CN102108415B - Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) - Google Patents

Abstract

The invention discloses a method and a kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV), wherein an adopted outer primer contains sequences indicated by Seq ID No.1 and Seq ID No.2 respectively. According to the method and the kit which are provided by the invention, PFRV can be detected specifically; and the sensitivity is high and particularly reaches 100.5TCID50 when the kit is used for detecting the extracted nucleic acid in a virus suspension.

Description

Pike juvenile rhabdovirus reverse transcription ring enzyme constant-temperature amplification detection method and test kit

Technical field

The present invention relates to Detecting method and detection kit, particularly relate to pike juvenile rhabdovirus reverse transcription ring enzyme constant-temperature amplification detection method and test kit.

Background technology

According to international virusology classification (the International comittee on taxonomy ofviruses of the council, ICTV) the 8th report, Rhabdoviridae (Rhabdoviridae) is divided into 6 genus, comprise infection plant Cytorhabdovirus ( Cytorhabdovirus) and Nucleorhabdovirus ( Nucleorhabdovirus), and infect vertebrate vesicular stomatitis virus belong to ( Vesiculovirus), Lyssavirus ( Lyssavirus), Ephemerovirus (Ephemerovirus) and the grain outer Rhabdovirus (also claiming the non-virion protein Rhabdovirus) ( Novirhabdovirus), also have the part rhabdovirus not yet to classify, as Sigma virus, Flanders virus etc.the rhabdovirus that hitherto reported infects fish has tens kinds, comprise infectious hematopoietic necrosis's poison (Infetioushematopoietic necrosis virus, IHNV), viral haemorrhagic septicaemia virus (Viralhaemorrhagic septicemia virus, VHSV), flounder rhabdovirus (Hirame rhabdovirus, HRV), snakehead fish rhabdovirus (Snakehead rhabdovirus, SHRV), SVCV (Spring viraemia of carp virus, SVCV), pike juvenile rhabdovirus (Pike fryrhabdovirus, PFRV), (Rhabdovirus 903/87 for rhabdovirus 903/87, 903/87), mandarin fish rhabdovirus (Siniperca chuatsi rhabdovirus, SCRV), mullet rhabdovirus (Chinesesucker rhabdovirus) and bull trout rhabdovirus 28/97 (Sea trout rhabdovirus 28/97, (the Granoff and Webster such as STRV), 1999, Zhang Qiya and Li Zhengqiu, 1999, Zhang et al., 2000, Johansson et al., 2001,2002).In the 6th report of ICTV, SVCV, PFRV are listed in vesicular stomatitis virus and belong to tentative species (Wunner et al., 1995).In the 7th report of ICTV, formally IHNV, VHSV, HRV, SHRV are classified as the outer Rhabdovirus of grain, SVCV, PFRV etc. still is classified as the tentative species (Walker et al., 2000) that vesicular stomatitis virus belongs to.The classification position of other kinds of fish Rhabdovirus is not yet definite.

Along with the fast development of fish farming industry, Virus disease of fish has become the maximum disease of cultured fishes.Owing to lacking effective methods for the treatment of, the control of fishes virus disease is putting prevention first, thereby the diagnoois and test technical study of virus has become very active field in fishes virus research.Kinds of fish Rhabdovirus has very strong pathogenic, and particularly VHSV, IHNV, HRV, SHRV and SVCV are widely current all over the world, causes great financial loss for the aquatic products aquaculture.Thereby these viral epidemiology enjoy the concern of researcher.

Pike juvenile rhabdovirus (PFRV) is a kind of virus very high with SVCV (SVCV) homology, does not cause also that at present people pay much attention to.PFRV is popular in European pike juvenile (Wolf, 1988) mainly.Should virus infect pike juvenile in Holland in 1972, and cause extensive death, from then on the first strain PFRV criticizes in ill pike juvenile and separates (De Kinkelin, 1973).PFRV and SVCV sibship are nearest, the homology of G albumen＞70%.PFRV, SVCV and the kinds of fish Rhabdovirus G protein part nucleotide sequence relevant to their serology are carried out phylogenetic analysis, result shows that they form 4 genotype, PFRV and SVCV form respectively a genotype, be respectively genotype III and I, other viruses form genotype II and IV (Stone et al., 2003).SVC main infection cyprinid fish, being classified as by OIE must notifiable disease, and the Ministry of Agriculture classifies SVC as the secondary animal epidemic.Along with the pay attention to day by day to SVC, to the increasing of SVCV control and monitoring, the virus that these and SVCV sibship are high also will more and more cause people's attention.Thereby seek special, sensitivity detection method fast, very crucial for generation and the development of prevention and control disease.

In China, fishes virus SVCV has caused the attention of people's height, and in annual spring and autumn, national carp is carried out the SVCV monitoring.But the fishes virus PFRV very high with the SVCV sibship also do not cause people's attention at present, do not include the scope of detection in.In succession separate (Ahne, 1975 along with learning relevant virus to these 2 kinds of serum virus; Ahne et al., 1982; Fijan et al., 1984; Ahne and Thomsen, 1986; Haenen and Davidse, 1989; Jorgensen et al., 1989; Rowley et al., 2001; Stone et al., 2003; Way et al., 2003), people can get more and more to the concern of these viruses.Thereby need to set up practicable detection method.

At present, identify that PFRV reaches the virus relevant to its serology and generally takes first to separate with sensitive cells, mode (De Kinkelin, 1973 of then identifying with serological method; Ahne, 1975; Ahne etal., 1982; Fijan et al., 1984; Ahne and Thomsen, 1986; Haenen and Dayidse, 1989; Jorgensen et al., 1989; Rowley et al., 2001; Stone et al., 2003; Way et al., 2003).Adopt this detection mode not only the cycle long, and use immunological method, as indirect fluorescent antibody test or enzyme linked immunosorbent assay, exist between PFRV and SVCV cross reaction ( Et al., 1989; Way, 1991), detected result is inaccurate.

Ring matchmaker's isothermal amplification technology (Loop-mediated isothermal amplification, LAMP) is a kind of novel nucleic acid amplification technologies (Notomi et al., 2000) of report in 2000.This technology is for 4 special primers of 6 zone design of DNA target sequence, comprise 1 pair of inner primer and 1 pair of outer primer, inner primer comprises front inner primer FIP (Forward inner primer) and rear inner primer BIP (Backward inner primer), outer primer comprises F3 and B3, as shown in Figure 1A.FIP is comprised of 2 primers, respectively F1C (complementary sequence of target gene F1 sequence) and F2 (identical with the target sequence sequence), TTTT link F1C and F2, in like manner BIP is made of B1C-TTTT-B2, TTTT is not essential as connecting Nucleotide, when inadequate 30 Nucleotide of ring that forms, increase the length that 4 Nucleotide can increase ring.Outer primer B3 and F3 identified region are positioned at outside inner primer, and be complementary with target sequence B3C, F3C respectively.Also note a principle during design primer, amplification section F2-R2 preferably is controlled in 200 Nucleotide.The mechanism (as shown in Figure 1B) of LAMP method amplification: 1, be combined by B2c with template DNA in for the B2 in primer BIP (complementary sequence of B2c), the synthesizing of initial complementary strand; 2, B3 (complementary sequence of B3c) is combined with B3c, starts strand replacement reaction; 3, strand replacement reaction produces 1 pair of two strands and 1 strand, and there is complementary nucleotide at strand two ends, form dumbbell shaped; 4, the synthetic a kind of transitional loop-stem structure DNA jaggy of the B2c on the ring of the B2 in primer BIP and double-stranded loop-stem structure DNA; 5, contain 1 pair of reverse complementary sequence on the stem of transitional loop-stem structure, end over there forms 1 ring texture by FIP.In building-up process is extended in self-primer displacement subsequently, under the inner primer effect, the beginning circulating reaction, the length of stem and the number of ring all increase gradually, and last product is the mixture that the stem circular DNA of different lengths forms.

Amplified production can judge by 3 kinds of methods: 1, agarose gel electrophoresis; 2, add double-stranded DNA dyestuff SYBR Green I in amplified production; 3, the negative product magnesium pyrophosphate white precipitate of visual inspection amplification.The LAMP method has advantages of that many other PCR method are incomparable.1, only need to keep the steady temperature of 60 ℃-65 ℃ just can carry out amplified reaction, therefore need not expensive equipment, general thermostat such as water-bath or thermostat container just can satisfy the amplification requirement; 2, for 4 primers of 6 section designs of target sequence, the specificity of amplification further improves than other PCR method; 3, whole amplification can be completed in about 1h, and productive rate can reach 0.15mg/mL, and amplification efficiency improves greatly.When 4, carrying out RT-LAMP, after increasing ThermoScript II and RNA enzyme inhibitors, do not need the time of specialized designs reverse transcription, the time of whole reaction does not need to increase yet, and further improves the efficient that detects; 5, when nucleic acid is synthetic in a large number, the pyrophosphate ion of separating out from dNTP and the Mg reaction soln ²⁺In conjunction with, producing by product---the magnesium pyrophosphate precipitation, because amplification efficiency is high, the magnesium pyrophosphate of generation precipitation is many, detects by an unaided eye or turbidimeter detects turbidity and just can judge whether to increase.

Summary of the invention

The objective of the invention is for the deficiencies in the prior art, reverse transcription ring matchmaker constant-temperature amplification (RT-LAMP) detection method of a kind of pike juvenile rhabdovirus is provided.

Another object of the present invention is to provide the detection kit of a kind of pike juvenile rhabdovirus.

For achieving the above object, the present invention has adopted following technical scheme:

The invention discloses pike juvenile rhabdovirus (Pike fry rhabdovirus, PFRV) reverse transcription ring matchmaker constant-temperature amplification detection method, described method comprises utilizes Auele Specific Primer, carry out reverse transcription ring matchmaker isothermal amplification reactions take virus genome RNA as template, described Auele Specific Primer comprises a pair of inner primer and a pair of outer primer, described outer primer contains respectively the sequence shown in Seq ID No.1 and Seq ID No.2

Seq ID No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’

Seq ID No.2：5’---TTCTCGATCCAGTCTCCACG---3’。

Described inner primer comprises front inner primer FIP and rear inner primer BIP,

Described front inner primer FIP preferably contains the sequence shown in Seq ID No.3 and Seq ID No.4, is connected by 0～4 base between Seq ID No.3 and Seq ID No.4;

Described rear inner primer BIP preferably contains the sequence shown in Seq ID No.5 and Seq ID No.6, is connected by 0～4 base between Seq ID No.5 and Seq ID No.6;

Seq ID No.3：5’---GAGCATTTCCATACATGGTCCC---3’

Seq ID No.4：5’---GAGGAATGCGACCAACACATC---3’

Seq ID No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’

Seq ID No.6：5’---CTTGATTCCATCCATCCCAC---3’。

In the preferred embodiment of the present invention, described outer primer has respectively the sequence shown in Seq ID No.1 and SeqID No.2,

The sequence of described front inner primer FIP is:

GAGCATTTCCATACATGGTCCCGAGGAATGCGACCAACACATC

Seq ID No.3 Seq ID No.4

The sequence of described rear inner primer BIP is:

CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC

Seq ID No.5 Seq ID No.6

The thermostat temperature of described reverse transcription ring matchmaker isothermal amplification reactions is preferably 59 ℃～65 ℃, and more preferably 63 ℃, the time of reaction is preferably 30min-120min, more preferably 60min.

The invention also discloses the detection kit of a kind of pike juvenile rhabdovirus (Pike fry rhabdovirus, PFRV), described test kit comprises the pair of primers that contains respectively sequence shown in Seq ID No.1 and Seq ID No.2,

Seq ID No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’

Seq ID No.2：5’---TTCTCGATCCAGTCTCCACG---3’。

Described detection kit is preferred for reverse transcription ring matchmaker isothermal amplification reactions, and described primer is outer primer.

Described detection kit preferably also contains a pair of inner primer, and described inner primer comprises front inner primer FIP and rear inner primer BIP,

Described front inner primer FIP preferably contains the sequence shown in Seq ID No.3 and Seq ID No.4, is connected by 0～4 base between Seq ID No.3 and Seq ID No.4;

Described rear inner primer BIP preferably contains the sequence shown in Seq ID No.5 and Seq ID No.6, is connected by 0～4 base between Seq ID No.5 and Seq ID No.6;

Seq ID No.3：5’---GAGCATTTCCATACATGGTCCC---3’

Seq ID No.4：5’---GAGGAATGCGACCAACACATC---3’

Seq ID No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’

Seq ID No.6：5’---CTTGATTCCATCCATCCCAC---3’。

Above-mentioned 0～4 base is not essential as connecting Nucleotide, and when inadequate 30 Nucleotide of ring that forms, 0～4 Nucleotide that increases can increase the length of ring, and described 0～4 base is preferably TTTT.

In the preferred embodiment of the present invention, described outer primer has respectively the sequence shown in Seq ID No.1 and SeqID No.2,

The sequence of described front inner primer FIP is:

GAGCATTTCCATACATGGTCCCGAGGAATGCGACCAACACATC

Seq ID No.3 Seq ID No.4

The sequence of described rear inner primer BIP is:

CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC

Seq ID No.5 Seq ID No.6

Owing to having adopted above technical scheme, the beneficial effect that the present invention possesses is:

Reverse transcription ring matchmaker constant-temperature amplification (RT-LAMP) detection method of the present invention and test kit are during for detection of PFRV, because the design of primers of uniqueness makes detection method have good specificity, during for detection of IHNV, SVCV, VHSV, VNNV, IPNV, HRV and PFRV, only have the detected result of PFRV positive.Method of the present invention and test kit are highly sensitive, are 10 to the detection sensitivity of extracting nucleic acid in viral suspension ^0.5TCID _{50 '}Than highly sensitive 100 times of RT-PCR, than highly sensitive 10 times of real-time fluorescence RT-PCR.Method of the present invention and test kit are short detection time, and the RT-LAMP reaction times only needs 1h, and be consuming time shorter than real-time fluorescence (1.5h-2h) and RT-PCR (2h-3h).The instrument of using the LAMP Technology Need is not high yet, and general PCR instrument or thermostatic equipment such as water-bath or thermostat container just can react.

Description of drawings

Fig. 1 is LAMP reaction process schematic diagram, and wherein A is LAMP primer location schematic diagram, and B is LAMP reaction process schematic diagram.

Fig. 2 is the position view of a kind of RT-LAMP primer of the present invention in the PFRV genome.

Fig. 3 A is the temperature optimization test-results electrophoretic image of RT-LAMP of the present invention; 1:MarkerDL2000; 2:59 ℃; 3:60 ℃; 4:61 ℃; 5:62 ℃; 6:63 ℃; 7:64 ℃; 8:65 ℃.

Fig. 3 B is that RT-LAMP temperature optimization amplified production of the present invention is at the solubility curve of ABI7500.

Fig. 4 A is the time-optimized test-results electrophoretic image of RT-LAMP of the present invention; 1:MarkerDL2000; 2:30min; 3:45min; 4:60min; 5:90min; 6:120min.

Fig. 4 B is that the time-optimized amplified production of RT-LAMP of the present invention is at the solubility curve of ABI7500.

Fig. 5 is the different RT-LAMP comparisons of observational technique as a result, A, gel electrophoresis, and B, PicoGreen dye (1 is emerald green), the C solubility curve.

Fig. 6 is the specific test that detects of PFRV RT-LAMP of the present invention electrophoretic image as a result; 1:PFRV; 2:HRV; 3:IHNV; 4:VHSV; 5:SVCV; 6:IPNV; 7:VNNV; 8:Negativecontrol; 9:Marker DL2000.

Fig. 7 is PFRV RT-LAMP sensitivity test of the present invention electrophoretic image as a result; 1:MarkerDL2000,2:10 ⁰3:10 ^-14:10 ^-25:10 ^-36:10 ^-47:10 ^-58:10 ^-69:Negativecontrol.

Fig. 8 is PFRV primers F 2/R2RT-PCR sensitivity experiment electrophoretic image as a result; 1:DNAMarker; 2:10 ⁰3:10 ^-14:10 ^-25:10 ^-36:10 ^-47:10 ^-58:10 ^-69:Negativecontrol.

Fig. 9 is the sensitivity experiment that detects of PFRV real-time fluorescence RT-PCR figure as a result.

Embodiment

Embodiment 1

1 materials and methods

1.1 virus and cell

PFRV is the F4 strain, is given by Inst. of Hydrobiology, Chinese Academy of Sciences, and SVCV and IHNV Reference Strains are so kind as to give by OIE reference laboratory professor B.Hill of Britain CEFAS; The VHSV Reference Strains by the veterinary institute OIE of Norway country reference laboratory Roar doctor Gudding be so kind as to give, IPNV, HRV, VNNV separate by this chamber.

IHNV, SVCV, VHSV, VNNV, IPNV, HRV and PFRV use respectively EPC, CO, RTG-2, SSN-1, CHSE-214, FHM and BF-2 cell amplification.The SSN-1 cell is available from hydrocoles health research institute of Thailand Kasetsart university, the RTG-2 cell is given by hydrobiont institute, the BF-2 cell is given by quarantine institute's (Brescia) cell preservation center, CHSE-214 cell, EPC cell by Britain's environment, fishery and aquaculture research establishment give, the FHM cell given by Univ Munich Germany and Inst. of Hydrobiology, Chinese Academy of Sciences, the CO cell is given by Inst. of Hydrobiology, Chinese Academy of Sciences.

EPC, CO, CHSE-214, FHM, BF-2 and RTG-2 cell are all cultivated with 199 nutrient solutions that contain 10% foetal calf serum, and the SSN-1 cell is cultivated with the L-15 nutrient solution that contains 10%FBS.After virus inoculation, with added with antibiotic (100IU/mL penicillin; 100 μ g/mL Streptomycin sulphates) corresponding nutrient solution is cultivated.

1.2 equipment and reagent

Equipment: ABI7500 quantitative fluorescent PCR, Eppendorf PCR instrument, BDA TI1 type gel imaging instrument (Biometra).

Reagent: MgSO ₄, Betaine, fluorescence dye PicoGreen be purchased from American I nvitrogen company; Bst archaeal dna polymerase large fragment and 10 * ThermoPol reaction buffer (100mmol/L KCl, 200mmol/L Tris-HCl, 100mmol/L (NH4) ₂SO ₄, 20mmol/L MgSO ₄, 1%TritonX-100,8.8,25 ℃ of pH) and be purchased from Niu Yinglun Bioisystech Co., Ltd (NEB); ThermoScript II, nucleic acid inhibitor are available from the precious biotech firm in Dalian; Experiment institute water is DEPC and processes water; Experimental ware all passes through high-temperature sterilization 2 times.

1.3RT-LAMP the design of primer

According to PFRV G gene (AJ538069) in Genbank, use Primer Explore V3 and Primer Premier 5.0 softwares for wherein 2 pairs of primers of 6 zone design, i.e. 1 pair of outer primer, 1 pair of inner primer.Synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Primer sequence sees Table 1.Position and the amplification principle schematic of primer in the PFRV genome seen Fig. 2.

Table 1PFRV RT-LAMP detects primer

Primer	Sequence 5 '-------3 '
		PFRV F3	CAATTTGGCTAACAGATCATATCCT (Seq ID No.1)
PFRV B3	TTCTCGATCCAGTCTCCACG (Seq ID No.2)
		PFRV FIP	GAGCATTTCCATACATGGTCCC GAGGAATGCGACCAACACATC F1c(Seq ID No.3) F2(Seq ID No.4)
PFRV BIP	CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC B1c(Seq ID No.5) B2(Seq ID No.6)

Inner primer FIP and BIP contain respectively 2 different sequences, are respectively F1c+F2 and B1c+TTTT+B2.

1.4 the extraction of viral nucleic acid

Specification sheets with reference to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit operates.

1.5 the mensuration of virus titer

Virus titer is measured and is adopted Endpoint Dilution Method, with reference to the method for Reed and Muench (1938).Concrete grammar is as follows:

1) pass the BF-2 cell and enter 96 orifice plates, be placed in 25 ℃ of incubators cultivate (＜24h);

2) 10 times of serial dilution viruses to be measured;

3) each dilution viral suspension is inoculated into cell and grows up in single 96 orifice plates that become, every extent of dilution adds 3 holes, and every hole adds 100 μ L, and control group adds 100 μ L nutrient solutions;

4) 96 orifice plates are placed in the optimal temperature incubator and cultivate, until CPE is complete;

5) observe under inverted microscope, calculate virus titer (TCID ₅₀/ 0.1mL).

1.6 the optimization of RT-LAMP reaction conditions

RT-LAMP adopts 25 μ L reaction systems, and the component dosage that adds is as follows:

10×Bst Buffer	2.5μL
		dNTP(10mM/L each)	3.5μL
MgSO 4(25μmol/μL)	0.6μL
		PFRV F3(5pmol/μL)	1μL
PFRV B3(5pmol/μL)	1μL
		PFRV FIP(40pmol/μL)	1μL
PFRV BIP(40pmol/μL)	1μL
		Betaine(5M)	5μL
RNasin(40U/μL)	1μL
		AMV RTase XL(5U/μL)	1μL
Bst DNA polymerase(8U/μL)	1μL
		RNA	1μL
DEPC dH 2O	5.4μL
		Total	25μL

Amplification condition to RT-LAMP is optimized, and adopts same template, identical component configuration, and (59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃ and 65 ℃) isothermal reaction 1h at different temperature respectively is to determine optimal reaction temperature; Adopt same template, identical component to configure, difference isothermal reaction 30min, 45min, 60min, 90min and 120min at the temperature of optimizing are to determine optimum reacting time.

Be put on ABI7500 real-time fluorescence PCR instrument add PicoGreen in the RT-LAMP of temperature optimization and time-optimized test product after and make solubility curve, to help the relative quantity of judgement amplified production.

1.7RT-LAMP result is observed

Amplification uses 3 kinds of methods to observe.

Method 1: get amplified production 8 μ L and carry out gel electrophoresis, then ethidium bromide staining, observe under the ultraviolet projecting lamp, hangover occurs near the point sample hole, and the sample that occurs the gradient band away from the point sample hole is judged to the positive;

Method 2: add double-stranded DNA (dsDNA) dyestuff PicoGreen in reaction tubes, the sample that emerald green color occurs is judged to the positive;

Method 3: the sample of PicoGreen dyeing is put into makes solubility curve on ABI7500, the sample that presents flat line is negative, occurs unimodal sample positive, and this paper introduces the relative quantity of this method demonstration amplified production.

1.8RT-LAMP specific test

Extract PFRV, HRV, IHNV, VHSV, SVCV, IPNV and VNNV nucleic acid and carry out PFRV RT-LAMP detection as template, observations is determined the specificity of primer.

1.9RT-LAMP sensitivity test and with the comparison of RT-PCR, real-time fluorescence RT-PCR sensitivity

Get PFRV virus liquid 250 μ L, extract viral RNA, make 10 times of serial dilutions, get each gradient dilution liquid 1 μ L and carry out RT-LAMP as template, determine to set up the sensitivity of RT-LAMP detection method.Carry out simultaneously RT-PCR and real-time fluorescence RT-PCR, relatively the sensitivity of 3 kinds of detection methods of PFRV.

2 results

2.1 virus titer measurement result

The virus titer that adopts the Reed-MuenchShi method to calculate PFRV is 10 ^5.5TCID ₅₀/ 0.1mL.

2.2RT-LAMP reaction condition optimization

The RT-LAMP temperature of reaction is optimized, add in the reaction tubes that reaction is completed and be put into ABI7500 after dyestuff PicoGreen and do the solubility curve analysis, and carry out gel electrophoresis, electrophoresis result shows, in the temperature range of 59 ℃-65 ℃, the feature electrophoretic band is all very bright, reaches the requirement (Fig. 3 A) of detection; The solubility curve result shows, the rising with temperature of reaction from 59 ℃ to 63 ℃, and amplified production increases gradually, and 63 ℃ to the 65 ℃ risings with temperature of reaction, the product of amplification reduces (Fig. 3 B) on the contrary gradually.Thereby can determine that 63 ℃ are optimal reaction temperature.Carry out the RT-LAMP optimizing reaction time under 63 ℃ of constant temperatures, amplified production is carried out solubility curve and gel electrophoresis analysis, electrophoresis result shows, in the 30min-120min time range, all can see the feature band, the reaction times is when being 30min and 45min, produce primer dimer, showing has primer residue, reacts insufficient, reaction times when being 60min, 90min and 120min, does not all find primer dimer (Fig. 4 A); Find out from the result of solubility curve, the reaction times is 30min-60min, and along with the increase of time, amplified production increases considerably, but the increase limited (Fig. 4 B) of product after 60min.In order to save time, selection 60min is the reaction times.Therefore the top condition of determining the RT-LAMP reaction is 63 ℃ of isothermal reaction 60min.

2.3 different observational techniques as a result relatively

1 positive and 1 negative sample are reacted by the RT-LAMP response procedures after optimizing, relatively judge the feasibility of these methods by the result of making solubility curve (Fig. 5 C) after gel electrophoresis (Fig. 5 A), dyestuff PicoGreen dyeing (Fig. 5 B) and PicoGreen dyeing to the ABI7500.Result shows, judges the amplified production of RT-LAMP with these methods, obtains consistent result, and the difference between the positive and feminine gender is fairly obvious, can be the trusted methods of these methods as the judgement of RT-LAMP amplification.

2.4 the specific test of RT-LAMP

Extract PFRV, HRV, IHNV, VHSV, SVCV, IPNV and VNNV nucleic acid and carry out PFRV RT-LAMP reaction as template, the RT-LAMP method that checking is set up detects the specificity of PFRV, result shows, the RT-LAMP method that this paper sets up can only be carried out special amplification to PFRV, sees Fig. 6.

2.5 the sensitivity test of RT-LAMP reaches the comparison with RT-PCR, real-time fluorescence RT-PCR sensitivity

Getting titre is 10 ^5.5TCID ₅₀The PFRV viral suspension 250 μ L extractings of/0.1mL add 25 μ LDEPC water dissolution, get 10 times of serial dilutions of 10 μ L nucleic acid, and every extent of dilution is got 1 μ L and adopted the reaction conditions after optimizing to carry out RT-LAMP, and the positive greatest dilution of detected result is 10 ^-4(Fig. 7), corresponding sensitivity is 10 ^0.5TCID ₅₀Carry out simultaneously RT-PCR and real-time fluorescence RT-PCR, found that sampling 10 μ L carry out RT-PCR and real-time fluorescence RT-PCR, the positive greatest dilution of detected result is respectively 10 ^-3(Fig. 8) He 10 ^-4(Fig. 9), corresponding sensitivity is respectively 10 ^2.5TCID ₅₀With 10 ^1.5TCID ₅₀

3 discuss

In China, fishes virus SVCV has caused the attention of people's height, and in annual spring and autumn, national carp is carried out the SVCV monitoring.But the fishes virus PFRV very high with the SVCV sibship also do not cause people's attention at present, do not include the scope of detection in.In succession separate (Ahne, 1975 along with learning relevant virus to these 2 kinds of serum virus; Ahne et al., 1982; Fijan et al., 1984; Ahne and Thomsen, 1986; Haenen and Davidse, 1989; Jorgensen et a1., 1989; Rowley et al., 2001; Stone et al., 2003; Way et al., 2003), people can get more and more to the concern of these viruses.Thereby need to set up practicable detection method.

The present invention is directed to PFRV G gene 200bp with 6 interior zone design 2 pairs of primers, unique design of primers makes this detection method have good specificity, specific test has also been verified this point.Use the RT-LAMP method of setting up and detect PFRV, remolding sensitivity RT-PCR is high 100 times, and is higher 10 times than real-time fluorescence RT-PCR, can be used for the detection of fish latent infection PFRV.The RT-LAMP reaction times only needs 1h, and is consuming time shorter than real-time fluorescence (1.5h-2h) and RT-PCR (2h-3h).The instrument of using the LAMP Technology Need is not high yet, and general PCR instrument or thermostatic equipment such as water-bath or thermostat container just can react, thereby this technology has good application prospect.

We are not difficult to find out and use the LAMP technology to increase from the electrophoresis picture, and the product amount is than much more times of general PCR product amount, thereby how to observe amplification, avoid Aerosol Pollution to seem extremely important.There are at present 3 kinds of methods to observe amplification, visual inspection magnesium pyrophosphate white precipitate; Double-stranded DNA dyeing and gel electrophoresis.These 3 kinds of methods all have shortcoming when clinical use.Visual inspection magnesium pyrophosphate white precipitate has subjective error, erroneous judgement may occur, and use Instrument measuring turbidity can be more accurate.Existing bibliographical information uses the thermostatical instrument that can observe turbidity to carry out LAMP, and the precipitation that amplification procedure is produced is carried out Real Time Observation (Parida et al., 2004,2006,2007; Fukuda etal., 2006).Adopt the decision procedure as a result of dyeing and gel electrophoresis, all need to open test tube cap, easily form aerosol, add that the sensitivity of this method is also very high, be easy to make detection after this false positive to occur.Thereby the prerequisite that LAMP becomes the clinical detection method is not need to open test tube cap when observing amplification, and in addition, the colour-change after preferably adopting the Instrument observation turbidity or adding dyestuff is avoided the erroneous judgement that human factor causes.The product observational technique of recommendation gel electrophoresis not in clinical application.

4 brief summaries

According to 6 zones of PFRV G gene, designed 1 cover LAMP primer (2 inner primer, 2 outer primers); Temperature of reaction and time are optimized, determine that optimum reaction condition is 63 ℃ of reaction 60min.Carry out specific test and sensitivity test according to optimizing good RT-LAMP condition, result shows: when detecting IHNV, SVCV, VHSV, VNNV, IPNV, HRV and PFRV, only have the detected result of PFRV positive; Detection sensitivity to extracting nucleic acid in viral suspension is 10 ^0.5TCID ₅₀, than highly sensitive 100 times of RT-PCR, than highly sensitive 10 times of real-time fluorescence RT-PCR.

Embodiment 2

The detection kit of a kind of pike juvenile rhabdovirus (Pike fry rhabdovirus, PFRV), this test kit comprises following two pairs of primers:

Primer	Sequence 5 '-------3 '
		PFRV F3	CAATTTGGCTAACAGATCATATCCT (Seq ID No.1)
PFRV B3	TTCTCGATCCAGTCTCCACG (Seq ID No.2)
		PFRV FIP	GAGCATTTCCATACATGGTCCC GAGGAATGCGACCAACACATC Flc(Seq ID No.3) F2(Seq ID No.4)
PFRV BIP	CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC B1c(Seq ID No.5) B2(Seq ID No.6)

Inner primer FIP and BIP contain respectively 2 different sequences, are respectively F1c+F2 and B1c+TTTT+B2.This test kit also comprises working instructions.The RT-LAMP that this test kit can be used for the pike juvenile rhabdovirus detects.

Above content is in conjunction with concrete embodiment further description made for the present invention, can not assert that concrete enforcement of the present invention is confined to these explanations.For the general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, can also make some simple deduction or replace, all should be considered as belonging to protection scope of the present invention.

Attached 1 viral list of abbreviations

Initialism	English name	Chinese name
			PFRV	Pike fry rhabdovirus	The pike juvenile rhabdovirus
IHNV	Infetious hematopoietic necrosis	Infectious hematopoietic necrosis's poison
			IPNV	Infectious pancreatic necrosis virus	Infectious pancreas necrosis virus
SVCV	Spring viraemia of carp virus	SVCV
			VHSV	Viral haemorrhagic septicemia virus	Viral hemorrhagic septicemia, VHS virus
VNNV	Viral nervous necrosis virus	The viral nervous necrosis poison
			HRV	Hirame rhabdovirus	Flounder rhabdovirus

Attached 2 cells and other list of abbreviations

Initialism	English name	Chinese name
			BF-2	Blue gill fry	Copper kiss phosphorus gill sunfish inoblast
CO	Overy of grass carp	The grass carp gonadal cell
			CHSE-214	Chinook salmon embryo	The king salmon embryonic cell
EPC	Epithelioma papulosum cyprini	Carp epithelioma cell
			FHM	Fathead minnow	Seawater cyprinid fish cell
GCF	Grass carp fin	Grass carp fin ray cell
			PG	Pike gonad	The pike gonadal cell
SSN-1	Stripped snakehead	Line sweet wine cell
			N	Nucleoprotein	Nucleoprotein
P	Phosphoprotein	Phosphorylated protein
			M	Matrix protein	Stromatin
G	Glycoprotein	Glycoprotein
			L	RNA-dependent RNA polymerase	The RNA polymerase that RNA relies on
NV	Non-virion	Non-virion protein
			ELISA	Enzyme-linked immunosorbent assay	Enzyme linked immunosorbent assay
RT-PCR	Reverse transcription polymerase chain	Inverse transcription polymerase chain reaction
			LAMP	Loop-mediated isothermal amplification	Ring matchmaker constant-temperature amplification
FIP	Forward inner primer	Front inner primer
			BIP	Backward inner primer	Rear inner primer
RACE	Rapid-amplification of cDNA ends	CDNA end rapid amplifying
			IUdR	5-iodo-2’-deoxyuridine	5 '-iodo-2 '-deoxidation uridylic

Sequence table

＜110〉Animal ﹠. Plant Inspection and Quarantine Techn Center, Shenzhen Bureau of Impor

＜120〉pike juvenile rhabdovirus reverse transcription ring enzyme constant-temperature amplification detection method and test kit

<130>DHC0910507

<160>6

<170>PatentIn version 3.3

<210>1

<211>25

<212>DNA

＜213〉artificial sequence

<400>1

caatttggct aacagatcat atcct 25

<210>2

<211>20

<212>DNA

＜213〉artificial sequence

<400>2

ttctcgatcc agtctccacg 20

<210>3

<211>22

<212>DNA

＜213〉artificial sequence

<400>3

gagcatttcc atacatggtc cc 22

<210>4

<211>21

<212>DNA

＜213〉artificial sequence

<400>4

gaggaatgcg accaacacat c 21

<210>5

<211>21

<212>DNA

＜213〉artificial sequence

<400>5

caagttccaa gatgcctgtc g 21

<210>6

<211>20

<212>DNA

＜213〉artificial sequence

<400>6

cttgattcca tccatcccac 20

Claims (10)

1. pike juvenile rhabdovirus (Pikefryrhabdovirus, PFRV) the non-diagnosis of reverse transcription ring matchmaker constant-temperature amplification (RT-LAMP), the detection method of therapeutic purpose, described method comprises utilizes Auele Specific Primer, carry out reverse transcription ring matchmaker isothermal amplification reactions take virus genome RNA as template, described Auele Specific Primer comprises a pair of inner primer and a pair of outer primer, it is characterized in that: described outer primer is respectively the sequence shown in Seq ID No.1 and Seq IDNo.2

Seq ID No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’

Seq ID No.2：5’---TTCTCGATCCAGTCTCCACG---3’。

2. the detection method of non-diagnosis according to claim 1, therapeutic purpose, it is characterized in that: described inner primer comprises front inner primer FIP and rear inner primer BIP,

Described front inner primer FIP has the sequence shown in Seq ID No.3 and Seq ID No.4, is connected by 0～4 base between Seq ID No.3 and Seq ID No.4;

Described rear inner primer BIP has the sequence shown in Seq ID No.5 and Seq ID No.6, is connected by 0～4 base between Seq ID No.5 and Seq ID No.6;

Seq ID No.3：5’---GAGCATTTCCATACATGGTCCC---3’

Seq ID No.4：5’---GAGGAATGCGACCAACACATC---3’

Seq ID No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’

Seq ID No.6：5’---CTTGATTCCATCCATCCCAC---3’。

3. the detection method of non-diagnosis according to claim 2, therapeutic purpose, it is characterized in that: described outer primer is respectively the sequence shown in Seq ID No.1 and Seq ID No.2,

The sequence of described front inner primer FIP is:

GAGCATTTCCATACATGGTCCCGAGGA ATGCGACCA ACACATC

Seq ID No.3 Seq ID No.4

The sequence of described rear inner primer BIP is:

CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC。

Seq ID No.5 Seq ID No.6

4. the detection method of the described non-diagnosis of according to claim 1 ~ 3 any one, therapeutic purpose is characterized in that: the thermostat temperature of described reverse transcription ring matchmaker isothermal amplification reactions is 59 ℃ ~ 65 ℃.

5. the detection method of non-diagnosis according to claim 4, therapeutic purpose, it is characterized in that: the time of described reverse transcription ring matchmaker isothermal amplification reactions is 30min-120min.

6. the detection method of non-diagnosis according to claim 5, therapeutic purpose, it is characterized in that: the thermostat temperature of described reverse transcription ring matchmaker isothermal amplification reactions is 63 ℃, and the time of reaction is 60min.

7. the detection kit of pike juvenile rhabdovirus (Pikefryrhabdovirus, PFRV), it is characterized in that: described test kit comprises the pair of primers that is respectively sequence shown in Seq ID No.1 and Seq ID No.2,

Seq ID No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’

Seq ID No.2：5’---TTCTCGATCCAGTCTCCACG---3’。

8. detection kit according to claim 7 is characterized in that: described detection kit is used for reverse transcription ring matchmaker isothermal amplification reactions, and described primer is outer primer.

9. detection kit according to claim 8, it is characterized in that: described detection kit also contains a pair of inner primer, and described inner primer comprises front inner primer FIP and rear inner primer BIP,

Described front inner primer FIP has the sequence shown in Seq ID No.3 and Seq ID No.4, is connected by 0～4 base between Seq ID No.3 and Seq ID No.4;

Described rear inner primer BIP has the sequence shown in Seq ID No.5 and Seq ID No.6, is connected by 0～4 base between Seq ID No.5 and Seq ID No.6;

Seq ID No.3：5’---GAGCATTTCCATACATGGTCCC---3’

Seq ID No.4：5’---GAGGAATGCGACCAACACATC---3’

Seq ID No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’

Seq ID No.6：5’---CTTGATTCCATCCATCCCAC---3’。

10. detection kit according to claim 9 is characterized in that:

Described outer primer is respectively the sequence shown in Seq ID No.1 and Seq ID No.2,

The sequence of described front inner primer FIP is:

GAGCATTTCCATACATGGTCCCGAGGA ATGCGACCA ACACATC

Seq ID No.3 Seq ID No.4

The sequence of described rear inner primer BIP is:

CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC。

Seq ID No.5 Seq ID No.6

Images