CN102108415A - Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) - Google Patents
Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) Download PDFInfo
- Publication number
- CN102108415A CN102108415A CN2009101893402A CN200910189340A CN102108415A CN 102108415 A CN102108415 A CN 102108415A CN 2009101893402 A CN2009101893402 A CN 2009101893402A CN 200910189340 A CN200910189340 A CN 200910189340A CN 102108415 A CN102108415 A CN 102108415A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- inner primer
- lamp
- pfrv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and a kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV), wherein an adopted outer primer contains sequences indicated by Seq ID No.1 and Seq ID No.2 respectively. According to the method and the kit which are provided by the invention, PFRV can be detected specifically; and the sensitivity is high and particularly reaches 100.5TCID50 when the kit is used for detecting the extracted nucleic acid in a virus suspension.
Description
Technical field
The present invention relates to the detection method and the detection kit of virus, particularly relate to pike juvenile fish rhabdovirus reverse transcription ring enzyme constant-temperature amplification detection method and test kit.
Background technology
According to the international virusology classification council (Rhabdoviridae (Rhabdoviridae) is divided into 6 genus for International comittee on taxonomy ofviruses, ICTV) the 8th report, comprise infection plant Cytorhabdovirus (
Cytorhabdovirus) and Nucleorhabdovirus (
Nucleorhabdovirus), and infect vertebrate vesicular stomatitis virus belong to (
Vesiculovirus), Lyssavirus (
Lyssavirus), Ephemerovirus (Ephemerovirus) and the grain outer Rhabdovirus (also claiming the non-virion protein Rhabdovirus) (
Novirhabdovirus), also have the part rhabdovirus still unfiled, as Sigma virus, Flanders virus etc.The rhabdovirus that hitherto reported infects fish has tens kinds, comprise infectious hematopoietic necrosis's poison (Infetioushematopoietic necrosis virus, IHNV), viral haemorrhagic septicaemia virus (Viralhaemorrhagic septicemia virus, VHSV), flounder rhabdovirus (Hirame rhabdovirus, HRV), snakehead fish rhabdovirus (Snakehead rhabdovirus, SHRV), SVCV (Spring viraemia of carp virus, SVCV), pike juvenile fish rhabdovirus (Pike fryrhabdovirus, PFRV), (Rhabdovirus 903/87 for rhabdovirus 903/87,903/87), mandarin fish rhabdovirus (Siniperca chuatsi rhabdovirus, SCRV), mullet rhabdovirus (Chinesesucker rhabdovirus) and bull trout rhabdovirus 28/97 (Sea trout rhabdovirus 28/97, (Granoff and Webster, 1999 such as STRV); Zhang Qiya and Li Zhengqiu, 1999; Zhang et al., 2000; Johansson et al., 2001,2002).In the 6th report of ICTV, SVCV, PFRV are listed in vesicular stomatitis virus and belong to tentative species (Wunner et al., 1995).In the 7th report of ICTV, formally IHNV, VHSV, HRV, SHRV are classified as the outer Rhabdovirus of grain, SVCV, PFRV etc. still is classified as the tentative species (Walker et al., 2000) that vesicular stomatitis virus belongs to.The classification position of other kinds of fish Rhabdovirus is not determined as yet.
Along with the fast development of fish farming industry, the fish virus disease has become the maximum disease of cultured fishes.Owing to lack effective methods of treatment, the control of fish virus disease is putting prevention first, thereby the diagnosis of virus has been studied the field of enlivening very much with detection technique in the fish virus research.Kinds of fish Rhabdovirus has very strong pathogenic, and particularly VHSV, IHNV, HRV, SHRV and SVCV are widely current all over the world, causes great financial loss for the aquatic products aquaculture.Thereby these viral epidemiology enjoy the concern of researcher.
Pike juvenile fish rhabdovirus (PFRV) is a kind of and the very high virus of SVCV (SVCV) homology, does not cause also that at present people pay much attention to.PFRV mainly popular in European pike juvenile fish (Wolf, 1988).Should virus infect the pike juvenile fish in Holland in 1972, and cause extensive death, from then on the first strain PFRV criticizes and separates (De Kinkelin, 1973) in the ill pike juvenile fish.PFRV and SVCV sibship are nearest, the proteic homology of G＞70%.PFRV, SVCV and the kinds of fish Rhabdovirus G protein part nucleotide sequence relevant with their serology are carried out phylogenetic analysis, the result shows that they form 4 genotype, PFRV and SVCV form a genotype respectively, be respectively genotype III and I, other viruses form genotype II and IV (Stone et al., 2003).SVC mainly infects cyprinid fish, is classified as the disease that must declare by OIE, and the Ministry of Agriculture classifies SVC as the secondary animal epidemic.Along with the pay attention to day by day to SVC, to the increasing of SVCV control and monitoring, the virus that these and SVCV sibship are high also will more and more cause people's attention.Thereby seek special, sensitivity detection method fast, very crucial for the generation and the development of prevention and control disease.
In China, fish virus SVCV has caused the attention of people's height, and in annual spring and autumn national carp is carried out the SVCV monitoring.But the fish virus PFRV very high with the SVCV sibship also do not cause people's attention at present, do not include the scope of detection in.Separate (Ahne, 1975 in succession along with learning relevant virus with these 2 kinds of serum virus; Ahne et al., 1982; Fijan et al., 1984; Ahne and Thomsen, 1986; Haenen and Davidse, 1989; Jorgensen et al., 1989; Rowley et al., 2001; Stone et al., 2003; Way et al., 2003), people can get more and more to the concern of these viruses.Thereby need set up practicable detection method.
At present, identify that PFRV reaches the virus relevant with its serology and generally takes to separate with sensitive cells earlier, then mode (De Kinkelin, 1973 of identifying with serological method; Ahne, 1975; Ahne etal., 1982; Fijan et al., 1984; Ahne and Thomsen, 1986; Haenen and Dayidse, 1989; Jorgensen et al., 1989; Rowley et al., 2001; Stone et al., 2003; Way et al., 2003).Adopt this detection mode not only the cycle long, and use immunological method, as indirect fluorescent antibody test or enzyme linked immunosorbent assay, exist between PFRV and the SVCV cross reaction (
Et al., 1989; Way, 1991), detected result is inaccurate.
(Loop-mediated isothermal amplification LAMP) is a kind of novel nucleic acid amplification technologies (Notomi et al., 2000) of report in 2000 to ring matchmaker isothermal amplification technology.This technology is at 4 special primers of 6 zone design of DNA target sequence, comprise 1 pair of inner primer and 1 pair of outer primer, inner primer comprises preceding inner primer FIP (Forward inner primer) and back inner primer BIP (Backward inner primer), outer primer comprises F3 and B3, shown in Figure 1A.FIP is made up of 2 primers, be respectively F1C (complementary sequence of target gene F1 sequence) and F2 (identical) with the target sequence sequence, TTTT link F1C and F2, in like manner BIP is made of B1C-TTTT-B2, TTTT is not essential as connecting Nucleotide, when not enough 30 Nucleotide of the ring that forms, increase the length that 4 Nucleotide can increase ring.Outer primer B3 and F3 identified region are positioned at the inner primer outside, respectively with target sequence B3C, F3C complementation.Also note a principle during design primer, amplification section F2-R2 preferably is controlled in 200 Nucleotide.The mechanism (shown in Figure 1B) of LAMP method amplification: 1, the B2 among the primer BIP (complementary sequence of B2c) combines with B2c in the template DNA, the synthesizing of initial complementary strand; 2, B3 (complementary sequence of B3c) combines with B3c, starts strand replacement reaction; 3, strand replacement reaction produces 1 pair of two strands and 1 strand, and there is complementary nucleotide at the strand two ends, forms dumbbell shaped; 4, the synthetic a kind of transitional loop-stem structure DNA jaggy of the B2c on the ring of B2 among the primer BIP and double-stranded loop-stem structure DNA; 5, contain 1 pair of reverse complementary sequence on the stem of transitional loop-stem structure, end over there forms 1 ring texture by FIP.Extend in the building-up process in self-primer displacement subsequently, under the inner primer effect, the beginning circulating reaction, the length of stem and the number of ring all increase gradually, and last product is the mixture that the stem circular DNA of different lengths is formed.
Amplified production can be judged by 3 kinds of methods: 1, agarose gel electrophoresis; 2, add double-stranded DNA dyestuff SYBR Green I in the amplified production; 3, the negative product magnesium pyrophosphate white precipitate of visual inspection amplification.The LAMP method has the incomparable advantage of many other PCR method.1, only need to keep 60 ℃-65 ℃ steady temperature just can carry out amplified reaction, therefore need not expensive equipment, general thermostat such as water-bath or thermostat container just can satisfy the amplification requirement; 2, at 4 primers of 6 section designs of target sequence, the specificity of amplification further improves than other PCR method; 3, whole amplification can be finished about 1h, and productive rate can reach 0.15mg/mL, and amplification efficiency improves greatly.When 4, carrying out RT-LAMP, after increasing ThermoScript II and RNA enzyme inhibitors, do not need the time of specialized designs reverse transcription, the time of entire reaction does not need to increase yet, and further improves the efficient that detects; 5, when nucleic acid is synthetic in a large number, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, producing by product---the magnesium pyrophosphate precipitation, because the amplification efficiency height, the magnesium pyrophosphate precipitation of generation is many, detects by an unaided eye or turbidimeter detects turbidity and just can judge whether to increase.
Summary of the invention
The objective of the invention is at the deficiencies in the prior art, reverse transcription ring matchmaker constant-temperature amplification (RT-LAMP) detection method of a kind of pike juvenile fish rhabdovirus is provided.
Another object of the present invention is to provide the detection kit of a kind of pike juvenile fish rhabdovirus.
For achieving the above object, the present invention has adopted following technical scheme:
The invention discloses pike juvenile fish rhabdovirus (Pike fry rhabdovirus, PFRV) reverse transcription ring matchmaker constant-temperature amplification detection method, described method comprises utilizes Auele Specific Primer, with the virus genome RNA is that template is carried out reverse transcription ring matchmaker isothermal amplification reactions, described Auele Specific Primer comprises a pair of inner primer and a pair of outer primer, described outer primer contains the sequence shown in Seq ID No.1 and the Seq ID No.2 respectively
Seq?ID?No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’
Seq?ID?No.2：5’---TTCTCGATCCAGTCTCCACG---3’。
Inner primer FIP and back inner primer BIP before described inner primer comprises,
Inner primer FIP preferably contains the sequence shown in Seq ID No.3 and the Seq ID No.4 before described, links to each other by 0～4 base between Seq ID No.3 and the Seq ID No.4;
Described back inner primer BIP preferably contains the sequence shown in Seq ID No.5 and the Seq ID No.6, links to each other by 0～4 base between Seq ID No.5 and the Seq ID No.6;
Seq?ID?No.3：5’---GAGCATTTCCATACATGGTCCC---3’
Seq?ID?No.4：5’---GAGGAATGCGACCAACACATC---3’
Seq?ID?No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’
Seq?ID?No.6：5’---CTTGATTCCATCCATCCCAC---3’。
In the preferred embodiment of the present invention, described outer primer has the sequence shown in Seq ID No.1 and the SeqID No.2 respectively,
The sequence of inner primer FIP is before described:
GAGCATTTCCATACATGGTCCCGAGGAATGCGACCAACACATC
Seq?ID?No.3 Seq?ID?No.4
The sequence of described back inner primer BIP is:
CAAGTTCCAAGATGCCTGTCGTTTT
CTTGATTCCATCCATCCCAC
Seq?ID?No.5 Seq?ID?No.6
The thermostat temperature of described reverse transcription ring matchmaker isothermal amplification reactions is preferably 59 ℃～65 ℃, and more preferably 63 ℃, the time of reaction is preferably 30min-120min, more preferably 60min.
The invention also discloses a kind of pike juvenile fish rhabdovirus (described test kit comprises a pair of primer that contains sequence shown in Seq ID No.1 and the Seq ID No.2 respectively for Pike fry rhabdovirus, detection kit PFRV),
Seq?ID?No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’
Seq?ID?No.2：5’---TTCTCGATCCAGTCTCCACG---3’。
Described detection kit is preferred for reverse transcription ring matchmaker isothermal amplification reactions, and described primer is an outer primer.
Described detection kit preferably also contains a pair of inner primer, inner primer FIP and back inner primer BIP before described inner primer comprises,
Inner primer FIP preferably contains the sequence shown in Seq ID No.3 and the Seq ID No.4 before described, links to each other by 0～4 base between Seq ID No.3 and the Seq ID No.4;
Described back inner primer BIP preferably contains the sequence shown in Seq ID No.5 and the Seq ID No.6, links to each other by 0～4 base between Seq ID No.5 and the Seq ID No.6;
Seq?ID?No.3：5’---GAGCATTTCCATACATGGTCCC---3’
Seq?ID?No.4：5’---GAGGAATGCGACCAACACATC---3’
Seq?ID?No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’
Seq?ID?No.6：5’---CTTGATTCCATCCATCCCAC---3’。
Above-mentioned 0～4 base is not essential as connecting Nucleotide, and when not enough 30 Nucleotide of the ring that forms, 0～4 Nucleotide that is increased can increase the length of ring, and described 0～4 base is preferably TTTT.
In the preferred embodiment of the present invention, described outer primer has the sequence shown in Seq ID No.1 and the SeqID No.2 respectively,
The sequence of inner primer FIP is before described:
GAGCATTTCCATACATGGTCCCGAGGAATGCGACCAACACATC
Seq?ID?No.3 Seq?ID?No.4
The sequence of described back inner primer BIP is:
CAAGTTCCAAGATGCCTGTCGTTTT
CTTGATTCCATCCATCCCAC
Seq?ID?No.5 Seq?ID?No.6
Owing to adopted above technical scheme, the beneficial effect that the present invention is possessed is:
When reverse transcription ring matchmaker constant-temperature amplification (RT-LAMP) detection method of the present invention and test kit are used to detect PFRV, because unique design of primers makes detection method have excellent specificity, when being used to detect IHNV, SVCV, VHSV, VNNV, IPNV, HRV and PFRV, have only the detected result of PFRV positive.Method of the present invention and test kit are highly sensitive, are 10 to the detection sensitivity of extracting nucleic acid in the viral suspension
0.5TCID
50 'Than highly sensitive 100 times of RT-PCR, than highly sensitive 10 times of real-time fluorescence RT-PCR.Method of the present invention and test kit are short detection time, and the RT-LAMP reaction times only needs 1h, and is consuming time shorter than real-time fluorescence (1.5h-2h) and RT-PCR (2h-3h).The instrument of using the LAMP Technology Need is not high yet, and general PCR instrument or thermostatic equipment such as water-bath or thermostat container just can react.
Description of drawings
Fig. 1 is a LAMP reaction process schematic diagram, and wherein A is a LAMP primer location synoptic diagram, and B is a LAMP reaction process synoptic diagram.
Fig. 2 is the position view of a kind of RT-LAMP primer of the present invention in the PFRV genome.
Fig. 3 A is the temperature optimization test-results electrophoretic image of RT-LAMP of the present invention; 1:MarkerDL2000; 2:59 ℃; 3:60 ℃; 4:61 ℃; 5:62 ℃; 6:63 ℃; 7:64 ℃; 8:65 ℃.
Fig. 3 B is the solubility curve of RT-LAMP temperature optimization amplified production of the present invention at ABI7500.
Fig. 4 A is the time-optimized test-results electrophoretic image of RT-LAMP of the present invention; 1:MarkerDL2000; 2:30min; 3:45min; 4:60min; 5:90min; 6:120min.
Fig. 4 B is the solubility curve of the time-optimized amplified production of RT-LAMP of the present invention at ABI7500.
Fig. 5 is the different RT-LAMP comparisons of observational technique as a result, A, gel electrophoresis, and B, PicoGreen dye (1 is emerald green), the C solubility curve.
The specificity test-results electrophoretic image that Fig. 6 detects for PFRV RT-LAMP of the present invention; 1:PFRV; 2:HRV; 3:IHNV; 4:VHSV; 5:SVCV; 6:IPNV; 7:VNNV; 8:Negativecontrol; 9:Marker DL2000.
Fig. 7 is a PFRV RT-LAMP sensitivity test of the present invention electrophoretic image as a result; 1:MarkerDL2000,2:10
03:10
-14:10
-25:10
-36:10
-47:10
-58:10
-69:Negativecontrol.
Fig. 8 is a PFRV primers F 2/R2RT-PCR sensitivity experiment electrophoretic image as a result; 1:DNAMarker; 2:10
03:10
-14:10
-25:10
-36:10
-47:10
-58:10
-69:Negativecontrol.
The sensitivity experiment that Fig. 9 detects for the PFRV real-time fluorescence RT-PCR is figure as a result.
Embodiment
1 material and method
1.1 virus and cell
PFRV is the F4 strain, is given by Inst. of Hydrobiology, Chinese Academy of Sciences, and SVCV and IHNV are so kind as to give with reference to OIE reference laboratory professor B.Hill of strain by Britain CEFAS; VHSV with reference to strain by the veterinary institute OIE of Norway country reference laboratory Roar doctor Gudding be so kind as to give, IPNV, HRV, VNNV separate by this chamber.
IHNV, SVCV, VHSV, VNNV, IPNV, HRV and PFRV use EPC, CO, RTG-2, SSN-1, CHSE-214, FHM and BF-2 cell amplification respectively.The SSN-1 cell is available from hydrocoles health research institute of Thailand Kasetsart university, the RTG-2 cell is given by hydrobiont institute, the BF-2 cell is given by quarantine institute's (Brescia) cell preservation center, CHSE-214 cell, EPC cell by Britain's environment, fishery and aquaculture research establishment give, the FHM cell given by Univ Munich Germany and Inst. of Hydrobiology, Chinese Academy of Sciences, the CO cell is given by Inst. of Hydrobiology, Chinese Academy of Sciences.
EPC, CO, CHSE-214, FHM, BF-2 and RTG-2 cell are all cultivated with 199 nutrient solutions that contain 10% foetal calf serum, and the SSN-1 cell is cultivated with the L-15 nutrient solution that contains 10%FBS.Behind the virus inoculation, with added with antibiotic (100IU/mL penicillin; 100 μ g/mL Streptomycin sulphates) corresponding nutrient solution is cultivated.
1.2 equipment and reagent
Equipment: ABI7500 quantitative fluorescent PCR, Eppendorf PCR instrument, BDA TI1 type gel imaging instrument (Biometra).
Reagent: MgSO
4, Betaine, fluorescence dye PicoGreen purchase the company in American I nvitrogen; The big fragment of Bst archaeal dna polymerase and 10 * ThermoPol reaction buffer (100mmol/L KCl, 200mmol/L Tris-HCl, 100mmol/L (NH4)
2SO
4, 20mmol/L MgSO
4, 1%TritonX-100,8.8,25 ℃ of pH) purchase in Niu Yinglun Bioisystech Co., Ltd (NEB); ThermoScript II, nucleic acid inhibitor are available from the precious biotech firm in Dalian; Experiment institute water is the DEPC treating water; Experimental ware all passes through high-temperature sterilization 2 times.
1.3RT-LAMP primer design
According to PFRV G gene (AJ538069) among the Genbank, use Primer Explore V3 and Primer Premier 5.0 softwares at wherein 2 pairs of primers of 6 zone design, i.e. 1 pair of outer primer, 1 pair of inner primer.Synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Primer sequence sees Table 1.Position and the amplification principle schematic of primer in the PFRV genome seen Fig. 2.
Table 1PFRV RT-LAMP detects primer
| Primer | Sequence 5 '-------3 ' |
| ?PFRV?F3 | CAATTTGGCTAACAGATCATATCCT (Seq?ID?No.1) |
| ?PFRV?B3 | TTCTCGATCCAGTCTCCACG (Seq?ID?No.2) |
| ?PFRV?FIP | GAGCATTTCCATACATGGTCCC? GAGGAATGCGACCAACACATC F1c(Seq?ID?No.3) F2(Seq?ID?No.4) |
| ?PFRV?BIP | CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC B1c(Seq?ID?No.5) B2(Seq?ID?No.6) |
Inner primer FIP contains 2 different sequences respectively with BIP, is respectively F1c+F2 and B1c+TTTT+B2.
1.4 the extraction of viral nucleic acid
Specification sheets with reference to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit is operated.
1.5 the mensuration of virus titer
Virus titer is measured and is adopted the terminal point dilution method, with reference to the method for Reed and Muench (1938).Concrete grammar is as follows:
1) pass the BF-2 cell and go into 96 orifice plates, place 25 ℃ of incubators cultivate (＜24h);
2) 10 times of serial dilution viruses to be measured;
3) each dilution viral suspension is inoculated into cell and grows up in 96 orifice plates of single one-tenth, every extent of dilution adds 3 holes, and every hole adds 100 μ L, and control group adds 100 μ L nutrient solutions;
4) place the optimal temperature incubator to cultivate 96 orifice plates, complete until CPE;
5) inverted microscope is observed down, calculates virus titer (TCID
50/ 0.1mL).
1.6 the optimization of RT-LAMP reaction conditions
RT-LAMP adopts 25 μ L reaction systems, and the component dosage of adding is as follows:
| 10×Bst?Buffer | 2.5μL |
| dNTP(10mM/L?each) | 3.5μL |
| MgSO 4(25μmol/μL) | 0.6μL |
| PFRV?F3(5pmol/μL) | 1μL |
| PFRV?B3(5pmol/μL) | 1μL |
| PFRV?FIP(40pmol/μL) | 1μL |
| PFRV?BIP(40pmol/μL) | 1μL |
| Betaine(5M) | 5μL |
| RNasin(40U/μL) | 1μL |
| AMV?RTase?XL(5U/μL) | 1μL |
| Bst?DNA?polymerase(8U/μL) | 1μL |
| RNA | 1μL |
| DEPC?dH 2O | 5.4μL |
| Total | 25μL |
Amplification condition to RT-LAMP is optimized, and adopts same template, identical component configuration, and (59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃ and 65 ℃) isothermal reaction 1h under different temperature respectively is to determine optimal reaction temperature; Adopt same template, identical component to dispose, difference isothermal reaction 30min, 45min, 60min, 90min and 120min under the temperature of optimizing are to determine optimum reacting time.
In the RT-LAMP of temperature optimization and time-optimized test product, be put on the ABI7500 real-time fluorescence PCR instrument behind the adding PicoGreen and make solubility curve, to help to judge the relative quantity of amplified production.
1.7RT-LAMP the result observes
Amplification uses 3 kinds of methods to observe.
Method 1: get amplified production 8 μ L and carry out gel electrophoresis, ethidium bromide staining is observed under the ultraviolet projecting lamp then, hangover occurs near the point sample hole, and the sample that occurs the gradient band away from the point sample hole is judged to the positive;
Method 2: add double-stranded DNA (dsDNA) dyestuff PicoGreen in reaction tubes, the sample that emerald green color occurs is judged to the positive;
Method 3: the painted sample of PicoGreen is put into makes solubility curve on the ABI7500, the sample that presents flat line is negative, and it is positive unimodal sample to occur, and this paper introduces the relative quantity that this method shows amplified production.
1.8RT-LAMP specificity test
Extract PFRV, HRV, IHNV, VHSV, SVCV, IPNV and VNNV nucleic acid and carry out PFRV RT-LAMP detection as template, observations is determined the specificity of primer.
1.9RT-LAMP sensitivity test and with the comparison of RT-PCR, real-time fluorescence RT-PCR sensitivity
Get PFRV virus liquid 250 μ L, extract viral RNA, make 10 times of serial dilutions, get each gradient dilution liquid 1 μ L and carry out RT-LAMP, determine to set up the sensitivity of RT-LAMP detection method as template.Carry out RT-PCR and real-time fluorescence RT-PCR simultaneously, relatively the sensitivity of 3 kinds of detection methods of PFRV.
2 results
2.1 virus titer measurement result
The virus titer that adopts the Reed-MuenchShi method to calculate PFRV is 10
5.5TCID
50/ 0.1mL.
2.2RT-LAMP reaction condition optimization
The RT-LAMP temperature of reaction is optimized, in the reaction tubes that reaction is finished, be put into ABI7500 behind the adding dyestuff PicoGreen and do the solubility curve analysis, and carry out gel electrophoresis, electrophoresis result shows, in 59 ℃-65 ℃ temperature range, the feature electrophoretic band is all very bright, reaches the requirement (Fig. 3 A) of detection; Solubility curve is the result show, the rising from 59 ℃ to 63 ℃ with temperature of reaction, and amplified production increases gradually, and 63 ℃ to the 65 ℃ risings with temperature of reaction, the product of amplification reduces (Fig. 3 B) on the contrary gradually.Thereby can determine that 63 ℃ are optimal reaction temperature.Under 63 ℃ of constant temperatures, carry out the RT-LAMP optimizing reaction time, amplified production is carried out solubility curve and gel electrophoresis analysis, electrophoresis result shows, in the 30min-120min time range, all can see the feature band, the reaction times is when being 30min and 45min, produce primer dimer, showing has primer residue, reacts insufficient, reaction times when being 60min, 90min and 120min, does not all find primer dimer (Fig. 4 A); Find out that from the result of solubility curve the reaction times is 30min-60min, along with the increase of time, amplified production increases considerably, but the increase limited (Fig. 4 B) of product after 60min.In order to save time, selection 60min is the reaction times.Therefore the top condition of determining the RT-LAMP reaction is 63 ℃ of isothermal reaction 60min.
2.3 different observational techniques as a result relatively
1 positive and 1 negative sample are reacted by the RT-LAMP response procedures after optimizing, and the result who makes solubility curve (Fig. 5 C) to the ABI7500 by gel electrophoresis (Fig. 5 A), dyestuff PicoGreen dyeing (Fig. 5 B) and PicoGreen dyeing back relatively judges the feasibility of these methods.The result shows that the amplified production with these methods judgements RT-LAMP obtains consistent result, and the difference between the positive and the feminine gender is fairly obvious, can be the trusted methods of these methods as the judgement of RT-LAMP amplification.
2.4 the specificity of RT-LAMP test
Extract PFRV, HRV, IHNV, VHSV, SVCV, IPNV and VNNV nucleic acid and carry out PFRV RT-LAMP reaction as template, the RT-LAMP method that checking is set up detects the specificity of PFRV, the result shows that the RT-LAMP method that this paper sets up can only be carried out special amplification to PFRV, sees Fig. 6.
2.5 the sensitivity test of RT-LAMP reaches the comparison with RT-PCR, real-time fluorescence RT-PCR sensitivity
Getting titre is 10
5.5TCID
50The PFRV viral suspension 250 μ L extractings of/0.1mL add 25 μ LDEPC water dissolution, get 10 times of serial dilutions of 10 μ L nucleic acid, and every extent of dilution is got 1 μ L and adopted the reaction conditions after optimizing to carry out RT-LAMP, and the positive greatest dilution of detected result is 10
-4(Fig. 7), corresponding sensitivity is 10
0.5TCID
50Carry out RT-PCR and real-time fluorescence RT-PCR simultaneously, found that sampling 10 μ L carry out RT-PCR and real-time fluorescence RT-PCR, the positive greatest dilution of detected result is respectively 10
-3(Fig. 8) with 10
-4(Fig. 9), corresponding sensitivity is respectively 10
2.5TCID
50With 10
1.5TCID
50
3 discuss
In China, fish virus SVCV has caused the attention of people's height, and in annual spring and autumn national carp is carried out the SVCV monitoring.But the fish virus PFRV very high with the SVCV sibship also do not cause people's attention at present, do not include the scope of detection in.Separate (Ahne, 1975 in succession along with learning relevant virus with these 2 kinds of serum virus; Ahne et al., 1982; Fijan et al., 1984; Ahne and Thomsen, 1986; Haenen and Davidse, 1989; Jorgensen et a1., 1989; Rowley et al., 2001; Stone et al., 2003; Way et al., 2003), people can get more and more to the concern of these viruses.Thereby need set up practicable detection method.
The present invention is directed to PFRV G gene 200bp with 6 interior zone design 2 pairs of primers, unique design of primers makes this detection method have excellent specificity, this point has also been verified in the specificity test.Use the RT-LAMP method of setting up and detect PFRV, remolding sensitivity RT-PCR is high 100 times, and is higher 10 times than real-time fluorescence RT-PCR, can be used for the detection of fish latent infection PFRV.The RT-LAMP reaction times only needs 1h, and is consuming time shorter than real-time fluorescence (1.5h-2h) and RT-PCR (2h-3h).The instrument of using the LAMP Technology Need is not high yet, and general PCR instrument or thermostatic equipment such as water-bath or thermostat container just can react, thereby this technology has good application prospects.
We are not difficult to find out and use the LAMP technology to increase from the electrophoresis picture, and the product amount is than much more times of general PCR product amount, thereby how to observe amplification, avoid aerosol to pollute and seem extremely important.There are 3 kinds of methods to observe amplification, visual inspection magnesium pyrophosphate white precipitate at present; Double-stranded DNA dyeing and gel electrophoresis.These 3 kinds of methods all have shortcoming when clinical use.Visual inspection magnesium pyrophosphate white precipitate has subjective error, erroneous judgement may occur, uses the Instrument measuring turbidity can compare accurately.Existing bibliographical information uses the thermostatical instrument that can observe turbidity to carry out LAMP, and the precipitation that amplification procedure produces is carried out Real Time Observation (Parida et al., 2004,2006,2007; Fukuda etal., 2006).Adopt the decision procedure as a result of dyeing and gel electrophoresis, all need to open the test tube lid, form aerosol easily, add that the sensitivity of this method is also very high, be easy to make detection after this false positive to occur.Thereby the prerequisite that LAMP becomes the clinical detection method is not need to open the test tube lid when observing amplification, and in addition, the colour-change after preferably adopting the Instrument observation turbidity or adding dyestuff is avoided the erroneous judgement that human factor causes.In clinical application, do not recommend to use the product observational technique of gel electrophoresis.
4 brief summaries
According to 6 zones of PFRV G gene, designed 1 cover LAMP primer (2 inner primer, 2 outer primers); Temperature of reaction and time are optimized, determine that the peak optimization reaction condition is 63 ℃ of reaction 60min.Carry out specificity test and sensitivity test according to optimizing good RT-LAMP condition, the result shows: when detecting IHNV, SVCV, VHSV, VNNV, IPNV, HRV and PFRV, have only the detected result of PFRV positive; Detection sensitivity to extracting nucleic acid in the viral suspension is 10
0.5TCID
50, than highly sensitive 100 times of RT-PCR, than highly sensitive 10 times of real-time fluorescence RT-PCR.
A kind of pike juvenile fish rhabdovirus (this test kit comprises following two pairs of primers for Pike fry rhabdovirus, detection kit PFRV):
| Primer | Sequence 5 '-------3 ' |
| PFRV?F3 | CAATTTGGCTAACAGATCATATCCT (Seq?ID?No.1) |
| PFRV?B3 | TTCTCGATCCAGTCTCCACG (Seq?ID?No.2) |
| PFRV FIP | GAGCATTTCCATACATGGTCCC? GAGGAATGCGACCAACACATC Flc(Seq?ID?No.3) F2(Seq?ID?No.4) |
| PFRV BIP | CAAGTTCCAAGATGCCTGTCGTTTT CTTGATTCCATCCATCCCAC B1c(Seq?ID?No.5) B2(Seq?ID?No.6) |
Inner primer FIP contains 2 different sequences respectively with BIP, is respectively F1c+F2 and B1c+TTTT+B2.This test kit also comprises working instructions.The RT-LAMP that this test kit can be used for pike juvenile fish rhabdovirus detects.
Above content be in conjunction with concrete embodiment to further describing that the present invention did, can not assert that concrete enforcement of the present invention is confined to these explanations.For the general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, can also make some simple deduction or replace, all should be considered as belonging to protection scope of the present invention.
Attached 1 viral list of abbreviations
| Initialism | English name | Chinese name |
| PFRV | Pike?fry?rhabdovirus | Pike juvenile fish rhabdovirus |
| IHNV | Infetious?hematopoietic?necrosis | Infectious hematopoietic necrosis's poison |
| IPNV | Infectious?pancreatic?necrosis?virus | Infectious pancreas necrosis virus |
| SVCV | Spring?viraemia?of?carp?virus | SVCV |
| VHSV | Viral?haemorrhagic?septicemia?virus | Viral hemorrhagic septicemia, VHS virus |
| VNNV | Viral?nervous?necrosis?virus | The viral nervous necrosis poison |
| HRV | Hirame?rhabdovirus | Flounder rhabdovirus |
Attached 2 cells and other list of abbreviations
| Initialism | English name | Chinese name |
| BF-2 | Blue?gill?fry | Copper kiss phosphorus gill sunfish inoblast |
| CO | Overy?of?grass?carp | The grass carp gonadal cell |
| CHSE-214 | Chinook?salmon?embryo | The king salmon embryonic cell |
| EPC | Epithelioma?papulosum?cyprini | Carp epithelioma cell |
| FHM | Fathead?minnow | Seawater cyprinid fish cell |
| GCF | Grass?carp?fin | Grass carp fin ray cell |
| PG | Pike?gonad | The pike gonadal cell |
| SSN-1 | Stripped?snakehead | Line sweet wine cell |
| N | Nucleoprotein | Nucleoprotein |
| P | Phosphoprotein | Phosphorylated protein |
| M | Matrix?protein | Stromatin |
| G | Glycoprotein | Glycoprotein |
| L | RNA-dependent?RNA?polymerase | The RNA polymerase that RNA relies on |
| NV | Non-virion | Non-virion protein |
| ELISA | Enzyme-linked?immunosorbent?assay | Enzyme linked immunosorbent assay |
| RT-PCR | Reverse?transcription?polymerase?chain | Inverse transcription polymerase chain reaction |
| LAMP | Loop-mediated?isothermal?amplification | Ring matchmaker constant-temperature amplification |
| FIP | Forward?inner?primer | Preceding inner primer |
| BIP | Backward?inner?primer | Back inner primer |
| RACE | Rapid-amplification?of?cDNA?ends | The terminal rapid amplifying of cDNA |
| IUdR | 5-iodo-2’-deoxyuridine | 5 '-iodo-2 '-deoxidation uridylic |
Sequence table
＜110〉Animal ﹠. Plant Inspection and Quarantine Techn Center, Shenzhen Bureau of Impor
＜120〉pike juvenile fish rhabdovirus reverse transcription ring enzyme constant-temperature amplification detection method and test kit
<130>DHC0910507
<160>6
<170>PatentIn?version?3.3
<210>1
<211>25
<212>DNA
＜213〉artificial sequence
<400>1
caatttggct?aacagatcat?atcct 25
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<400>2
ttctcgatcc?agtctccacg 20
<210>3
<211>22
<212>DNA
＜213〉artificial sequence
<400>3
gagcatttcc?atacatggtc?cc 22
<210>4
<211>21
<212>DNA
＜213〉artificial sequence
<400>4
gaggaatgcg?accaacacat?c 21
<210>5
<211>21
<212>DNA
＜213〉artificial sequence
<400>5
caagttccaa?gatgcctgtc?g 21
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<400>6
cttgattcca?tccatcccac 20
Claims (10)
1. pike juvenile fish rhabdovirus (Pike fry rhabdovirus, PFRV) reverse transcription ring matchmaker constant-temperature amplification (RT-LAMP) detection method, described method comprises utilizes Auele Specific Primer, with the virus genome RNA is that template is carried out reverse transcription ring matchmaker isothermal amplification reactions, described Auele Specific Primer comprises a pair of inner primer and a pair of outer primer, it is characterized in that: described outer primer contains the sequence shown in Seq ID No.1 and the Seq ID No.2 respectively
Seq?ID?No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’
Seq?ID?No.2：5’---TTCTCGATCCAGTCTCCACG---3’。
2. detection method according to claim 1 is characterized in that: inner primer FIP and back inner primer BIP before described inner primer comprises,
Inner primer FIP contains the sequence shown in Seq ID No.3 and the Seq ID No.4 before described, links to each other by 0～4 base between Seq IDNo.3 and the Seq ID No.4;
Described back inner primer BIP contains the sequence shown in Seq ID No.5 and the Seq ID No.6, links to each other by 0～4 base between Seq IDNo.5 and the Seq ID No.6;
Seq?ID?No.3：5’---GAGCATTTCCATACATGGTCCC---3’
Seq?ID?No.4：5’---GAGGAATGCGACCAACACATC---3’
Seq?ID?No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’
Seq?ID?No.6：5’---CTTGATTCCATCCATCCCAC---3’。
3. detection method according to claim 2 is characterized in that: described outer primer has the sequence shown in Seq ID No.1 and the Seq ID No.2 respectively,
The sequence of inner primer FIP is before described:
GAGCATTTCCATACATGGTCCC?
GAGGAATGCGACCAACACATC
Seq?ID?No.3 Seq?ID?No.4
The sequence of described back inner primer BIP is:
CAAGTTCCAAGATGCCTGTCGTTTT
CTTGATTCCATCCATCCCAC
Seq?ID?No.5 Seq?ID?No.6
4. according to any described detection method of claim 1～3, it is characterized in that: the thermostat temperature of described reverse transcription ring matchmaker isothermal amplification reactions is 59 ℃～65 ℃.
5. detection method according to claim 4 is characterized in that: the time of described reverse transcription ring matchmaker isothermal amplification reactions is 30min-120min.
6. detection method according to claim 5 is characterized in that: the thermostat temperature of described reverse transcription ring matchmaker isothermal amplification reactions is 63 ℃, and the time of reaction is 60min.
Pike juvenile fish rhabdovirus (Pike fry rhabdovirus, detection kit PFRV) is characterized in that: described test kit comprises a pair of primer that contains sequence shown in Seq ID No.1 and the Seq ID No.2 respectively,
Seq?ID?No.1：5’---CAATTTGGCTAACAGATCATATCCT---3’
Seq?ID?No.2：5’---TTCTCGATCCAGTCTCCACG---3’。
8. detection kit according to claim 7 is characterized in that: described detection kit is used for reverse transcription ring matchmaker isothermal amplification reactions, and described primer is an outer primer.
9. detection kit according to claim 8 is characterized in that: described detection kit also contains a pair of inner primer, inner primer FIP and back inner primer BIP before described inner primer comprises,
Inner primer FIP contains the sequence shown in Seq ID No.3 and the Seq ID No.4 before described, links to each other by 0～4 base between Seq IDNo.3 and the Seq ID No.4;
Described back inner primer BIP contains the sequence shown in Seq ID No.5 and the Seq ID No.6, links to each other by 0～4 base between Seq IDNo.5 and the Seq ID No.6;
Seq?ID?No.3：5’---GAGCATTTCCATACATGGTCCC---3’
Seq?ID?No.4：5’---GAGGAATGCGACCAACACATC---3’
Seq?ID?No.5：5’---CAAGTTCCAAGATGCCTGTCG---3’
Seq?ID?No.6：5’---CTTGATTCCATCCATCCCAC---3’。
10. detection kit according to claim 9 is characterized in that: described outer primer has the sequence shown in Seq ID No.1 and the Seq ID No.2 respectively, and the sequence of described preceding inner primer FIP is:
GAGCATTTCCATACATGGTCCC?
GAGGAATGCGACCAACACATC
Seq?ID?No.3 Seq?ID?No.4
The sequence of described back inner primer BIP is:
CAAGTTCCAAGATGCCTGTCGTTTT
CTTGATTCCATCCATCCCAC
Seq?ID?No.5 Seq?ID?No.6
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910189340 CN102108415B (en) | 2009-12-24 | 2009-12-24 | Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910189340 CN102108415B (en) | 2009-12-24 | 2009-12-24 | Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102108415A true CN102108415A (en) | 2011-06-29 |
| CN102108415B CN102108415B (en) | 2013-06-12 |
Family
ID=44172700
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910189340 Expired - Fee Related CN102108415B (en) | 2009-12-24 | 2009-12-24 | Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102108415B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112063750A (en) * | 2020-08-17 | 2020-12-11 | 河海大学 | LAMP (Loop-mediated isothermal amplification) detection primer group of mandarin perch rhabdovirus, application of LAMP detection primer group and detection kit |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266785B (en) * | 2018-09-07 | 2021-08-13 | 中国水产科学研究院长江水产研究所 | Monopterus albus rhabdovirus CrERV RT-LAMP detection primer and application |
-
2009
- 2009-12-24 CN CN 200910189340 patent/CN102108415B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| HONG-LIAN CHEN ET AL: "Characterization of the complete genome sequence of pike fry rhabdovirus", 《ARCH VIROL》 * |
| M. KOUTNÁ* ET AL: "Identification of spring viraemia of carp virus (SVCV) by combined RT-PCR and nested PCR", 《DISEASES OF AQUATIC ORGANISMS》 * |
| STONE D M, ET AL: "Nucleotide sequence analysis of the glycoprotein gene of putative spring viraemia of carp virus and pike fry rhabdovirus isolates reveals four genogroups", 《DISEASES OF AQUATIC ORGANISMS》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112063750A (en) * | 2020-08-17 | 2020-12-11 | 河海大学 | LAMP (Loop-mediated isothermal amplification) detection primer group of mandarin perch rhabdovirus, application of LAMP detection primer group and detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102108415B (en) | 2013-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112048572B (en) | LAMP technology-based shrimp health system visual rapid detection kit | |
| CN104328222B (en) | The test kit of reverse transcription PCR detection and somatotype dengue virus and detection method thereof | |
| CN108384899B (en) | Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof | |
| CN110616272B (en) | Primer group for detecting prawn liver enterocytozoon and kit containing primer group | |
| CN102559928A (en) | Specific primer group, kit comprising the primer group, use method and detection method | |
| CN102108414B (en) | Real-time fluorescence transcription-polymerase chain reaction (RT-PCR) detection method and kit for pike fry rhabdovirus (PFRV) | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN102146483B (en) | Loop-mediated isothermal amplification (LAMP) detection method and kit of soft-shelled turtle iridovirus (STIV) | |
| CN102071263B (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN104195269B (en) | A kind of method detecting tomato spotted wilf virus | |
| CN102108415B (en) | Method and kit for detecting reverse transcription-loop mediated isothermal amplification (RT-LAMP) of pike fry rhabdovirus (RFRV) | |
| CN112575118B (en) | Method for simultaneously detecting various diarrhea viruses by using melting curve | |
| CN108486279A (en) | A method of pigeon with newcastle disease is detected based on fluorescent quantitative PCR technique | |
| Jaianand et al. | Development of a new method for diagnosis of Group B Coxsackie genome by reverse transcription loop-mediated isothermal amplification | |
| CN108467904B (en) | RT-LAMP primer group for detecting seneca valley virus, kit and application | |
| CN101178350A (en) | Method and reagent box for testing rabies viruses | |
| CN106868198B (en) | Multiplex PCR primer group for simultaneously detecting four pathogenic bacteria of catfishes and monitoring method | |
| CN103397106B (en) | Hybridized snakehead fish rhabdovirus fluorescent quantificationally PCR detecting kit and detection method thereof | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| CN1952174A (en) | LUX fluorescent primer special for detecting bovine herpes virus type I and process for nucleic acid amplification | |
| WO2021255787A1 (en) | Sars-cov-2 detection primer set, sars-cov-2 testing method, and sars-cov-2 test reagent and test kit | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN103882150A (en) | Primer, probe and real-time fluorescent PCR (polymerase chain reaction) method for detecting TTSuV II (torque teno sus virus II) | |
| CN103882151A (en) | Primer, probe and real-time fluorescence polymerase chain reaction (PCR) detection method for detecting I-type torque teno sus virus | |
| CN113403427B (en) | Reverse transcription multiple-sleeve PCR detection primer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130612 Termination date: 20141224 |
|
| EXPY | Termination of patent right or utility model |