CN102108368A - Recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen and preparation method thereof - Google Patents
Recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen and preparation method thereof Download PDFInfo
- Publication number
- CN102108368A CN102108368A CN2009102473174A CN200910247317A CN102108368A CN 102108368 A CN102108368 A CN 102108368A CN 2009102473174 A CN2009102473174 A CN 2009102473174A CN 200910247317 A CN200910247317 A CN 200910247317A CN 102108368 A CN102108368 A CN 102108368A
- Authority
- CN
- China
- Prior art keywords
- yeast
- gene
- saccharomyces cerevisiae
- promoter
- terminator
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the tuberculosis vaccine field and the genetic engineering field. The invention provides a recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen, and the saccharomyces cerevisiae strain comprises the following expression vector: the expression vector comprises a complete sequence of yeast 2mu plasmid, a yeast nutrition defect screening gene, a yeast promoter, a yeast terminator, and a mycobacterium tuberculosis antigen gene. No non-yeast gene sequence exists in the expression plasmid except for the mycobacterium tuberculosis antigen gene sequence needing to be expressed, and the expression plasmid can only survive in saccharomyces cerevisiae cells and can not transfer. The saccharomyces cerevisiae expression plasmid generated by the invention gives full play to the advantages of saccharomyces cerevisiae food-grade microbe, and is safe and has high efficiency. In addition, yeast cells themselves have strong immunoadjuvant effects, and no adjuvant is needed to be added; yeast cells can be used as an excellent material for the preparation of prophylactic and therapeutic vaccines of tuberculosis.
Description
Technical field
The invention belongs to Vaccinum Calmette-Guerini field and technical field of biological genetic engineering, be specifically related to a kind of recombination yeast and construction process thereof that can be used as tuberculosis vaccine.
Background technology
Tuberculosis (tuberculosis) is by mycobacterium tuberculosis (Mycobacterium tuberculosis, a kind of chronic infectious disease that MT) causes.In recent years, the infection because the appearance of tubercule bacillus multi-drug resistant bacterial strain and virus of AIDS (HIV) and tubercule bacillus are occurred together, tuberculosis becomes the three big transmissible diseases that threaten human health with acquired immune deficiency syndrome (AIDS), malaria.China is second-biggest-in-the-world tuberculosis morbidity state, and the situation is tense for tuberculosis prevention and treatment.Vaccine is the effective means of preventing and treating transmissible disease, and bacille Calmette-Guerin vaccine (BCG) is present unique prevention tuberculosis vaccine that gets the Green Light, used so far more than 80 year, but the immanoprotection action instability of BCG, efficient between 0%-80%, because of individual, regional different widely different, and because the diffusion of Mycobacterium tuberculosis drug-resistant bacterial strain causes the not good (Wang Honghai of tuberculosis medication effect, the tuberculosis prevention and treatment advances of Basic Research, microorganism and infection, 2007,2 (3): 164-169; Wu Fang etc., tuberculosis vaccine progress, foreign medical science (preventive assessment treatment biological products fascicle), 2005,28 (3): 110-113).Therefore, the development novel tuberculosis vaccine becomes the task of top priority of tuberculosis prevention and treatment.
The tuberculosis vaccine of developing at present mainly contains subunit vaccine, dna vaccination, whole-bacterial-vaccine etc.(1) subunit vaccine refers to utilize the prepared vaccine of antigen protein (polypeptide) of tubercule bacillus, adopts genetic engineering technique expression, purifying to prepare antigen protein (polypeptide) usually.Tubercule bacillus has stronger immunogenic antigen protein early stage secretion antigen (ESAT-6), Ag85 mixture (Ag85A, Ag85B, Ag85C), MPT-64 and heat shock protein(HSP) HSP65 etc. is arranged, subunit vaccine is safe in utilization, but the time length of residence time and immunne response weak point must be sought safe and potent adjuvants and transmission form in vivo.(2) dna vaccination refers to the negre antigen protein coding gene is cloned in corresponding expression vector (being mainly virus vector) as vaccine, directly imports body cell.The dna vaccination technology is simple; can be in body continuous expression for some time; activated cell immune response well; but there is certain problem in the dna vaccination expression level; immune protective effect is limited separately; just can reach immune protective effect preferably with subunit vaccine or BCG combined immunization, and there is query in security.(3) whole-bacterial-vaccine is mainly recombinant BCG (rBCG), promptly BCG is carried out genetic engineering modifiedly, is recombined into BCG as the important protective antigen that will lack among the BCG, improves its immanoprotection action.The main advantage of rBCG is that the target antigen of its expression need not pass through the purification process complicated procedures of forming, can be directly used in immunity.RBCG immunity and protection effect also need further to improve.
Owing to there is the huge tuberculosis infected students of quantity, the novel tuberculosis vaccine that development prevention and treatment effect have concurrently shows important especially.And have the potential that becomes the therapeutic type vaccine based on the novel tuberculosis vaccine of the full yeast saccharomyces cerevisiae of reorganization (Saccharomyces cerevisiae).Yeast saccharomyces cerevisiae is as vaccine carrier, and its principal feature has (1) security good, and yeast saccharomyces cerevisiae is a kind of nonpathogenic safety type microorganism, is extensive use of for a long time at food, pharmacy field; (2) good eukaryotic cell expression system, genetic background is clear, easily carries out genetic manipulation; (3) preparation method is simple, and cost is low; (4) yeast cell self has very strong immunological adjuvant effect, need not add adjuvant; (6) (Dendritic Cells DCs), induces potent cell immune response can to act on and activate dendritic cell.The full yeast therapeutic type of reorganization vaccine at acquired immune deficiency syndrome (AIDS) (HIV) and hepatitis C (HCV) has been finished preclinical study, RAS recombinate full yeast tumor vaccine obtained drugs approved by FDA enter the treatment multiple cancer clinical study (A.A.Haller et al., Whole recombinant yeast-basedimmunotherapy induces potent T cell response targeting HCV NS3 and Coreproteins, Vaccine (2007), 25:1452-1463; R.P.Galao, et al., Saccharomyces cerevisiae:a versatile eukaryotic system in virology, Microbial Cell Factories (2007), 6:32)
Summary of the invention
The present invention is intended to make up a kind of recombinant Saccharomyces cerevisiae of expressing negre antigen, and this recombinant Saccharomyces cerevisiae can be used as vaccine and is applied to tuberculosis prevention and treatment.
Another object of the present invention provides the construction process of above-mentioned recombinant Saccharomyces cerevisiae.
The invention provides a kind of recombinant Saccharomyces cerevisiae of expressing negre antigen, this Wine brewing yeast strain contains following expression vector: this expression vector contains yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, yeast terminator and negre antigen gene.
Described Yeast promoter is any one in yeast inulinase gene promoter, TEF1 gene promoter, ADH1 gene promoter, ADH2 gene promoter, GAPDH gene promoter, GAL1 gene promoter, the GAL10 gene promoter, perhaps the promoter, fusion of two kinds and two or more promotors wherein.
Described yeast terminator is one or several in inulinase gene terminator, CYC1 gene terminator, TEF1 gene terminator, the ADH1 gene terminator.
Described yeast nutrition defective screening-gene is one or several among LEU2, ADE2, URA3, TRP1 or the HIS3.
Described negre antigen gene is ESAT-6, Ag85A, Ag85B, Ag85C, MPT-64, heat shock protein(HSP) HSP65, perhaps wherein two kinds and two or more fusion genes.
In one embodiment of the present of invention, with the fusion gene (EA) of ESAT-6 and Ag85B as the negre antigen gene.EA is that the order of connection of Ag85B and EAST6 fusion rotein is that identical carrier is inserted in direct back from beginning to end.Ag85B gene accession number BX842578.1; Albumen accession number: CAB10044.1.ESAT-6 gene accession number BX248347.1; Albumen accession number: CAD96091.1.
It is as follows that negre antigen is expressed authentication method:
The recombinant Saccharomyces cerevisiae engineering bacteria that makes up is inoculated in selectivity SD-Leu liquid nutrient medium, overnight incubation is as seed liquor in 30 ℃ of shaking tables, ratio according to 5% (v/v) is inoculated in the YEPD substratum, cultivated 48 hours in 30 ℃ of shaking tables, centrifugal results yeast cell, glass bead method cracking yeast is got lysate and is carried out the SDS-PAGE electrophoresis, and Western blot identifies the recombinant tubercle bacillus antigen protein expression level.
Above-mentioned expression vector and recombinant Saccharomyces cerevisiae bacterial strain thereof can be used to prepare the anti-mycobacterium tuberculosis vaccine.
The present invention also provides the preparation method of above-mentioned recombinant Saccharomyces cerevisiae bacterial strain, and this method comprises the steps:
(1) makes up the shuttle plasmid yeast vector part that contains yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter and yeast terminator;
(2) make up the exogenous gene expression box that contains Yeast promoter, yeast terminator and negre antigen gene;
(3) the corresponding auxotroph Wine brewing yeast strain of exogenous gene expression box cotransformation that shuttle plasmid yeast vector part and (2) that (1) obtained obtain, screening and culturing transformant on the auxotrophy selective medium, the recombinant Saccharomyces cerevisiae bacterial strain of negre antigen is expressed in acquisition.
The recombinant Saccharomyces cerevisiae construction process of expressing negre antigen is as follows:
Yeast-shuttle vehicle pHR-Px (is seen patent application " a kind of novel food-grade yeast saccharomyces cerevisiae expression system ", contriver's Liu Jianping etc.), remove intestinal bacteria replicon Ori and ampicillin resistance gene Ap in the carrier through restriction enzyme Sal1, Sac1 double digestion
rSequence, Yeast expression carrier fragment that obtains and negre antigen expression cassette cotransformation Saccharomyces cerevisiae host, coating leucine auxotrophy selective medium SD-Leu goes up the screening transformant, the negre antigen gene is cloned on Yeast expression carrier by homologous recombination mechanism in transformed yeast cells, PCR identifies transformant, obtain to express the recombinant Saccharomyces cerevisiae engineering bacteria of negre antigen, the antigen presentation plasmid in this recombination yeast does not have intestinal bacteria sequence and drug resistance gene sequence.
Recombinant plasmid is cut through restriction enzyme Not1 enzyme, and electrophoretic separation reclaims the negre antigen yeast saccharomyces cerevisiae expression cassette of being made up of Yeast promoter, negre antigen gene and yeast terminator sequence.
Shuttle plasmid in the above-mentioned steps (1) contains the sequence of escherichia coli plasmid replicon, antibiotics resistance gene, yeast saccharomyces cerevisiae 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter and yeast terminator, excision escherichia coli plasmid replicon and antibiotics resistance gene obtain shuttle plasmid yeast vector part.
Can utilize cloning vector to make up the exogenous gene expression box.Cloning vector contains Yeast promoter, multiple clone site district and yeast terminator.For example, based on the pAG61 plasmid, make up the cloning vector Px-RH (Fig. 3) that contains Yeast promoter, multiple clone site district and yeast terminator.Foreign gene is cloned the carrier in Px-RH by the multiple clone site district, and digestion with restriction enzyme obtains by Yeast promoter Px, frame is read in the exploitation of negre antigen gene and yeast stops molecular exogenous gene expression box.
Yeast-shuttle vehicle makes up: based on complete yeast 2 μ plasmid sequences, structure contains the shuttle plasmid pHR-Px (Fig. 4) of yeast nutrition defective screening-gene, Yeast promoter Px and yeast terminator element, and Yeast promoter Px and terminator interelement are escherichia coli plasmid replicon (Ori) and ampicillin resistance gene (Ap
r) sequence, the escherichia coli plasmid replicon is cut and can be separated with the yeast genes sequence on the shuttle vectors by enzyme with the ampicillin resistance gene sequence.
Removed the shuttle vectors pHR-Px fragment and the exogenous gene expression box cotransformation auxotroph Wine brewing yeast strain of escherichia coli plasmid replicon and ampicillin resistance gene sequence, screening obtains the exogenous gene expression engineering bacteria on the auxotrophy selective medium.External source expression casette and shuttle vectors pHR-Px fragment form the exogenous gene expression plasmid by homologous recombination in the engineering bacteria, and this expression plasmid does not have non-yeast genes sequence and drug resistance gene sequence (except that need expressed exogenous gene sequence).
The recombinant Saccharomyces cerevisiae bacterial strain of cracking gained can separation and purification obtains to comprise the yeast saccharomyces cerevisiae expression vector of yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, yeast terminator and negre antigen gene.
This yeast saccharomyces cerevisiae expression vector also can prepare by the following method: make up the dna fragmentation of yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, negre antigen gene and yeast terminator respectively, then it is connected successively.
The present invention also provides one primary yeast-bacillus coli shuttle plasmid, this shuttle plasmid contains the sequence of yeast terminator, yeast saccharomyces cerevisiae 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, escherichia coli plasmid replicon and antibiotics resistance gene, each part mentioned above connects successively, and all there is restriction enzyme site escherichia coli plasmid replicon and antibiotics resistance gene both sides.
Among the present invention, the concrete steps of preparation Wine brewing yeast strain are as follows:
1, cloning vector Px-RH makes up
(1) the pAG61 plasmid is cut through the Not1 enzyme, and electrophoresis reclaims and contains escherichia coli plasmid replicon Ori and ampicillin resistance gene Ap
rThe dna fragmentation of sequence;
(2) respectively pcr amplification Yeast promoter Px and terminator sequence of the primer that contains restriction endonuclease sites with two ends, restriction enzyme enzyme is respectively cut Yeast promoter, terminator PCR product;
(3) the positive anti-chain strand in synthetic respectively multiple clone site district, sex change annealing form the double-stranded sequence of multiple clone site, and two ends are contained respectively and Yeast promoter Px sequence 3 ' cohesive end, yeast terminator sequence 5 ' cohesive end complementary cohesive end;
(4) escherichia coli plasmid replicon and ampicillin resistance gene sequence and double-stranded connection of Yeast promoter, yeast terminator and multiple clone site after enzyme is cut, transformed into escherichia coli DH5 α, the transformant that forms is carried out the PCR Screening and Identification, the PCR positive transformant extracts plasmid, order-checking is identified, obtains cloning vector Px-RH.The Px-RH carrier has escherichia coli plasmid replicon, ampicillin resistance gene selection markers, Yeast promoter, multiple clone site district and yeast terminator element.
2, the exogenous gene expression box makes up (foreign gene is the tuberculosis antigen gene)
Need the expressed exogenous gene exploitation to read frame (ORF) through PCR specific amplified, digestion with restriction enzyme, be connected with the Px-RH carrier of handling through same digestion with restriction enzyme, foreign gene inserts Px-RH carrier multiple clone site district, the plasmid that forms has Yeast promoter Px-foreign gene ORF-yeast and stops molecular exogenous gene expression box, transformed into escherichia coli DH5 α carries out PCR, order-checking evaluation to the recombinant plasmid in the transformant then.Recombinant plasmid is cut through the Not1 enzyme, and electrophoresis reclaims and escherichia coli plasmid replicon, the isolating exogenous gene expression box of ampicillin resistance gene sequence.
3, yeast-shuttle vehicle pHR-Px makes up
PHC11 carrier (Liu Yiting etc., expression and the regulation and control of hepatitis B virus surface antigen SA-28 fusion gene in yeast under hybrid promoter control, Fudan Journal, 37 (4): 399-444,1998) enzyme is cut, and electrophoresis reclaims the 8.7kb fragment comprise yeast 2 μ plasmid complete sequence and yeast nutrition defective screening-gene Leu2, inserted intestinal bacteria replicon Ori and ampicillin resistance gene Ap with the centre
rThe Yeast promoter Px of sequence is connected with the yeast terminator, and transformed into escherichia coli DH5 α carries out PCR, order-checking evaluation to the recombinant plasmid in the transformant, obtains the pHR-Px shuttle vectors.
4, engineering bacteria makes up
Yeast-shuttle vehicle pHR-Px is through Sac1, Sal1 double digestion, and electrophoresis reclaims and removed escherichia coli plasmid replicon Ori and ampicillin resistance gene Ap
rThe carrier segments of sequence, this carrier segments is the yeast genes sequence, utilize the Wine brewing yeast strain of Lithium Acetate method cotransformation LEU2 transgenation with the exogenous gene expression box, go up the screening transformant at the SD selective medium (SD-Leu) that lacks leucine (leucine), PCR identifies the foreign gene of cloning in the transformant in expression plasmid, selects the PCR positive transformant to carry out the exogenous gene expression test as engineering bacteria.
Carrier of the present invention is commercially available or according to bibliographical information.Particularly point out as non-, all can adopt the working method of this area routine.For example, according to " molecular cloning ", " antibody ", " cell " of cold spring harbor laboratory, and general laboratory manuals such as " cold spring harbor laboratory's experimental programs ".
The invention provides a kind of recombinant Saccharomyces cerevisiae of expressing negre antigen, this Wine brewing yeast strain contains following expression vector: this expression vector contains yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, yeast terminator and negre antigen gene.In this expression plasmid, except that the negre antigen gene order that need are expressed, do not have non-yeast genes sequence, be merely able in brewing yeast cell, survive, can not shift.The yeast saccharomyces cerevisiae expression plasmid that the present invention produced has been given full play to the advantage of yeast saccharomyces cerevisiae food-grade microorganisms, safety, efficient; And yeast cell self has very strong immunological adjuvant effect, need not add adjuvant; Can be used as the excellent material of preparation tuberculosis prevention and treatment vaccine.
Description of drawings
Tubercule bacillus fused antigen ESAT6-Ag85B expression plasmid pHR-EA in Fig. 1 recombinant Saccharomyces cerevisiae engineering bacteria.
Fig. 2 recombinant Saccharomyces cerevisiae engineering bacterium expression tubercule bacillus fused antigen ESAT6-Ag85B (EA) Western blot identifies.
Swimming lane 2-4 is respectively 3 strain Y16/pHR-EA engineering bacterium fermentation cellular lysate liquid samples, and EA is the ESAT6-Ag85B fused antigen.
Fig. 3 P
x-RH synoptic diagram.
Fig. 4 pHR-P
ADH1Synoptic diagram.
The IgG antibody ELISA detected result of reacting with negre antigen Ag85B in Fig. 5 recombinant Saccharomyces cerevisiae immune serum.Recombination yeast is the Y16/pHR-EA engineering bacteria, and contrast 1 is host's yeast saccharomyces cerevisiae Y16, and contrast 2 is a PBS solution.
Embodiment
With plasmid pMD18-T-ESAT6 (the ESAT6 gene clone is in pMD18-T vector) is template, primer P1 and P2PCR amplification ESAT6 gene open reading frame ORF sequence, and the PCR product is handled through HindIII, BamH1 double digestion.With plasmid pMD18-T-Ag85B (the Ag85B gene clone is in pMD18-T vector) is template, and frame ORF sequence is read in primer P3 and the exploitation of P4PCR amplification Ag85B gene, and the PCR product is handled through Bgl II, Sal1 double digestion.Cloning vector P
ADH1-RH (sees patent application " a kind of novel food-grade yeast saccharomyces cerevisiae expression system ", contriver's Liu Jianping etc.) behind HindIH, Sal1 double digestion, cutting product, Ag85B gene Bgl II/Sal1 enzyme with ESAT6 gene HindIII/BamH1 enzyme cuts product and carries out three fragments and be connected, transformed into escherichia coli DH5 α bacterial strain, PCR identifies transformant, extracting positive transformant recombinant plasmid, order-checking are identified, obtain cloning the recombinant plasmid P of fused antigen EA
ADH1-EA-RH.This recombinant plasmid has by promotor P
ADH1, the EA expression casette (P that forms of fused antigen EA and terminator Tcyc sequence
ADH1-EA-Tcyc), recombinant plasmid is cut through the Not1 enzyme, electrophoretic separation, recovery fused antigen EA expression casette P
ADH1-EA-Tcyc.Genetic engineering technique methods such as PCR, the enzyme that adopts cut, connection, intestinal bacteria conversion are ordinary method, with reference to " molecular cloning experiment guide " (J.Sambrook, et al., second edition, 1996).
Two primer sequences of clone ESAT6 gene ORF are:
P1：5’AGG
AAGCTT?AGATCTATGACAGAGCAGCAGTGGAATT(SEQ?ID?NO?1)HindIII
P2：5’AT
GGATCCTGCGAACATCCCAGTGACGTTG(SEQ?ID?NO?2)BamH1
Two primer sequences of clone Ag85B gene ORF are:
P3：5’AT?
AGATCTTTCTCCCGGCCGGGGCTG(SEQ?ID?NO?3)Bgl?II
P4：5’CA?
GTCGAC?TTATCAGCCGGCGCCTAACGAAC(SEQ?ID?NO?4)Sal1
The recombinant Saccharomyces cerevisiae engineering bacteria that embodiment 2 expresses tubercule bacillus fused antigen EA makes up
Yeast-shuttle vehicle pHR-P
ADH1Through Sac1, Sal1 double digestion, electrophoretic separation, removal intestinal bacteria replicon Ori and ampicillin resistance gene Ap
rFragment, reclaim the yeast vector part, adopt Lithium Acetate method cotransformation yeast saccharomyces cerevisiae Y16 bacterial strain with fused antigen EA expression casette, at selective medium SD-Leu screening transformant, recombinant expression plasmid in the transformant is carried out PCR identify that EA gene PCR male yeast transformant is the recombinant Saccharomyces cerevisiae engineering bacteria Y16/pHR-EA that expresses fused antigen EA.Yeast cell Lithium Acetate method for transformation is with reference to " yeast genetics method experiment guide " (A.Adams, et al., 2000).
1. recombinant Saccharomyces cerevisiae engineering bacteria Y16/pHR-EA is inserted in the 3ml selectivity SD-Leu liquid nutrient medium, at 30 ℃, in the 250rpm rotating speed shaking table after the overnight incubation as seed liquor.Selectivity SD-Leu liquid culture based component is: 0.67%YNB, 2% glucose, 0.002% uridylic, 0.002% Histidine and 0.002% tryptophane.Seed liquor is equipped with in the 100ml triangular flask of 20ml YEPD with 1: 20 ratio access,, cultivated 48 hours in the 250rpm rotating speed shaking table at 30 ℃.The YEPD medium component is: 1% yeast extract, 2% peptone and 2% glucose.
2. get 1ml fermented liquid high speed centrifugation, remove supernatant liquor, results precipitation thalline, add 200 μ l PBS, add the equivalent glass microballon again, thermal agitation breaks bacterium (the 1 minute postposition of vibrating 1 minute so repeats 5 times) on ice, get the broken bacterium liquid of 20 μ l behind the SDS-PAGE electrophoresis, Western blot identifies that EA expresses.
Western blot method is with reference to " molecular cloning experiment guide " (J.Sambrook, et al., second edition, 1996).
The result shows that the recombinant Saccharomyces cerevisiae engineering bacteria of above-mentioned acquisition can be expressed fused antigen EA.Specifically see Fig. 2 for details.
1. recombinant Saccharomyces cerevisiae engineering bacteria Y16/pHR-EA is inserted in the 3ml selectivity SD-Leu liquid nutrient medium, at 30 ℃, in the 250rpm rotating speed shaking table after the overnight incubation as seed liquor.Selectivity SD-Leu liquid culture based component is: 0.67%YNB, 2% glucose, 0.002% uridylic, 0.002% Histidine and 0.002% tryptophane.Seed liquor is equipped with in the 100ml triangular flask of 20ml YEPD with 1: 20 ratio access,, cultivated 48 hours in the 250rpm rotating speed shaking table at 30 ℃.The YEPD medium component is: 1% yeast extract, 2% peptone and 2% glucose.
2. centrifugal results engineering bacteria, and sodium phosphate buffer (PBS, pH7.4) washing is 3 times, places 60 ℃ of water-baths 1 hour, the inactivation yeast cell, preparation becomes 5 * 10
8/ ml cell suspension is according to each dosage 0.1ml cell suspension (promptly 5 * 10
7Cell count), all female C57BL/6 mouse of hypodermic injection immunity age 7-9, totally 3 times, each 1 week at interval is respectively at blood sampling in 9 days after the immunity, 16 days, separation of serum.With host's yeast saccharomyces cerevisiae Y16 and PBS solution immune mouse in contrast 1, contrast 2.4 of every group of mouse quantity.
3. negre antigen specific antibody IgG detects in the immune serum.Adopt ELISA to detect negre antigen Ag85B specific antibody IgG level in the immune serum.The ELISA method is operated according to conventional procedure.The every hole of 96 hole enzyme plates envelope antigen albumin A g85B 0.5 microgram, the serum sample extension rate is 500 times, the ELISA reaction substrate is TMB, detects wavelength 450nm.
The result shows, the IgG antibody that mouse produces anti-Ag85B can be effectively evoked behind the recombination yeast Y16/pHR-EA immune mouse of expression tubercule bacillus ESAT6-Ag85B fused antigen (EA), and the Ag85B specific antibody can not be produced after host's yeast saccharomyces cerevisiae Y16 immunity in contrast.
Sequence table
<210>1
<211>37
<212>DNA
<213>Artificial
<400>1
aggaagctta?gatctatgac?agagcagcag?tggaatt 37
<210>2
<211>30
<212>DNA
<213>Artificial
<400>2
atggatcctg?cgaacatccc?agtgacgttg 30
<210>3
<211>26
<212>DNA
<213>Artificial
<400>3
atagatcttt?ctcccggccg?gggctg 26
<210>4
<211>31
<212>DNA
<213>Artificial
<400>4
cagtcgactt?atcagccggc?gcctaacgaa?c 31
Claims (10)
1. a negre antigen expression vector is characterized in that, this expression vector contains yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, yeast terminator and negre antigen gene.
2. expression vector as claimed in claim 1, it is characterized in that, described Yeast promoter is any one in yeast inulinase gene promoter, TEF1 gene promoter, ADH1 gene promoter, ADH2 gene promoter, GAPDH gene promoter, GAL1 gene promoter, the GAL10 gene promoter, perhaps the promoter, fusion of two kinds and two or more promotors wherein.
3. expression vector as claimed in claim 1 is characterized in that, described yeast terminator is a kind of in inulinase gene terminator, CYC1 gene terminator, TEF1 gene terminator, the ADH1 gene terminator.
4. expression vector as claimed in claim 1 is characterized in that, described yeast nutrition defective screening-gene is one or several among LEU2, ADE2, URA3, TRP1 or the HIS3.
5. expression vector as claimed in claim 1 is characterized in that, described negre antigen gene is ESAT-6, Ag85A, Ag85B, Ag85C, MPT-64, heat shock protein(HSP) HSP65 or wherein two kinds and two or more fusion genes.
6. recombinant Saccharomyces cerevisiae bacterial strain that contains the described expression vector of claim 1.
7. the preparation method of the described recombinant Saccharomyces cerevisiae bacterial strain of claim 6 is characterized in that, this method comprises the steps:
(1) makes up the shuttle plasmid yeast vector part that contains yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter and yeast terminator;
(2) make up the exogenous gene expression box that contains Yeast promoter, yeast terminator and negre antigen gene;
(3) the corresponding auxotroph Wine brewing yeast strain of exogenous gene expression box cotransformation that shuttle plasmid yeast vector part and (2) that (1) obtained obtain, screening and culturing transformant on the auxotrophy selective medium, the recombinant Saccharomyces cerevisiae bacterial strain of negre antigen is expressed in acquisition.
8. the described preparation of expression vectors method of claim 1, it is characterized in that, the recombinant Saccharomyces cerevisiae bacterial strain of cracking claim 7 gained, separation and purification obtains to comprise the yeast saccharomyces cerevisiae recombinant plasmid of yeast 2 μ plasmid complete sequence, yeast nutrition defective screening-gene, Yeast promoter, yeast terminator and target foreign gene.
9. the application of the described expression vector of claim 1 is characterized in that, described expression vector is used to prepare the anti-mycobacterium tuberculosis vaccine.
10. the application of the described recombinant Saccharomyces cerevisiae bacterial strain of claim 6 is characterized in that, described recombinant Saccharomyces cerevisiae is used to prepare the anti-mycobacterium tuberculosis vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102473174A CN102108368A (en) | 2009-12-28 | 2009-12-28 | Recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102473174A CN102108368A (en) | 2009-12-28 | 2009-12-28 | Recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102108368A true CN102108368A (en) | 2011-06-29 |
Family
ID=44172653
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102473174A Pending CN102108368A (en) | 2009-12-28 | 2009-12-28 | Recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102108368A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103304670A (en) * | 2013-06-03 | 2013-09-18 | 中国人民解放军第三〇九医院 | Mycobacterium tuberculosis specific fusion protein vaccine AB and preparation and application thereof |
-
2009
- 2009-12-28 CN CN2009102473174A patent/CN102108368A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103304670A (en) * | 2013-06-03 | 2013-09-18 | 中国人民解放军第三〇九医院 | Mycobacterium tuberculosis specific fusion protein vaccine AB and preparation and application thereof |
| CN103304670B (en) * | 2013-06-03 | 2015-09-16 | 中国人民解放军第三〇九医院 | Mycobacterium tuberculosis specific fusion protein vaccine AB and Synthesis and applications thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | The surface display of haemolysin from Vibrio harveyi on yeast cells and their potential applications as live vaccine in marine fish | |
| US10821163B2 (en) | Process for the production of a DNA vaccine for cancer immunotherapy | |
| Rosales-Mendoza | Algae-based biopharmaceuticals | |
| WO2022087856A1 (en) | Antigen presenting system of novel coronavirus vaccine using attenuated salmonella for secreting and expressing rbd domain protein, and use thereof | |
| Liu et al. | Recombinant invasive Lactobacillus plantarum expressing fibronectin binding protein A induce specific humoral immune response by stimulating differentiation of dendritic cells | |
| Yu et al. | Generation of Mucosal Anti-Human Immunodeficiency Virus Type 1 T-Cell Responses by Recombinant Mycobacterium smegmatis▿ | |
| Dennehy et al. | Evaluation of recombinant BCG expressing rotavirus VP6 as an anti-rotavirus vaccine | |
| CN114478715B (en) | Novel coronavirus vaccine presentation system for attenuated salmonella secretion expression of S2 structural domain protein and application thereof | |
| CN101693900A (en) | Application of utilizing bacillus subtilis spore coat protein CotX as molecular carrier adopting spore surface to display exogenous proteins | |
| US20180305416A1 (en) | Recombinant Mycobacterium Encoding A Heparin-Binding Hemagglutinin (HBHA) Fusion Protein And Uses Thereof | |
| CN102108368A (en) | Recombinant saccharomyces cerevisiae expressing mycobacterium tuberculosis antigen and preparation method thereof | |
| CN116478953A (en) | Acinetobacter baumannii DlaT recombinant protein, preparation method and application | |
| CN102675433A (en) | Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof | |
| CN110564751A (en) | Design and application of micro-ring DNA vaccine | |
| KR102402971B1 (en) | Virus-like particles comprising the merozoit surface protein of malaria protozoa, and vaccine compositions using the same | |
| CN116669759A (en) | Novel coronavirus vaccine based on attenuated salmonella controllable secretory expression and preparation method and application thereof | |
| CN106986942B (en) | Recombinant fusion protein containing core protein of bat hepatitis virus and preparation method and application thereof | |
| CN106986943B (en) | Recombinant fusion protein containing arctic squirrel hepatitis virus core protein and preparation method and application thereof | |
| KR102536927B1 (en) | Virus-like particles comprising the merozoit surface protein-8 of malaria protozoa, and vaccine compositions using the same | |
| CN116041541B (en) | Mycobacterium tuberculosis antigen EPPA011 and application thereof | |
| CN116041543B (en) | Mycobacterium tuberculosis multi-antigen fusion protein, encoding gene and application thereof | |
| US9963487B2 (en) | Production of polypeptides relevant to human and animal health using Yarrowia lipolytica | |
| CN101716350A (en) | AIDS live carrier multipartial vaccine and construction method thereof | |
| CN102757971A (en) | Mycobacterium tuberculosis recombinant protein and preparation method thereof | |
| CN114377121B (en) | Recombinant African swine fever antigen cocktail vaccine containing intramolecular adjuvant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110629 |