claim 1, wherein: the sequence of the fluorescent probe for detecting the ORF1ab gene of the novel coronavirus is as follows:
5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'。
3. the test strip of claim 1, wherein: the fluorescent probe sequence for detecting the N gene of the novel coronavirus is as follows:
5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'。
4. the test strip of claim 1, wherein: the detection test strip also comprises a lysis flushing fluid, wherein the lysis flushing fluid consists of a Tris-HCl buffer solution with the pH of 7.5-8.340-80mM, naCl with the concentration of 100-200mM, sodium deoxycholate with the concentration of 0.1% and NP-40 with the concentration of 1%.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010107401.2A CN111273026B (en) | 2020-02-21 | 2020-02-21 | Novel rapid detection test strip for coronavirus and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010107401.2A CN111273026B (en) | 2020-02-21 | 2020-02-21 | Novel rapid detection test strip for coronavirus and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111273026A CN111273026A (en) | 2020-06-12 |
CN111273026B true CN111273026B (en) | 2023-05-09 |
Family
ID=70997213
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010107401.2A Active CN111273026B (en) | 2020-02-21 | 2020-02-21 | Novel rapid detection test strip for coronavirus and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111273026B (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11149320B1 (en) * | 2020-03-31 | 2021-10-19 | Diasorin S.P.A. | Assays for the detection of SARS-CoV-2 |
CN111270017A (en) * | 2020-04-03 | 2020-06-12 | 深圳华因康基因科技有限公司 | Primer probe combination for detecting novel coronavirus based on digital PCR and application thereof |
CN111808993A (en) * | 2020-07-21 | 2020-10-23 | 川南医学转化研究院 | Specific primer, probe and kit for gene detection of novel coronavirus |
CN112877470A (en) * | 2020-12-11 | 2021-06-01 | 肇庆大华农生物药品有限公司 | New coronavirus RPA reaction system and application thereof |
CN113151583A (en) * | 2020-12-29 | 2021-07-23 | 苏州新波生物技术有限公司 | Detection kit capable of directly amplifying sample containing SARS CoV-2 virus and detection method thereof |
GB202100997D0 (en) * | 2021-01-25 | 2021-03-10 | Primer Design Ltd | Composition and method |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2003254594A1 (en) * | 2003-07-14 | 2005-01-28 | Capital Biochip Company, Ltd. | Methods and compositions for detecting sars virus and other infectious agents |
US20050113298A1 (en) * | 2003-09-15 | 2005-05-26 | The Brigham And Women's Hospital, Inc. | Receptor binding peptides derived from the SARS S protein |
WO2006076007A2 (en) * | 2004-04-22 | 2006-07-20 | Vanderbilt University | Methods of detecting coronavirus infections |
US7629443B2 (en) * | 2004-06-02 | 2009-12-08 | New York Blood Center, Inc. | Neutralizing monoclonal antibodies against severe acute respiratory syndrome-associated coronavirus |
EP2707496A1 (en) * | 2011-05-11 | 2014-03-19 | Diagon Kft. | Procedure for rapid determination of viruses using nucleic acid-based molecular diagnostics, and a kit for this purpose |
TW201606306A (en) * | 2014-08-12 | 2016-02-16 | Nat Univ Chung Hsing | Biomedical detection chip and method of performing detection using the same |
-
2020
- 2020-02-21 CN CN202010107401.2A patent/CN111273026B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN111273026A (en) | 2020-06-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111273026B (en) | Novel rapid detection test strip for coronavirus and application thereof | |
CN102337351B (en) | Typing detection kit for influenza virus | |
CN108384899B (en) | Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof | |
WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
CN116438299A (en) | CRISPR-based assays for detecting pathogens in samples | |
CN113564130B (en) | Coxsackie virus A10 type strain and application thereof | |
Ekrami et al. | Potential diagnostic systems for coronavirus detection: a critical review | |
CN111500780A (en) | Kit for detecting novel coronavirus and preparation method thereof | |
US7709188B2 (en) | Multi-allelic detection of SARS-associated coronavirus | |
TWI362419B (en) | Nucleic acid detection | |
WO2021225221A1 (en) | Rt-lamp kit and method for diagnosis of coronavirus-19 infection | |
CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
CN111808990A (en) | 2019-nCoV nucleic acid detection kit | |
CN111197098A (en) | Method for detecting mycobacterium tuberculosis from sputum | |
CN116042678A (en) | Fusion protein for detecting nerve syphilis and kit thereof | |
CN112662812B (en) | Novel coronavirus quality control product, preparation method and application thereof | |
JP4080995B2 (en) | Polynucleotide probe and primer derived from hepatitis E virus from Japanese, chip having them, kit having them, and method for detecting hepatitis E virus by them | |
CN114934043A (en) | Primer probe composition and kit for detecting canis and preparation method thereof | |
Belliot et al. | Characterization of ‘Norwalk-like viruses’ and astroviruses by liquid hybridization assay | |
CN117230258B (en) | EB virus detection method of culture amplification combined PCR for improving sensitivity | |
CN111534611A (en) | Fluorescent quantitative PCR method for detecting toxigenic streptococcus suis and corresponding kit | |
CN102417935B (en) | Nucleic acid quantitative determination kit, detection method, primers and probes for Newcastle disease virus (NDV) | |
WO2022199526A1 (en) | Hepatitis e virus-like particles and uses thereof | |
JP4127722B2 (en) | Polynucleotide probe and primer derived from hepatitis E virus from Japanese, chip having them, kit having them, and method for detecting hepatitis E virus by them | |
US20220243290A1 (en) | Molecular detection of novel coronaviruses |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |