CN102094027A - Rice blast resistance gene Pi7 and application thereof - Google Patents
Rice blast resistance gene Pi7 and application thereof Download PDFInfo
- Publication number
- CN102094027A CN102094027A CN2010105786332A CN201010578633A CN102094027A CN 102094027 A CN102094027 A CN 102094027A CN 2010105786332 A CN2010105786332 A CN 2010105786332A CN 201010578633 A CN201010578633 A CN 201010578633A CN 102094027 A CN102094027 A CN 102094027A
- Authority
- CN
- China
- Prior art keywords
- leu
- gene
- ile
- ser
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a rice blast resistance gene Pi7 and application thereof, and provides a nucleotide sequence of the rice blast resistance gene Pi7 and an amino acid polypeptide sequence coded thereby. The nucleotide sequence comprises two genes which belong to members of a coiled-coil nucleotide binding site leucine-rich repeat (CC-NBS-LRR) resistance gene family and are constitutive expression genes. The invention also provides application of the gene to the aspect of transforming rice or breeding disease-resistant varieties of other plants and application of a molecular marker produced according to the gene sequence to breeding.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to a kind of resistance gene of rice blast
Pi7Clone and application thereof.
Background technology
Plant usually is subjected to the infringement of multiple pathogen in the process of growth, plant then takes multiple defence policies to protect self, avoids being subjected to it to attack.A most important defense mechanism is exactly the defence answering system that can discern the existence of obligate pathogenic microorganism and start self in the plant.Plant is mediated by disease-resistant gene the identification of pathogenic bacteria.Therefore, enantiopathy gene product structure is analyzed and is studied, and is the basis of understanding plant disease-resistant mechanism, also has important directive significance for the prevention and the control of its disease.
Up to now, oneself is through having separated more than 80 disease-resistant gene from plant.To the structure of these disease-resistant genes and discovering of product, though host plant difference, pairing pathogen also has fungi, bacterium, differences such as virus and nematode, but the structure of disease-resistant gene and product have many common constitutional featuress, there is rich leucine tumor-necrosis factor glycoproteins (leucine-rich repeat as the C-end, LRR), there is nucleotide binding site (nucleotide binding site in the N-end, NBS), and leucine zipper (leucine zipper, LZ), coiled coil structural domain (coiled-coil, CC), and membrane spaning domain (transmembrane domain, TM), protein kinase (protein kinase, PK), and fruit bat Toll albumen and Mammals interleukin-1 acceptor (Toll and interleukin – 1 receptor, TIR) etc.According to they coded proteic constitutional featuress, disease-resistant gene can be divided into 7 classes (Hammond-Kosack ﹠amp; Jones, 1997; Dangl ﹠amp; Jones 2001; Iyer ﹠amp; McCouch 2004).
The first kind, toxin reduction enzyme disease-resistant gene.As the corn disease-resistant gene
Hm1, it is the 1st plant disease resistance genes that quilt is cloned, it is controlled fungi
Cochliobolus carbonumThe resistance of microspecies 1.
Hm1Coding separate toxenzyme can passivation the HC toxin that produced of pathogenic fungi, and the HC toxin is a fungi
C.
CarbonumThe virulence factor that microspecies 1 produce, it determines this germ can only infect some genotype of corn (Johal etc., 1992).Second class, NBS-LRR class disease-resistant gene.The nearly N end of their encoded protein is NBS, and nearly C end then is made up of LRR.As
RPS2(Bent et al., 1994),
RPM1(Grant et al., 1995),
I2(Simon et al., 1998);
RPP5(Parker et al., 1997),
N(Dodd et al., 2001),
L 6(Lawrence et al., 1995),
Mla1(Zhou et al., 2001),
Mla6(Halterman et al., 2001); The disease-resistant gene of paddy rice as
Xa1(Yoshimura et al., 1998),
Pib(Wang et al., 1999),
Pita(Bryan et al., 2000) etc.The 3rd class, PK class disease-resistant gene.As tomato
PtoGene, its product are a kind of intracellular serine-threonine protein kinase enzymes that is positioned at, and do not have LRR structural domain (Martin et al., 1993).The 4th class, LRR-TM class disease-resistant gene.The gene of the different physiological strains of the anti-leaf mold of tomato
Cf-2(Dixon et al., 1996),
Cf-4(Thomas et al., 1997),
Cf-5(Dixon et al., 1998),
Cf-9(Jones et al., 1994), and the gene of the anti-Cyst nematode of beet
Hs1 Pro-1 (Cai et al., 1997) etc.The 5th class, LRR-TM-PK class disease-resistant gene is with the rice bacterial blight resistance gene
Xa21(Song et al., 1995) are representative.The 6th class, with Arabidopis thaliana
RPW8Be representative, its encoded protein only contains complete CC and NBS structural domain (Xiao et al., 2001).The 7th class, with paddy rice
Xa5Gene is representative, and its encoded protein is a transcription factor (TFIIA γ) (Iyer ﹠amp; McCouch, 2004).
The disease-resistant proteic disease-resistant gene of coding NBS-LRR class is a class disease-resistant gene maximum in the plant disease resistance genes, constructional feature according to the disease-resistant protein N terminal of NBS-LRR class, this genoid can be divided into two big class TIR-NBS-LRR and CC-NBS-LRR(Meyers et al. again, 2002; Pan et al., 2000; Cannon et al., 2002; Richly et al., 2002).TIR-NBS-LRR class disease-resistant gene is mainly found in dicotyledons, does not also find (Bai et al., 2002 so far in the monocotyledons genome; Meyers et al., 2002).The disease-resistant gene that in monocotyledons, identifies the at present disease-resistant albumen of CC-NBS-LRR class of mainly encoding, also there is a large amount of CC-NBS-LRR class disease-resistant genes in the dicotyledons, comparatively speaking, CC-NBS-LRR class disease-resistant gene in the monocotyledons is than more rich and varied (Cannon et al., 2002) in the dicotyledons.
Studies show that NBS, CC, TIR structural domain may participate in signal conduction (Hammond-Kosack ﹠amp; Jones 1997), although this class R albumen does not have the intrinsic kinase activity, NBS can activate kinases or G albumen, NBS has in conjunction with ATP or GTP and hydrolytic enzyme activities (Traut et al., 1994).The signal conduction (Jones et al., 1994) in the disease-resistant defense response of TIR structure possibility involved in plant downstream.Nearest evidence shows, flax
LFamily's diversity selects to also occur in the TIR zone, and this zone forms specificity (Luck et al., 2000) with corresponding LRR zone coevolution.The function of LRR structural domain be mainly concerned with protein-protein and with interaction (the Jones ﹠amp of part; Jones, 1996; Kajava et al., 1998), be product or the indirect interactional position of product (Bent, 1996 that the disease-resistant gene product is direct and the pathogenic bacteria nontoxic gene is encoded by inference; Baker et al., 1997).Jia et al.(2000) proves by yeast two-hybrid
AVR-PitaEncoded protein is processed as one 176 amino acid whose activated protein AVR-Pita
L76The specific exciton of microspecies is delivered to plant cytoplasm and combines with the LRD zone of Pita acceptor specifically, thus the defense response of Pita mediation in the activating cells.Av-rPita after the Ala among the Pita becomes Ser
176Can not combine with LRD, thereby show susceptible.This result has proved that directly the LRR structural domain may be exactly the zone of pathogenic bacteria identification; Mutual " gene pairs gene " relation of making to have verified from molecular level for the first time paddy rice and Pyricularia oryzae of Pita and AvrPita.
Paddy rice is one of most important food crop in the world, and it is staple food with rice that population over half is arranged approximately.By pathogenic fungi
Magnapothe oryzae(no condition:
Pyricularia oryzae) rice blast that causes is that Rice Production is endangered one of severe diseases, annually all causes serious grain loss.From the viewpoint of Sustainable development of environment protection with agricultural, breed and the utilization of disease-resistant variety is the safe and effective procedure of control rice blast.But, because the diversity and the volatility of rice blast fungus population, people lack effective utilization of antagonism gene in addition, and antagonism mechanism lacks understanding fully, so that the susceptibleization problem of disease-resistant variety not only is not resolved, and becomes thremmatology man stubborn problem the most because of the shortage of effective anti-source gene and short-livedization of disease-resistant variety on the contrary.Therefore, excavate, identify and clone disease-resistant gene and reasonably be applied to breeding for disease resistance in the works, become the preferential major issue that solves in the agri-scientific research.
Along with molecular biological fast development, so far, have at least more than 80 rice blast master to imitate resistant gene and be in the news, wherein located for 60 by molecule.At present, also not identified the rice blast master on the 3rd karyomit(e) of paddy rice imitates the resistant gene, all identified the main resistant gene site of imitating on remaining 11 karyomit(e), and contain a plurality of rice blast resistances site on the karyomit(e) that has, and the resistant gene of some gene locus is that cluster exists.At present, aspect clone's research of rice blast resistance gene, existing 13 resistant genes of formal report,
Pib(Wang et al., 1999),
Pita(Bryan et al., 2000),
Pi9(Qu et al., 2006),
Pid2(Chenet al., 2006),
Piz-tWith
Pi2(Zhou et al
., 2006b),
Pi36(Liu et al., 2007a),
Pi37(Lin et al., 2007),
Pik-m(Ashikawa et al., 2008),
Pit(Hayashi et al
.,2009),
Pi5(Lee et al
.,2009),
Pid3(Shang et al
.,2009) and
Pi21(Fukuoka et al., 2009).
Clone's disease-resistant gene is the prerequisite to the further investigation of paddy rice resistance mechanism, discloses the molecule mechanism of rice anti-rice blast and can control and reduce the harm of Pyricularia oryzae to paddy rice better.Simultaneously, clone's disease-resistant gene is modified and transformed, can control and increase the disease resistance of plant artificially, widen the anti-spectrum of plant.These aspects are that employing conventional plant breeding and improving technology institute are inaccessiable.
Summary of the invention
The purpose of this invention is to provide a kind of resistance gene of rice blast and the dna fragmentation that comprises the promotor of regulating and control this gene.
Another object of the present invention provides the coded protein of above-mentioned rice blast resistance gene.
Another object of the present invention provides the above-mentioned carrier that contains above-mentioned resistant gene.
Another object of the present invention provides the host cell of above-mentioned carrier.
Another object of the present invention provides the application of said gene in the preparation transgenic plant.
Further purpose of the present invention provides molecule marker that above-mentioned resistant gene produces and rice blast is had application in the paddy rice of disease resistance in seed selection.
The present invention separates from rice varieties IRBL7-M and obtains
Pi7Gene comprises the gene of 2 coding NBS-LRR proteinoids
Pi7-1With
Pi7-2, its nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, their aminoacid sequences shown in SEQ ID NO.3 and the SEQ ID NO.4 of encoding respectively, structure is shown in accompanying drawing 9 and accompanying drawing 10.Their albumen all comprises 2 main structural domain: NBS and LRR zone, wherein
Pi7-1The NBS structural domain contains conservative kinase 1a:GLPGGGKTTVAR, kinase2:NKKYLIVIDDIW, kinase3a:DLGGRIIMTTRLNSI, GLPL:EDSPCYDIVNMCYGMPLALIW;
Pi7-2The NBS structural domain contains conservative kinase1a:VLSIVGFGGVGKTTIA, kinase2:LEQLLAEKSYILLIDDIW, kinase3a:GGRIIVTTRFQAV, GLPL:EQVPEEIWKICGGLPLAIV, RNBS-D:CLLYLSIFPKGWK, MHDV:KTFQVHDMVLEYI.And the proteic C-end of Pi7-1 is 16 incomplete LRR repetitions, and its leucine content is 14.0%(Fig. 9); The proteic C-end of Pi7-2 is that 13 incomplete LRR repeat, and its leucine content is 17.0%(Figure 10).
Be to be understood that, under the prerequisite that does not influence protein-active (not in proteic active centre), those skilled in the art can carry out various replacements, interpolation and/or lack the aminoacid sequence that one or several amino acid obtains to have same function the aminoacid sequence shown in SEQ ID NO.3 or the SEQ ID NO.4.In addition, consider the degeneracy of codon, for example can be in its coding region, under the condition that does not change aminoacid sequence, or at its non-coding region under the condition that does not influence protein expression, above-mentioned proteic gene order is made amendment to encoding.Therefore, the present invention also comprises replacement, the interpolation that the above-mentioned proteic gene order of encoding is carried out and/or lacks one or more Nucleotide, has the nucleotide sequence that has identical function with above-mentioned encoding gene.The present invention also comprises just sequence or the antisense sequences based on described gene, comprises the host cell that contains described nucleotide sequence or its segmental cloning vector or expression vector, contain described carrier, contains described nucleotide sequence or its segmental plant transformed cell and transgenic plant.
The present invention comprise equally with
Pi7The primary structure part of resistant gene connects the upward formed mosaic gene of proper regulation sequence effectively, and comprises the plant of this gene and the seed of this kind of plant in genome.This gene can be natural or chimeric.For example, will comprise the fragment of this gene and the promotor of a constitutive expression and be connected, this promotor can and be expressed under any condition cytocerastic any period.The promotor of this constitutive expression comprises the 35S promoter of cauliflower mosaic virus etc.On the other hand, also promotor that can the promotor of this gene and a tissue specific expression or developmental stage is specific expressed or accurately the promotor of environmental induction be connected, these promotors are referred to as inducible promoter.Like this, the change of environment, the difference of developmental stage can change this expression of gene.Similarly, also this expression of gene can be limited in some tissues, make by this gene induced disease resistance response and obtain artificial control.Wherein envrionment conditions comprises attack, anaerobic condition and the light etc. of pathogenic bacteria, and tissue and developmental stage comprise leaf, fruit, seed and flower etc.
The present invention also further clones the promotor that obtains described gene, and the dna fragmentation that comprises the promotor of regulating and control this gene is respectively shown in SEQ ID NO.5 and SEQ ID NO.6.
According to provided by the invention
Pi7Gene order information (SEQ ID No.1 and SEQ ID No.2), those skilled in the art can easily obtain by the following method with
Pi7The gene that is equal to: (1) obtains by database retrieval; (2) with
Pi7Gene fragment is that genomic library or the cDNA library of probe Screening of Rice or other plant obtains; (3) basis
Pi7Gene order information design oligonucleotides primer obtains from genome, mRNA and the cDNA of paddy rice or other plant with the method for pcr amplification; (4) exist
Pi7Obtain with the gene engineering method transformation on the basis of gene order; (5) method with chemosynthesis obtains this gene.
Rice blast resistance gene provided by the invention
Pi7Have important use and be worth, its give plant to Pyricularia oryzae (
Magnaporthe oryzae) caused disease produces specific disease resistance response.It is applicable to that these plants comprise monocotyledons and dicotyledons to all plants to this pathogenic bacteria sensitivity.One of application is with described
Pi7Gene order is connected to any plant conversion carrier, will with any method for transformation
Pi7Disease-resistant gene imports paddy rice or other plant cell, can obtain the transgenosis disease-resistant variety of expressing said gene, thereby is applied to produce.Of the present invention gene constructed in plant conversion carrier, can do suitable modification to described gene or its regulating and controlling sequence, also can before its transcription initiation codon, replace the original promotor of described gene, thereby widen and strengthen the resistance of plant pathogenic bacteria with other promotor.
The Another application of resistant gene provided by the invention is to produce specific molecule marker according to described gene order information, includes but not limited to the SNP(mononucleotide polymorphic), the SSR(simple sequence repeats polymorphic), RFLP(restriction enzyme length is polymorphic), CAPS(cutting amplified fragments is polymorphic).Can identify the resistant gene type of paddy rice or other plant with this mark, be used for the molecular marker assisted selection breeding, thereby improve the efficiency of selection of breeding.
The present invention has tangible advantage and effect.Change clone's disease-resistant gene over to susceptible plant, help to produce new disease-resistant plants.Particularly can be with transformation technology a plurality of disease-resistant genes that in plant, add up, and can not produce the chain problem of bad gene in the genome of following appearance in the traditional breeding technology, and can shorten breeding time.The clone of disease-resistant gene overcomes the prerequisite that can not shift the problem of disease-resistant gene in the traditional breeding method between plant species.
The present invention can further provide or use disease-resistant transfer-gen plant and the corresponding seed that obtains based on above-mentioned dna fragmentation, and with gene of the present invention or based on the recombinant chou plants transformed of this gene or the seed that obtains by this class plant.Can gene of the present invention be changed in other the plant with the mode of sexual hybridization.
Description of drawings
Fig. 1 is a resistance gene of rice blast
Pi7Clone's policy map.Before there had been report to claim
Pi1(C101LAC),
Pi7(RIL29) and
PikTo go out identical response type (Tsunematsu et al. 2000, Breeding Science 50:229-234) from Filipine a plurality of Pyricularia oryzae strains expressed;
Pi1With
Pi7In fact be
PikAllelotrope or gene identical (Campbell et al. 2004, Phytopathology 94:302-307) with it.In conjunction with this research department pair with above-mentioned
PikAllelotrope has " gene pairs gene, gene-for-gene " interactional avirulence gene of rice blast location, clone's result, thereby infers
Pi7May be exactly
PikNew allelotrope.Therefore, the present invention is to have announced
Pi7Localized information (Campbell et al. 2004, Phytopathology 94:302-307) is the basis, makes up the electronics physical map in this goal gene zone; Adopt with
PikAllelotrope it
Pik-m(Ashikawa et al. 2008, Genetics 180:2267 – 2276) and
Pik(Zhai et al. 2010, New Phytologist DOI:10.1111/j.1469-8317.2010.03462.x) similar clone's strategy is cloned this resistant gene.
Fig. 2 is
PikBunch allelotrope is to the comparison of the anti-spectrum of 8 rice blast fungus populations.Ordinate zou is a fastness frequency among the figure, and X-coordinate is 8 rice blast fungus populations (GD, Guangdong; FJ, Fujian; HN, the Hunan; GZ, Guizhou; SC, Sichuan; LN, Liaoning; JL, Jilin; HLJ, Heilungkiang).5
PikBunch allelotrope (IRBLks-S,
Pik-s; IRBLk-Ka,
Pik; Tsuyuake,
Pik-m; IRBLkp-K60,
Pik-p; IRBL7-M,
Pi7).This shows,
Pi7The higher resistance of rice blast fungus population performance to Guangdong, Hunan, Guizhou, Sichuan and Liaoning.
Fig. 3 is a goal gene
Pi7The design of graphics of zone electronics physical map.Fig. 3 A: above-mentioned Campbell etc. (2004) make up
Pi7The genetic map that the zone is rough; Fig. 3 B: according to
Pik-m(Ashikawa et al. 2008, Genetics 180:2267 – 2276) and
PikThe locating information of (Zhai et al. 2010, New Phytologist DOI:10.1111/j.1469-8317.2010.03462.x) makes up
Pi7With
PikBunch allelic integration physical map; Fig. 3 C: 4 BAC clones that select gene region to exist; Fig. 3 D:
PikGene candidate region (Zhai et al. 2010, New Phytologist 180:2267 – 2276); Fig. 3 E:
Pi76 disease-resistant candidate genes that gene locus exists on the fine type gene group of Japan with NBS-LRR conserved structure; Fig. 3 F:
Pi72 disease-resistant candidate genes that gene locus exists on IRBL7-M/Tsuyuake type gene group with NBS-LRR conserved structure.This shows,
Pi7There is two types genome on the gene locus, has very big disappearance/insertion each other;
Pi7Gene have only 2 candidate genes (
Pi7-1With
Pi7-2).
Fig. 4 is a resistance gene of rice blast
Pi7(by
Pi7-1With
Pi7-2Composition) genetic complementation T
0The resistance of plant is identified pictorial diagram.Solid arrow refers to disease-resistant plant among the figure, and disease plant that dotted arrow refers to illustrates resistant gene
Pi7By
Pi7-1With
Pi7-2Forming could the function of appeal.
Fig. 5 is a resistance gene of rice blast
Pi7The part T of genetic complementation
0The PCR of the selective marker HPT gene of transformant detects figure.Among the figure from left to right, swimming lane 1,15: molecular weight marker DL2000; Swimming lane 2: empty carrier (Vector), positive control; Swimming lane 3: transformation receptor kind Q1063, negative control; Swimming lane 4: donor kind IRBL7-M, negative control; Swimming lane 5-14:T
0Transformant.The result shows, all disease-resistant transformant have all detected the pcr amplification product of selected marker, and susceptible transformant does not detect the pcr amplification product of selected marker, illustrates that disease-resistant transformant is to have recovered resistance owing to transformation construct has been incorporated into to have obtained to express in the genome of acceptor kind Q1063 of high sense.R: high anti-; MR: in anti-; MS: middle sense; S: susceptible.
Fig. 6 is a resistance gene of rice blast
Pi7Genetic complementation offspring's genotype and phenotypic coseparation analysis figure.Among the figure from left to right, swimming lane 1,11: molecular weight marker DL2000; Swimming lane 2: empty carrier (Vector), positive control; Swimming lane 3: transformation receptor kind Q1063, negative control; Swimming lane 4-10:T
1Transform the separation offspring of system.The result shows, at T
1Transform among the separation offspring of system the T that all are disease-resistant
1Transformant has all detected the pcr amplification product of selected marker, and susceptible T
1Transformant does not detect the pcr amplification product of selected marker, and this T is described
1Conversion be the genotype of offspring's individuality and phenotype be divided into from, that is transgenosis is separated among the offspring genetic stability at it and is expressed.R: high anti-; MR: in anti-; S: susceptible.
Fig. 7 is a resistance gene of rice blast
Pi7RNA interfere (RNAi) F
1The resistance of plant is identified pictorial diagram.Among the figure HF4 be donor kind IRBL7-M with
Pik-h(be
Pi7Height homologous allelotrope) RNAi T
1The F of transformant kh4i-11 genetic cross
1Plant, its postvaccinal performance disease is susceptible (S), explanation
Pi7The function quilt
Pik-hRNAiT
1The construct that transformant contained and interfered (destruction); HF6 be donor kind IRBL7-M with
Pik-hRNAiT
1The F of transformant kh4i-26 genetic cross
1Plant, its postvaccinal performance disease is susceptible, explanation
Pi7The function quilt
Pik-hRNAiT
1The construct that transformant contained and interfered (destruction); HF10 is for containing among the figure
PiaKind Aichi Asahi with
Pik-h(
PiaBe with
Pik-h/
Pi7The non-allelic genes that the position is different) RNAi T
1The F of transformant kh4i-9 genetic cross
1Plant, its postvaccinal phenotype are disease-resistant (R), explanation
PiaThe resistance function do not have quilt
Pik-hRNAiT
1The construct that transformant contained and interfered (destruction) therefore, can be used as the contrast that non-specific RNA interferes; IRBL7-M is
Pi7The donor kind, its postvaccinal phenotype is disease-resistant (R), illustrate the inoculation used rice blast fungi isolates CHL381 be suitable.
Fig. 8 is a resistance gene of rice blast
Pi7RNA interfere (RNAi) F
1The Molecular Identification pictorial diagram of plant.Among the figure from left to right, swimming lane M(both sides): molecular weight marker DL2000; Swimming lane 1: above-mentioned IRBL7-M, do not detect the special molecule marker of RNAi construct (
Hpt), promptly do not contain construct; Swimming lane 2:RNAi T
1Transformant kh4i-11, detected the special molecule marker of RNAi construct (
Hpt), promptly contain construct; Swimming lane 3: the F of above-mentioned HF4
1Plant contains construct; Swimming lane 4:RNAi T
1Transformant kh4i-26 contains construct; Swimming lane 5,6: the F of above-mentioned HF6
1Plant contains construct; Swimming lane 7: above-mentioned Aichi Asahi, do not contain construct; Swimming lane 8:RNAi T
1Transformant kh4i-9 contains construct; Swimming lane 9,10: the F of above-mentioned HF10
1Plant contains construct.Above presentation of results, the F of HF4 and HF6
1Plant because be subjected to allele specific RNA interfere and make its resistant gene that contains (
Pi7) function do not express; In contrast, the F of HF10
1Plant make because the allele specific RNA of the right and wrong that are subjected to interferes its resistant gene that contains (
Pia) the function normal expression.
Fig. 9 is a resistance gene of rice blast
Pi7Constitutive gene
Pi7-1Gene structure and sequence chart.Fig. 9 A: light box indicating 5 ' and 3 '-UTR among the figure; Dark box indicating exon; Lines are represented intron; The size (bp) in the promotor of this gene coding region (ATG) and terminator (TAG) and each zone also is shown in wherein.Fig. 9 B: the amino acid of CC motif represented to form in the boldface type of CC structural domain band underscore among the figure, and aminoacid sequence conservative among the NBS represented in the boldface type of NBS zone band underscore.The amino-acid residue that independently list the lower section is the terminal LRR of C-zone; The conservative motif of xLDL in LRR zone represented to form in the boldface type of band underscore; Back, LRR zone also has one section CNL(C and holds non-LRR zone) aminoacid sequence.Two aminoacid sequences that indicate that roll off the production line are
Pi7Special amino acid replacement [substitution, with
PikBunch other allelotrope (
Pik,
Pik-s,
Pik-p,
Pik-m) compare].
Figure 10 is a resistance gene of rice blast
Pi7Another constitutive gene
Pi7-2Gene structure and sequence chart.Figure 10 A: light box indicating 5 ' and 3 '-UTR among the figure; Dark box indicating exon; Lines are represented intron; The size (bp) in the promotor of this gene coding region (ATG) and terminator (TAG) and each zone also is shown in wherein.Figure 10 B: the amino acid of CC structure represented to form in the boldface type of CC structural domain band underscore among the figure, and aminoacid sequence conservative among the NBS represented in the boldface type of NBS zone band underscore.The amino-acid residue that independently list the lower section is the terminal LRR of C-zone; The conservative motif of xLDL in LRR zone represented to form in the boldface type of band underscore.Two aminoacid sequences that indicate that roll off the production line are
Pi7Special amino acid replacement [substitution, with
PikBunch other allelotrope (
Pik,
Pik-s,
Pik-p,
Pik-m) compare].
Figure 11 is a resistance gene of rice blast
Pi7The quantitative RT-PCR of expression characterization detects figure.Left side figure is a constitutive gene
Pi7-1Different inoculation time points (0 hr, 12 hr, 24 hr, 72 hr, relative expression's level 120hr) this shows, this expression of gene type is, progressively raises from 12 hr-72 hr, then progressively downward modulation.Right figure is another constitutive gene
Pi7-2Relative expression's level at different inoculation time points this shows, this expression of gene type is that 12 hr-24 hr progressively raises, then progressively downward modulation.It can also be seen that thus this gene is at inoculation contrast (H
2O) and between the inoculation pathogenic bacteria show visibly different inducible expression.2 genes all show as constitutive expression because the inoculation before and can both detect 2 expression of gene afterwards.Ordinate zou is relative expression's level among the figure, and X-coordinate is represented the time, and unit is hour (h), and the twill block diagram is contrast (before the inoculation), and black surround figure is inoculation contrast (H
2O), blank block diagram is the pathogenic bacteria inoculation.
Figure 12 is for utilizing resistance gene of rice blast
Pi7The genotype identification figure of specific molecular marker.This shows, 2 specific molecular markers be used in combination can with
Pi7Distinguish with other several allelotrope.Figure 12 A is mark T1-795G, this mark can with the genotype of resistant variety IRBL7-M (
Pi7/Pi7) and resistant variety IRBLkp-K60(
Pik-p/
Pik-p) and susceptible acceptor kind dragon round-grained rice 24Q1063 (
Pi7/pi7) distinguish; Figure 12 B is mark A2-1879G, this mark can with the genotype of resistant variety IRBL7-M (
Pi7/Pi7) and resistant variety IRBLk-Ka (
Pik/Pik), IRBLkm-Ts(
Pik-m/Pik-m), IRBLks-S(
Pik-s/Pik-s), susceptible acceptor kind Q1063 (
Pi7/pi7), susceptible acceptor kind dragon round-grained rice 24 (
Pi7/pi7) distinguish.Among the figure, M: molecular weight marker DL2000.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.In the embodiments of the invention part, we have set forth
Pi7Resistance feature, separating clone, functional character and the Molecular Identification of gene, isolating
Pi7Gene can be connected with appropriate carriers, changes in the plant materials, makes this plant materials have certain resistance.
In order to compare with clear and definite
Pi7With
Pik4 allelotrope in site (
Pik,
Pik-p,
Pik-s,
Pik-m) anti-spectrum, utilization is (60 bacterial strains) from Guangdong, Fujian (40), Hunan (41), Guizhou (60), Sichuan (66), Liaoning (108), 498 bacterial strains of total that Jilin (60) and Heilungkiang (63) collect to above-mentioned 5 allelic kinds of holding (be respectively IRBL7-M, IRBLk-Ka, IRBLkp-K60, IRBLks-S and Tsuyuake) carried out anti-spectrum comparative analysis.The result shows,
Pi7To the higher resistance of rice blast fungus population performance in Guangdong, Hunan, Guizhou, Sichuan and Liaoning, illustrate that thus this gene can use (Fig. 2) in above-mentioned area.Rice varieties RBL7-M, IRBLk-Ka, IRBLkp-K60 and IRBLks-S document (Kobayashi et al. Development of new sets of international standard differential varieties for blast resistance in rice (
Oryza sativaL.). JARQ, 2007, open in 41:31-37).Rice varieties Tsuyuake is at document (Wang et al. Characterization of rice blast resistance genes in the
PikCluster and fine mapping of the
Pik-pLocus. Phytopathology, 2009, open in 99:900-905).
Previous Position Research shows
Pi7The assignment of genes gene mapping in
PikThe genome area that cluster gene is identical (Campbell et al. Development of co-dominant amplified polymorphic sequence markers in rice that flank the
Magnaporthe griseaResistance gene
Pi7(t) in recombinanant inbred line 29. Phytopathology, 2004,94:302-307; Fig. 3 A); The anti-spectrum analysis of this research department shows
Pi7Gene with
PikBunches of 3 allelotrope (except resistance more weak
Pik-sOutside) most of test strain is shown identical resistance reaction (Fig. 2); What this research department was previous studies show that, with
Pi7Corresponding nontoxic gene
AvrPi7Also be with
PikThe nontoxic gene of bunch resistant gene correspondence
AvrPik/km/kpBe homotopic.The result of comprehensive above-mentioned three aspects according to " gene pairs gene " theory of Plant diseases system, infers
Pi7Should also be
Pik/km/kpAllelotrope.Therefore, the present invention has adopted the clone with this research department
PikStrategy that allelotrope is similar and method have been finished
Pi7The structure (Fig. 1) of target area electronics physical map.That is, based on the sequence information of paddy rice with reference to kind Japan fine (Nipponbare), by the information biology means, with
Pi7Chain mark (Campbell et al. 2004; Fig. 3 A) and with
PikGene is isolating mark (Zhai et al. 2010, New Phytologist DOI:10.1111/j.1469-8317.2010.03462.x altogether; Fig. 3 B) carry out physical location and integrate, and made up the contig figure (Fig. 3 C) in goal gene zone thus, and electronics physical map (Fig. 3 D).
In order to determine
Pi7Candidate gene, the applicant utilizes the fine reference sequences of Japan, by 3 kinds of predictive genes software RiceGAAS (http://ricegaas.dna.affrc.go.jp), Gramene (http: // 143.48.220.116/resources/) and the FGENESH (http://www.softberry.com) of Softberry predictive genes and note analysis have been carried out in the goal gene zone, tentatively determined
Pi7Candidate resistance gene be 6 nucleotide binding sites and rich leucine repeat (nucleotide binding site-leucine-rich repeat, candidate gene NBS-LRR) (
Pi71-NP,
Pi72-NP,
Pi73-NP,
Pi74-NP,
Pi75-NPAnd
Pi76-NP).
To 6 candidate genes carry out based on the gene specific mark existence/disappearance (presence/absence P/A) analyzes, and the result shows, with
Pik Bunch 3 allelotrope are the same, 4 candidate genes that exist at the fine reference sequences of Japan (
Pi71-NP,
Pi72-NP,
Pi73-NP,
Pi74-NP)
Pi7The institute hold among the kind IRBL7-M be non-existent (Fig. 3 E, 3F).Therefore,
Pi7Candidate resistance gene have only
Pi7-1With
Pi7-2, next step will be by following its function of functional complementation experimental verification.
Previous studies show that,
PikBunch 2 allelotrope
Pik-m(Ashikawa et al. 2008, Genetics 180:2267 – 2276) and
Pik(Zhai et al. 2010, New Phytologist DOI:10.1111/j.1469-8317.2010.03462.x) is all by 2 closely linked genomic constitutions.Therefore, utilize the high-fidelity enzyme
PhusionIn conjunction with long segment PCR(long-range PCR, LR-PCR) technology, total DNA with IRBL7-M is a template, according to or with reference to Liu et al. (2007, Genetics, 176:2541-2549) with Zhai et al. (2010, New Phytologist DOI:10.1111/j.1469-8317.2010.03462.x) experimental technique and the program of Miao Shuing, above-mentioned 2 candidate genes are made as a whole gene carried out amplification, clone, carried out then based on the acquired experiment of the function of genetic complementation (Fig. 1).The result shows, has obtained the transformant (table 1 that has complementary functions in the genetic complementation offspring; Fig. 4).
Amplification, clone
Pi7-12Primer be:
Forward primer: TTTT
GGCGCGCCGGTGCGGGAAGAAGACGGGATAAAGA
Reverse primer: TTTT
GGCGCGCCGCCGACGATAGCAACCGACAGGAGTG
Utilize hygromycin gene in the conversion carrier (
Hpt) mark carried out the PCR detection to transformant.Detected result proof target gene fragment has imported in the disease-resistant transformant, and does not import (Fig. 5) in the susceptible transformant.
Table 1.
Pi7The genetic complementation experiment analysis results of 2 constitutive genes
bThe success ratio that has complementary functions (%) is R+MR/R+MR+MS+S*100%
The experimental result of above-mentioned genetic complementation shows, candidate gene
Pi7-12Be exactly
Pi7Functional gene.Rice varieties Q1063 and bioabsorbable carrier material pCAMBIA1300 are open in document (Lin et al.2007, Genetics 177:1871-1880); Rice varieties Longjing 24(dragon round-grained rice 24) open in document (Zhai et al. 2010, New Phytologist DOI:10.1111/j.1469-8317.2010.03462.x).
In order further to confirm the genetic stability of transgenic constructs, select the transformation generation T of part at transformation generation
1Strain is to have carried out the coseparation analysis (Fig. 6) of resistance phenotype/resistant gene type.The result shows, resistance phenotype and resistant gene type be divided into fully from.That is transgenic constructs can genetic stability in transformation generation, expression.
For further affirmation
Pi7Function, and
Pi7Whether be exactly
PikBrand new allelotrope, the applicant carried out based on
PikAllelotrope (
Pik-h) T of RNAi
1The afunction experiment (Fig. 1) of transformant filial generation.The result shows,
Pik2 plant (kh4i-11 and kh4i-26) that allelotrope RNAi isozygotys stable and the hybridization F of donor kind IRBL7-M
1Plant all shows
Pi7The forfeiture of resistance function.That is,
Pi7The resistance function because quilt
PikThe T of allelotrope RNAi
1The construct that transformant contained and interfered (destruction) (HF4 and HF6 among Fig. 7).Contrast as non-specific RNA interferes contains
PiaKind Aichi Asahi with
Pik-h(
PiaBe with
Pik-h/
Pi7The non-allelic genes that the position is different) RNAi T
1The F of transformant kh4i-9 genetic cross
1Plant, its postvaccinal phenotype still are disease-resistant (HF10 among Fig. 7), explanation
PiaThe resistance function do not have quilt
Pik-hRNAiT
1The construct that transformant contained and interfere (destruction).IRBL7-M is
Pi7The donor kind, its postvaccinal phenotype is disease-resistant, illustrate the inoculation used rice blast fungi isolates CHL381 be suitable.
For the forfeiture of confirming filial generation resistance function whether with RNAiT
1The construct that transformant contained is relevant, and the parent of above-mentioned 3 cross combinations and offspring thereof have been carried out Molecular Identification based on the construct specific molecular marker.The result shows, offspring (HF4 and HF6) the resistance phenotype relevant with its molecular marker gene type ( swimming lane 3,5,6 of Fig. 8) that specific RNA is interfered, but not offspring (HF10) the resistance phenotype uncorrelated with its molecular marker gene type ( swimming lane 9,10 of Fig. 8) that specific RNA is interfered.
The employing method of moving one's steps is right
Pi7Dna sequence dna measure.Utilize the RACE technology, obtained
Pi7Full length cDNA sequence and it is checked order.
Pi7Gene DNA length is that 16.9 kb (comprise
Pi7-1With
Pi7-2), wherein,
Pi7-1Full length cDNA sequence be 3723 bp, contain the opening code-reading frame of one 3429 bp, 5 ' and 3 ' non-translational region is respectively 104 bp and 190 bp.By icp gene group DNA and cDNA sequence, find that the opening code-reading frame of this gene contains 2 introns and 3 exons (Fig. 9 A).Another constitutive gene
Pi7-2Full-length cDNA be 3690 bp, contain the opening code-reading frame of one 3066 bp, 5 ' and 3 ' non-translational region is respectively 380bp and 244bp.By icp gene group DNA and cDNA sequence, find that the opening code-reading frame of this gene contains 1 intron and 2 exons, and contain an intron (Figure 10 A) at 5 ' non-translational region.
Pi72 constitutive gene encoded protein sequences that gene comprises are shown in Pi7 SEQ ID No.3 in the sequence table and Pi7SEQ ID No. 4.
Pi7-11 protein polypeptide of forming by 1142 amino-acid residues of genes encoding, molecular weight is 126.60 KD, iso-electric point is 6.46.Utilize this protein polypeptide of COIL analysis revealed to have CC (coiled-coil) structural domain.Pi7-1 albumen belongs to NBS-LRR albumen, and conservative kinase 1a (GLPGGGKTTVAR) is positioned at the 290th amino-acid residue of this polypeptide in the NBS structural domain; Kinase 2(NKKYLIVIDDIW) is positioned at the 376th amino-acid residue of this polypeptide; Kinase 3a (DLGGRIIMTTRLNSI) is positioned at the 402nd amino-acid residue of this polypeptide, and GLPL (EDSPCYDIVNMCYGMPLALIW) is positioned at 461 amino-acid residues of this protein polypeptide.And 610-960 amino-acid residue of this proteic C-end is 16 imperfect LRR repetitions, and its leucine content is 14.0%, and its C-terminal also has the aminoacid sequence (Fig. 9 B) of a non-LRR structure (CNL).Two aminoacid sequences that indicate that roll off the production line are among the figure
Pi7The amino acid of gene specific is replaced (substitution), and the gene specific acidic amino acid of this site and following another constitutive gene is replaced the site and combined, and can differentiate
Pi7Gene and other allelotrope (
Pik,
Pik-m,
Pik-p,
Pik-s) difference (seeing embodiment 9 for details).
Pi7-21 protein polypeptide of forming by 1021 amino-acid residues of genes encoding, molecular weight is 114.57 KD, iso-electric point is 8.64.Utilize this protein polypeptide of COIL analysis revealed not have the CC structural domain, find to have the CC structural domain but utilize more powerful forecasting tool Paircoil2 to analyze.Pi7-2 albumen belongs to NBS-LRR albumen, and conservative kinase 1a (GFGGVGKTTIA) is positioned at the 211st amino-acid residue of this polypeptide in the NBS structural domain; Kinase 2(KSYILLIDDIW) is positioned at the 330th amino-acid residue of this polypeptide; Kinase 3a (GGRIIVTTRFQAV) is positioned at the 358th amino-acid residue of this polypeptide, GLPL (EQVPEEIWKICGGLPLAIV) is positioned at the 415th amino-acid residue of this polypeptide, RNBS-D(CLLYLSIFPKGWK) be positioned at the 488th amino-acid residue of this polypeptide, MHDV(KTFQVHDMVLEYI) be positioned at the 553rd amino-acid residue of this polypeptide.And the 610-960 of this a proteic C-end amino-acid residue is 13 imperfect LRR repetitions, and its leucine content is 17.0%(Figure 10 B).Two aminoacid sequences that indicate that roll off the production line are among the figure
Pi7The amino acid of gene specific is replaced (substitution), and the gene specific acidic amino acid of this site and above-mentioned another constitutive gene is replaced the site and combined, and can differentiate
Pi7Gene and other allelotrope (
Pik,
Pik-m,
Pik-p,
Pik-s) difference (seeing embodiment 9 for details).
Utilize the quantitative RT-PCR technology right
Pi7The expression of gene pattern is analyzed.The different time point in disease-resistant variety IRBL7-M inoculation back (0 hr, 12 hr, 24 hr, 72 hr 120h) go up and gather blade and extract its total RNA, utilize reverse transcription test kit SuperScript
TMReverse Transcriptase II carries out the synthetic of reverse transcription cDNA article one chain.The primer of RT-PCR is,
RRT5F：GAAGCTCTGATCAACGGTATTCC，
RRT5R：TCTTTGATCATCTTCGGGATACG；
RRT17F：TGAACTTCCACGATTGGATCCAC，
RRT17R：ACATGGTTCTTGAATACATCATGTC?。
Quantitative RT-PCR uses CFX96 Real-time PCR detection system and SYBR Premix Ex Taq test kit (precious biotech firm), and operation is carried out according to the test kit explanation.Figure 11 (left side) is a constitutive gene
Pi7-1Relative expression's level at different inoculation time points this shows, this expression of gene type is progressively to raise from 12 hr-72 hr, then progressively downward modulation.Figure 11 (right side) is another constitutive gene
Pi7-2Relative expression's level at different inoculation time points this shows, this expression of gene type is that 12 hr-24 hr progressively raises, then progressively downward modulation.It can also be seen that thus this gene is at inoculation contrast (H
2O) and between the inoculation pathogenic bacteria show visibly different inducible expression.2 genes all show as constitutive expression because the inoculation before and can both detect 2 expression of gene afterwards.
As described in embodiment 7,
Pi7Exist the amino acid of a gene specific to replace the site in 2 constitutive genes of gene respectively, utilize these 2 sites to develop the molecule marker Pi7-SNP-1 (Pi7-SNP-1F:GCAGGTCAGCCAAGCAAT of gene specific respectively, Pi7-SNP-1R:CAACCGTTGTTTTGCCTCC, the amplified production restriction enzyme
MseI carries out enzyme and cuts) and Pi7-SNP-2 (Pi7-SNP-2F:CGTGGAAGTTCAACAAAAGG, Pi7-SNP-2R:CAGCACCTGTATTATCCCAT, amplified production restriction enzyme
NdeI carries out enzyme and cuts), the two is differentiated in conjunction with both can be used for
Pi7Gene and other allelotrope (
Pik,
Pik-p,
Pik-m,
Pik-s) difference (enzyme of amplified production is cut the effect difference; The swimming lane 1 of Figure 12 compares with swimming lane 2-5), also can be used for identifying filial generation
Pi7Range gene type on the site, promptly
Pi7/Pi7With
Pi7/pi7Plant (enzyme is cut the effect difference; The swimming lane 1 of Figure 12 compares with swimming lane 6-7).These information can be applied in the molecular marker assisted selection breeding process, to improve the purpose and the efficient of breeding.
Will
Pi7Gene clone is to plant conversion carriers such as pCAMBIA1300, in the agrobacterium strains such as importing EHA105, be used to transform susceptible rice varieties Longjing 24(dragon round-grained rice 24) and Q1063,285 strain transformed plants obtained altogether, wherein 155 strains performance resistance reactions (table 1).This explanation can be used
Pi7Gene transformation paddy rice susceptible variety after a series of procedures of breeding such as selfing, purifying selection, can produce disease-resistant variety and in being applied to produce.
The sequence explanation
SEQ ID NO. 1 ﹠amp; The 2nd,
Pi7-1With
Pi7-2Nucleotide sequence; SEQ ID NO. 3 ﹠amp; The 4th, SEQ ID NO. 1 ﹠amp; 2 coded product; SEQ ID NO. 5 ﹠amp; The 6th, have promotor
Pi7-1With
Pi7-2Nucleotide sequence.SEQ ID NO. 7 ﹠amp; The 8th, be used for increasing
Pi7-12Primer right; SEQ ID NO. 9 ﹠amp; 10 and SEQ ID NO. 11 ﹠amp; 12 is respectively that primer is to RRT5F, RRT5R and RRT17F, RRT17R; SEQ ID NO. 13 ﹠amp; The 14th, primer is to Pi7-SNP-1F and Pi7-SNP-1R; SEQ ID NO. 15 ﹠amp; The 16th, primer is to Pi7-SNP-2F and Pi7-SNP-2R; SEQ ID NO. 17 ~ 26 is respectively
Pi7-1Kinase 1a, kinase 2, kinase 3a, GLPL sequence and
Pi7-2Kinase 1a, kinase 2, kinase 3a, GLPL, RNBS-D, MHD sequence.
Sequence table
＜110〉Agricultural University Of South China
＜120〉rice blast resistance gene Pi7 and application thereof
<130> *********
<160> 22
<170> PatentIn?version?3.5
<210> 1
<211> 9101
<212> DNA
＜213〉Oryza paddy rice (Orysa sativa L.)
<220>
<221> 5'UTR
<222> (1)..(104)
<220>
<221> CDS
<222> (105)..(668),?(819)..(1387),?(4160)..(6455)
<220>
<221> 3'UTR
<222> (6456)..(6645)
<400> 1
aaccttgctc?taattacact?cggagtcgga?gagtcaggag?gtgagagagt?agcactcaac 60
gcaaaagggg?atcggccgag?ccgccgatcg?aggcgcgagt?agggatggag?gcggctgcca 120
tggccgtaac?cgcagccacg?ggggccttgg?cgcccgtgct?agtgaagctg?gccgctttgc 180
tggacgacgg?ggagtgcaat?cttctggagg?ggagccggag?cgacgcagag?ttcatcagat 240
ccgagctgga?ggccgttcat?tctctcctca?ccccaaatat?cttggggagg?atgggggatg 300
acgatgcggc?gtgcaaggat?ggcttgattg?cggaggtccg?ggagctgtcc?tacgacctgg 360
atgatgccgt?cgacgacttc?ttggagctca?atttcgagca?gcgaagaagc?gcaagccctt 420
tcggtgagct?caaggcaaga?gttgaggagc?atgtctccaa?tcgcttctct?gactggaagc 480
taccggcggc?gagccttccg?ccgtcgtcgg?tacaccgccg?agctggcttg?ccgccaccag 540
atgcagagct?ggtggggatg?gacaaacgta?tggaagagct?caccaaattg?ctggaacaag 600
ggagcaatga?tgcttcacga?tggcgcaagc?gaaaaccgca?tttcccgctc?agaaaaacag 660
ggctaaaggt?acggttggat?ctcgattctt?cacaaatata?gcttcctccg?atagcagtgc 720
caatgaattt?gtttacttct?ctcttgattc?tttaatttgg?aagtactgta?taacaaacat 780
ggagggatcg?tcatttaact?taattttttt?tgttgcagca?aaaaatcgtg?atcaaggttg 840
ccatggaggg?caataattgc?cgttcaaaag?caatggcttt?agttgcgagc?actggaggag 900
tggactcggt?tgcgctcgta?ggtgatctaa?gagacaagat?agaggtggtc?ggttatggca 960
ttgaccccat?caagctgatc?tccgcgctcc?ggaagaaggt?gggcgatgcg?gagttgctgc 1020
aggtcagcca?agcaaacaaa?gatgtgaagg?agacgacgcc?gatgcttgcg?ccggtgaaat 1080
ccatatgtga?atttcacaag?gtcaaaacag?tttgcatcct?tggattgcca?ggtggaggca 1140
aaacaacggt?tgccagagaa?ttatatgacg?ccttgggaac?gcacttccca?tgccgggttt 1200
tcgtgtcagt?ctctccaagt?tctagtccca?gtcccaatct?cacaaagact?cttgcagaca 1260
ttttcgctca?agcacaacta?ggagtaaccg?atacacttag?cacaccatat?ggtgggagtg 1320
ggaccgggag?agctcttcaa?caacatctca?tcgacaacat?atcagctttc?ctcctcaaca 1380
aaaagtaagc?aatatcttat?atctcttatc?tagcttgtcc?ttaatccggc?ttcccaaatt 1440
aaagtgaaca?ggctatatgt?ccatataatg?ttgggttttt?ttttttctgt?cctcgatgag 1500
gtatatatca?agatatgcca?aacttttttt?aattagcgtt?actttattct?acctagtaaa 1560
tagatacaga?aatggggcag?gcccctcctt?tgtgacaggc?caatggtttt?atgatgtgga 1620
aacaactccc?ttatcactga?agctcttgct?attactcgtg?atggtactga?tcttgcaaag 1680
gcttgcagta?tttgtaaatc?cacagggagt?ggtcatcttt?ttttttttaa?gataatgaat 1740
agaaatctgg?cctctatata?gaaagccaaa?ggttacacaa?gtgcatacac?tccaaatctc 1800
aaagctgaga?aacacgaaaa?acaaacgacc?aaaaagaaaa?gacgataaga?ttaagtttca 1860
agcttttcct?ccttgcttca?gaaaacaggg?aaatgcagag?ctagcccgct?cttcccctgc 1920
catgccctct?cactgccatt?gcaactacca?caaaagctcc?cctgtttcgc?cgtgagcgaa 1980
gggaggggat?ggaactagtc?tgctgctttg?ttgtcgccaa?gcactggttt?catgctgccc 2040
aaacaaccta?tgccccgcta?gcgataacga?gtctgttgcc?gccatgctgt?tgtcgctgga 2100
gagcacttgt?cgctgctcag?ctatgtgtta?agtaagctac?taacaatctc?tccattctct 2160
tgtagactgc?ttataaaaga?ttgtacttca?actttttatt?aatgaaatag?agttcctgcc 2220
ttacaacaac?aagaacgaga?gagagagaga?gagccaatat?cacgagttag?cactgtgaag 2280
acttcctgac?tgttatgtct?tcaagaacag?tataaaagca?tttgccacta?taaaaatatg 2340
atagccctca?agatcattaa?aaatatgtca?tgttctttta?ccttcataac?aaccagtatc 2400
acaaatatga?aaacatttaa?aggaaaatca?gtatttgcca?tttatgtaaa?gaaaaactag 2460
actagaactc?tgggctttta?ttttagtgca?cactgtatac?atgtgtgttc?tttgacgtat 2520
atacttgata?ttttttcaaa?aacttttggg?ggcatatctg?taacccatgc?cccatgcatc 2580
caaagtagta?gtgagacaac?tttcgtatca?atggacatgt?ggcattaaat?ttaatcccaa 2640
tatttgttct?ctcgaagtcc?tgaacatata?attggacaaa?attatataat?ttaattaggc 2700
caattgagcc?atatatacac?acactataag?aaacttctac?aaaacaaaca?ttcgctcctt 2760
ttaggttttg?accagtctat?acatgaacca?gccaacggtg?tgctggtctg?actataaatg 2820
tttttttaga?gagtaaaggc?accttccagt?acctctctcg?aggacagtaa?aaacacccat 2880
gctttaaggt?tatgaacaac?aaagcataga?acaaccacaa?gaaaaaaaaa?aacaactaga 2940
acaagttctg?gaactagtta?gggattcggg?aagccattgc?ttgctggctt?gggacaagct 3000
atgcctgcca?ttggactatg?gtggagactg?ggcataaagg?atctcaatct?cttggagatt 3060
ggcctatgtc?ctaggtggcc?atggctgact?gcaaggagat?atatttcttg?caacggaaat 3120
tttcattgca?aaagctgaaa?atcgttgcga?tatgtaccta?ttgtgacata?attgaatcca 3180
ttgggagccg?tagcaataaa?tcccgtggta?ataggctatt?gcaatgattt?tccgatggtt 3240
gcataaaaag?gtgctattac?aatggttttg?cattgctatt?gcaacaactt?gatatgtcat 3300
aggtatttat?tgcaacagtt?tgtaccatgc?tgcaataaga?tttcgcaaca?cagacctatt 3360
cattaaatag?cctatttcca?cacattcatt?tttgtggcaa?taattcagtg?cgacaagcat 3420
gttctatagc?tataacctga?tgcaacgggt?tagacttgtt?gcagtaactt?attagcacat 3480
ttaatttttt?actaaattta?tattgattca?actatttcaa?catcattcaa?tacagtaaat 3540
actggaaaat?gcaagcaatc?tccaaaaatt?caccaataag?agaaacgaat?taaatcatat 3600
acacaattat?ttcacaccgt?acagtgcact?taagtgtagg?aaatataatg?ctatatacat 3660
ttccaaccct?caatacaggt?tctgtaaata?atgaaaagaa?acatcaattt?gatttcttga 3720
ccggtccctc?tgagacacac?agtgctttcc?tcagcaacat?cgttgccgat?ctatgtaact 3780
tgtaaactcc?ttgtgcttaa?taaattctgg?ccagggttac?ttcagcctgc?atggcgaaaa 3840
aaaagaactt?gttagggaga?tcgcaaacaa?atgttagctg?ccccatttct?tctctactga 3900
ccataaaagc?tctaggatca?ggtcatgaaa?acaatgccgt?cagaccggaa?atactcaaga 3960
ttcagaacac?gactcctagg?aactgcaagt?ttaaatttca?acaaaagcaa?aatacaacca 4020
gatgacaaac?taatatatat?cagctgactg?ttcatctcaa?gtggactcac?atctgtgaaa 4080
ttgttagttc?tatgcatata?tgctaatgta?atactaatat?gctattgagg?cttattactc 4140
ttctcgactt?ttataggtat?ctcattgtaa?tcgatgacat?ttggcattgg?gaagaatggg 4200
aagtcatcag?aaagtccatt?cccaagaatg?atctgggtgg?tagaataatc?atgactactc 4260
gtcttaattc?aatagctgag?aagtgccaca?ctgatgacaa?tgatgttttt?gtctacgaag 4320
ttggggatct?agataataat?gatgctttgt?cgttgtcttg?ggggatagca?acaaagtctg 4380
gggcaggcaa?caggatcgga?actggagagg?ataatccatg?ctatgatatt?gtgaacatgt 4440
gttatggtat?gcctttagca?cttatttggc?tgtcgtcagc?attggttgga?gagatagaag 4500
aattaggtgg?tgctgaagtg?aaaaaatgta?gggatttgag?acacatagag?gatggtattt 4560
tggacatccc?atccttacaa?ccattggcgg?agagtttatg?ccttggttat?aaccatcttc 4620
ctctttatct?gaggactttg?ttgttgtact?gtagtgcata?ccattggtct?aacagaatcg 4680
aaaggggtcg?tctggtcagg?aggtggattg?cggaaggatt?tgtgtcggaa?gagaaagaag 4740
cagaaggtta?ctttggcgag?cttattaaca?gaggatggat?tacgcagcac?ggagacaaca 4800
acagttataa?ttactatgag?atccaccccg?tgatgctggc?cttcctgaga?tgcaagtcca 4860
aggagtacaa?ttttttaaca?tgcttgggtc?tgggatctga?tactagtact?agtgcatcct 4920
ccccaaggtt?gattcgccgg?ctgtctcttc?agggggggta?tccagtggac?tgcttgtcaa 4980
gcatgagtat?ggatgtgtca?cacacttgca?gccttgtcgt?ccttggtgac?gtggcgcgac 5040
ccaagggaat?ccccttctat?atgtttaagc?gcttgcgagt?gttggacctt?gaagataata 5100
aggatataca?ggattctcat?ctgcagggca?tatgtgaaca?gttaagcctc?agagtgaggt 5160
accttggtct?caagggaacg?cggatccgaa?agctccctca?ggagatgagg?aagctgaagc 5220
atttggagat?tttgtatgtg?gggagcactc?ggatcagtga?acttccgcaa?gagattggag 5280
agctgaagca?tctgcggatt?ctggacgtga?gaaacacgga?catcactgag?ctcccactgc 5340
agatacggga?gctgcagcat?ctgcacactc?tggacgtgag?gaacactcca?atcagtgagc 5400
tcccgccgca?ggttggcaag?ctgcagaatc?tcaagattat?gtgcgtgagg?agcactgggg 5460
ttagggagct?cccaaaggag?attggggagc?tgaatcatct?acagactctg?gacgtgagaa 5520
acacgagggt?gagagagctg?ccatggcaag?ctggccagat?ctcccaatcg?ttgcgcgtgc 5580
ttgccggtga?cagtggcgat?ggcgtgcggt?tgcccgaagg?cgtctgcgaa?gctctgatca 5640
acggtattcc?aggggctacg?cgtgcaaaat?gcagggaggt?tctgtccatc?gcgatcatcg 5700
atcgtttcgg?acctcccctt?gttgggatat?tcaaagttcc?cggcagtcat?atgcgtatcc 5760
cgaagatgat?caaagaccac?ttccgcgttc?tttcttgcct?agacatcagg?ctctgccaca 5820
agcttgagga?tgatgaccaa?aagttcctcg?ccgagatgcc?caacctgcag?acgctcgtgc 5880
tgaggttcga?ggccctacca?agacaaccca?taaccatcaa?cggcacaggc?ttccagatgc 5940
tggagagctt?ccgtgtcgac?agccgggtgc?caaggatagc?cttccatgaa?gacgccatgc 6000
ccaacctcaa?gcttctcgag?ttcaagttct?acgccggccc?agcaagcaac?gatgccatcg 6060
gcatcaccaa?cctgaagagc?ctccaaaagg?tggtctttcg?gtgctcgcca?tggtacaaga 6120
gcgacgcccc?tggcatcagc?gccaccattg?acgtcgtgaa?gaaagaagcc?gaggagcatc 6180
ccaaccggcc?gatcaccctc?ctcatcaatg?ctgggtataa?ggagatatca?actgagtcac 6240
acgggagcag?tgaaaacatt?gcgggcagca?gtgggatcga?tactgagcct?gcacaggcac 6300
agcatgataa?tctccctgct?gttcgagatg?actacaaggg?aaaagggatt?cttcttgatg 6360
gcaggtgtcc?tacctgcggc?cgagcgacta?aaattgaaga?ggaaacccaa?gatcgagtag 6420
cagatattga?aattcaaaca?gaaactacta?gctagctagt?accgctgtct?aattttattt 6480
gtattaaata?ctctccttca?tgtaatactc?taagtccccg?ctcaattttt?cttgcctccg 6540
caactctaca?tgatactcaa?aactgatttc?ttacctccct?ttgattgtag?aaaaaacatg 6600
ggaagtttgg?aggatttcaa?tcctatgaaa?aggactttga?gaaacaaatt?acggaatcct 6660
atcttttcct?ttaaaagata?tataatagaa?aatcctatag?agatttttat?aggaaagtta 6720
acaaaagcct?caatcttatg?gagaattcct?gtgtttattt?gcatagagga?aagtgagact 6780
cacctaatca?ggggcggttc?tagtgggtgg?tccaggtgat?ccctggacca?ccctaaaatt 6840
tggcccatga?gaaccgcccc?ccccctcctc?ctcccggggt?tggtcgaaac?cagaaaaaag 6900
gccactgagc?taagctaggg?ttagggagag?gtgtagccat?gaactagcca?cagcagcacg 6960
catcgctggc?tgccgcctcc?gcctctgcgt?cagcgccagc?gtgccgtctc?cccggctctc 7020
gactctgcct?ccgcctccgc?cttggcgccg?atgcgtcgcc?tcctcggctc?ccgcttctac 7080
ctcagcgcca?gcgtgccgcc?tccgccttag?cgccgcctcc?tcgcctcctc?ccttccccga 7140
ctcctccagt?cccccactcc?tgtcggttgc?tatcgtcggc?gggcggcgac?caacgcctac 7200
aagccaacta?cggctgcctg?ggcaagccgg?cggccacccc?cgcccctgga?aagggaaaac 7260
attgccattc?cacaggcggc?gccaggtccc?ctttctctct?agctttcttg?ttgctcagca 7320
aagttcaaag?gtcagtagac?atttcttgtt?ggttttttgc?aatgttgccc?tatgcagtag 7380
tgagtagtca?gtactcagta?gtagtgctag?tgaaaaattt?ctgccttgag?tgtagtgaaa 7440
agcaagctga?gaaatagcat?gtgtgacaaa?ttattaaatg?atggtttaat?cacatctatt 7500
gagcgggtta?ttttctctca?agttagcaaa?gaagacatta?tgcataattt?catgtctata 7560
tatgaacgga?gagtagaaaa?gaagtagggt?tttgtaatct?tctacttatc?tattataaga 7620
tatttgaatg?attatgttct?aactttcgta?acttcaaatt?tagatgttgg?ttttaagcaa 7680
gttgtgatgt?tgtgagatat?attgctacat?ttcaattata?tttttattat?ttttgacaca 7740
tttggcttga?atttgtaaca?atgtgacaat?ttggagcatc?aagtaggact?acccgacgat 7800
tcatgaaacc?aatgtgccga?tatttagcgg?ttcttaatca?tactgaggta?agaaggcaac 7860
attttgcaaa?agtagaattt?cttcatgaaa?atcaggctta?tagctttaat?gttcacaaac 7920
tagctaagtt?tccttgtacc?ttagaggagg?ggcatcatgt?tcgattctca?aatactcctt 7980
gtaatctaag?taggaatgta?aataatttgg?ttgttaatga?ataaaatgcc?agaattttat 8040
tctaaaagaa?tatgtaattc?aaattaatat?tattctagat?gtatcttgaa?tagcccatta 8100
gcactggacc?agtctttcaa?gttgggtcag?tggtcggtac?cattgcctgg?cccatcatgg 8160
aacagaatgg?ccatggtctg?atcgcaatgg?gccgaggcat?gacgcgctgc?gctttcgaaa 8220
tcacgggcct?gagctgtcat?gagggctatc?ctgggccagg?cccgcgagac?aagagggtgt 8280
cggacaatgc?aacaacaacg?agaggcaata?agcagagctt?atgcattgca?cgaccaacaa 8340
agttgtcact?tacatccctt?attattctca?atcttaatac?tatctccgtt?caaaaaaaag 8400
tagactttta?gatacgaatg?tgaacaaacg?tcctcatcaa?tcttgcctgc?tgataaagca 8460
accgcagcta?ccacgcacta?tgcagggatc?gatcgatcga?tggatggaca?tattattact 8520
caacaaagta?gaggcattaa?tccgcttgca?gactaatcag?attcaggcga?cagcacgcgg 8580
ctgctgattc?atcagatggc?attgcttcaa?attgttcgct?ttcaccatgc?cctgcaccat 8640
gcatcattta?gatatttatt?ttactgtact?catagtaatt?aaccactgaa?aattcactct 8700
aggaaatcgt?gtgttaactg?ttaacctggt?agattttgat?catgaattgg?ttgatgtcgt 8760
cgagcgatat?gacgccctcg?tacgcggcgt?tgaaacggta?gctgtcgtca?tcgcgtccag 8820
acgccaccag?cagcggcggc?gcaggcggca?gctgctccac?gcagctgtac?tcgcactcgt 8880
cgtggcactc?gccgtcgccg?ccgccgccgc?cgccgccgtt?ctccgccgtg?atcgccacct 8940
gcagcgtcag?gtgcacctcc?agcgtcacga?acacgcccac?caccttcgcc?ggcgacccca 9000
tcgccgtcgg?ccgctgcatc?ttgtagctcg?acatccacga?gaatatgtac?gccgccatcg 9060
acgacgagac?gccgacgatg?ttctgcttcc?tcaggctgtt?c 9101
<210> 2
<211> 7630
<212> DNA
＜213〉Oryza paddy rice (Orysa sativa L.)
<220>
<221> 5'UTR
<222> (1)..(1232)
<220>
<221> CDS
<222> (1233)..(2224),?(2389)..(4462)
<220>
<221> 3'UTR
<222> (4463)..(4706)
<400> 2
ggcctccgcc?caaaagcctc?acccccaagg?ccccaatctt?cccaccgcgc?cgctgtcccc 60
cccccccccc?ccccccccaa?tcttctggcc?tggccagctc?tggtcggagg?agggttcagt 120
tccatgggtg?cgccccctgc?ccatccctcc?acttctactt?tcgtcttgag?atctcgccgt 180
ttctgatctc?cttgccatgg?caaccagttg?atttggctgc?caagatcgtc?cgtgctttgc 240
aaaggtgaac?aatctttttc?ttcttgggct?ttcactttgt?tgtgttaata?gactcagcgc 300
cgtcgcaact?tgcaaataaa?aaggttcaga?tcggaaaatg?gaaataccgt?acacagtagt 360
ctatagagaa?tcgactagta?tttcctgact?gtaagtaagg?aagttgtagg?taccatgttc 420
tgatgattat?ctttgaagct?tggaggggga?caaaaagttg?ggagagaaac?aagaatgtat 480
ttgttcactt?gattgggggc?agtaggtaaa?atctcagcgt?taggaatttg?cacctcttta 540
ttaagtttga?ctaaatttat?agaaaaaaat?tagcaacact?taaaacacca?aattagtttc 600
attgaatcca?acattgaata?tattttgata?atatgtttac?tttgtgttca?aaatgttact 660
atatttttct?ataaatttga?tcaaatttca?ataagtttga?ctagaaaaaa?aagtcaaacc 720
gacttataat?atgaatataa?atggagggag?tagattataa?attatcttta?ttataatact 780
ttgagtgtac?aaacgaatga?ataaagttta?caaagttgaa?aagttatttt?taaatactat 840
tccgataaac?ctgtatatag?agaacttgtg?aaaaaaaaca?ccgtttgaaa?tgtgtctgtg 900
ataatctata?agaggaacgg?ggcctaaata?tattcctttt?ttcctacgaa?aatgcaagaa 960
gtattgccta?atatattgat?agagctgaag?ttttaaagta?aaatgaaaca?tttgcatgag 1020
gcagcactgg?acaaaaagcg?cttgtgaaaa?aaatatgttc?caaatattat?taattcattc 1080
atggtatggt?ctttattttc?attttccccc?cttatccatg?ggcaggacac?ggaaattctc 1140
agcaggttcg?cgcttgatct?gaactgtctg?tggctcatac?tctcttgtgc?ttgcaacagc 1200
tgaaagttgc?agtgagaagt?acagagaaca?agatggagtt?ggtggtaggt?gcttccgaag 1260
ccaccatgaa?atctctcttg?ggcaagctgg?gcaatcttct?agcccaggag?tatgctctca 1320
tcagcggtat?ccgtggtgac?atccagtaca?tcaatgacga?gcttgccagc?atgcaggcct 1380
tcctccgtga?tctcagcaac?gtgccagagg?gtcacagtca?tggccaccgg?atgaaggact 1440
ggatgaagca?gatccgagac?atcgcctatg?atgttgagga?ctgtatcgat?gactttgccc 1500
accgcctccc?tcaggattcc?atcagcgatg?ccaaatggtc?cttcctactc?acaaaaatct 1560
atgaactatg?gacatggtgg?ccacgtcgtg?tgattgcttc?caacattgcc?caactcaagg 1620
tacgggcaca?acagatcgca?gatcgacgta?gtagatacgg?agtgaacaac?ccagaacacc 1680
ttgacagtag?cagcagtgcc?aggacccgtg?ctgtcaatta?cgaaattgct?gagtatcagg 1740
tcacaagccc?tcagatcatt?ggtataaagg?agcctgtggg?gatgaagacg?gtcatggagg 1800
agcttgaggt?ttggttaact?aatcctcaag?ctgaaaatgg?gcaagctgtt?ctgtccatag 1860
tcggttttgg?aggtgtggga?aagactacca?ttgccacagc?attgtacaga?aaagtcagtg 1920
ataaatttca?gtgccgggca?tcagtagctg?tgtctcagaa?ctatgaccaa?ggcaaagtcc 1980
tcaatagtat?tctgagtcaa?gtcagcaatc?aggagcaggg?cagcagcaca?acaattagtg 2040
agaaaaagaa?cctcacctca?ggcgctaaga?gcatgttgaa?gacagccctg?tcactgctca 2100
gaggtaattg?tatatgtcag?ccagaaaatg?atggaaaccc?tgataataca?ccaatcaggc 2160
tgcaggaaac?aacggacgat?gatcaaaacc?ccagaaaact?ggaacagctc?ctggccgaaa 2220
agaggtacct?ttttttgtaa?ataaaattgc?tttgcttatc?tgtaaattaa?cttactcatc 2280
ccactctaaa?tctaatgttt?atttccttct?atacacagca?caactccatc?ttttgaatgg 2340
gttttatttt?tctcacttgt?gctcattttt?tttttatcat?ctctgcagtt?atatcctctt 2400
gattgatgac?atttggtctg?ccgaaacatg?ggagagtatc?agatcgattt?tgcctaaaaa 2460
taataaaggc?ggtagaataa?tagtgactac?aagatttcaa?gctgttggtt?caacatgctc 2520
ccctcttgaa?actgatcgtt?tgcatacagt?tgattttctc?accgatgacg?agtcccaaaa 2580
cttattcaat?acaagtattt?gtgaatcaaa?gataagaaaa?gatagcaaca?aagtagacga 2640
gcaagtccct?gaggaaatat?ggaaaatatg?tgggggattg?cctttggcca?tagtcaccat 2700
ggctggtctt?gtcgcctgca?acccaaggaa?agcctgctgc?gattggagta?aactttgcaa 2760
atcattattt?ccagagcaag?aaactcctct?taccctcgat?ggtgttacaa?ggatactgga 2820
ttgttgttac?aatgatttgc?ctgcggatct?gaagacttgc?ttattgtact?tgagtatatt 2880
tccgaagggt?tggaaaatta?gtaggaaacg?tttgtcccgg?cgatggatag?ctgaaggttt 2940
tgctaatgag?aagcaagggt?taacccagga?aagagttgca?gaggcatact?ttaatcaact 3000
cacaagaagg?aacttagtac?gtcccatgga?gcatggcagc?aatgggaagg?taaaaacgtt 3060
tcaagttcat?gacatggttc?ttgaatacat?catgtccaaa?tcaatcgaag?agaattttat 3120
tactgtggtt?ggtggacact?ggcagatgac?tgcaccaagc?aataaagtcc?gtcgactgtc 3180
gatgcaaagc?agtggatcca?atcgtggaag?ttcaacaaaa?ggcctgaact?tggctcaagt 3240
gagatcactg?acggtgtttg?ggaacctgaa?ccatatgcca?ttccattcat?tcaactatgg 3300
gataatacag?gtgctggatc?ttgaggactg?gaagggtttg?aaagagagac?atatgacgga 3360
gatatgtcaa?atgcttttac?tcaagtattt?gagcatccga?cgaacagaaa?tttccaaaat 3420
tccctccaag?attcagaaac?ttgagtactt?ggaaactctt?gacataaggg?agacatatgt 3480
cagggacctg?cctaagtcaa?tagtccagct?aaaacggatc?attagcatac?ttggagggaa 3540
taaaaacaca?cggaaggggc?tgaggttgcc?tcaagaaaaa?agtaagaagc?caattaaaaa 3600
cccgtcgcct?caaggaaaaa?caaaggagcc?cgcaaagaaa?ggattcttat?cccaagaaaa 3660
aggtaaaggc?gcaatgaaag?cactccgtgt?actgtcaggg?attgagattg?ttgaggaatc 3720
atcagaagta?gctgcaggcc?ttcatcagtt?gacagggcta?aggaagcttg?ccatatacaa 3780
gctcaatata?acaaagggtg?gtgatacctt?caaacaatta?cagtcctcca?ttgagtacct 3840
tggcagctgt?ggtctgcaga?ctctggccat?caatgatgag?aattctgaat?ttatcaactc 3900
actgggcgac?atgcccgcgc?ctccaagata?tcttgtcgcc?cttgagctgt?ctggcaagtt 3960
ggagaagcta?cccaagtgga?tcaccagcat?cactactctc?aacaagctaa?ccatatctgt 4020
aacagttctt?aggactgaaa?ctttggagat?cctccacatt?ttaccttcat?tgttttccct 4080
caccttcgcc?ttttcactta?gtgcagcgaa?gcaggatcag?gacataataa?aggacatcct 4140
tgagaataat?aaattggaca?gtgatgggga?aatcgtcatt?ccagctgaag?gattcaagag 4200
tcttaagctg?cttcgcttct?ttgcaccttt?agtgccgaag?ctcagctttt?tggacaagaa 4260
tgcaatgcca?gcactcgaaa?tcattgaaat?gcggtttaaa?gacttcgaag?gtctatttgg 4320
catcgaaatc?cttgaaaatc?tccgtgaggt?gcatctcaaa?gttagtgatg?gggcagaagc 4380
aataaccaag?ttccttgtaa?atgatttgaa?ggttaatact?gagaaaccaa?aagtatttgt 4440
tgatggcatc?gtcactgcat?gagaagtaaa?attgctgcaa?atcggagaac?ttaccaatca 4500
tctgaggctt?cccctctatt?attactctct?tagaatatat?tgttattatt?gctcaccttg 4560
caaaataaaa?tagggatggc?atagcatatt?gctacaacgt?accatggttc?catcatagtt 4620
gatttcactt?gtcattacag?tgtctgttca?gttgtgtttt?ctattaataa?aagggagatc 4680
tccgcaagaa?accattatta?tacttatatt?cggttattga?actctataaa?tgatgggatt 4740
gctatattta?tggtgccaca?atttccatga?gtgcggtatt?tttttttcta?gcagttggct 4800
ggtgttaaga?tttgtgctgc?cattgctcct?ctattattgg?tgcccaaaat?tacgctttgc 4860
actatgttca?cagttgtaaa?acttacctaa?atttcgtgta?ttagtactgt?aatgttgtga 4920
ttttcgcgtc?cagttatatt?tttttctttg?ccagaagttt?gatttcaagg?tatatctggt 4980
aagcttcagc?cggattcgtt?aagtttttag?tttaatcagc?taaactttta?acagtatgca 5040
tgcactagtt?tctcccgtta?tcttatccaa?tataattaat?gggctaattg?gatctatgcc 5100
attacaaaca?tggcaagatt?cagaaaaatg?ctactacaat?ttgtctattc?atagctgtgc 5160
tagtgaaatt?ttacaaaatt?ggaaccgtgc?tattgatatc?acgttttcca?tccatctttt 5220
cttttttttc?cttttcttct?ttatcccgtc?ttcttcccgc?accgacgaga?ggcgagtggc 5280
ggcgggaccg?gcaagcgatg?gcaggacctc?ggcagctcag?tggtggcagc?ggcaaaaggg 5340
aaaggggaag?gggtaggaga?gaacctggcc?cgccgacgca?agcatgttgg?tcgtcgtctt 5400
ccccgaggag?cttgagcagt?ggcaatggta?gaggaatcca?aggaggccga?ggaggttgag 5460
cggcactaat?ggtagaggat?gccgaggagg?tcgagcatca?gcgagcttgc?cctgggtggg 5520
cgagtgaggg?agagctctcc?caagtgtctg?cgaagctctc?atcttcgttt?tcctcatccc 5580
cactttgctc?ctcttccact?actgctgttg?aagctagcgg?ccctctctca?ccagatctgg 5640
gcggagctca?agcgaggcgc?caccaccgac?gatggagctt?cgcgtggacc?ccacagcctc 5700
acccgattgc?catccctcct?accctcatca?ctccatctcc?aagcccaaat?cccacctccc 5760
ccaccggctc?ctcctcctca?gcccctgccg?tggcagccga?ggccaccgat?gggccaaccc 5820
tcaacatcgt?ctcgaagcag?ctccgcgcac?tgtggaagaa?gcacaaccaa?atcctccaga 5880
tggaggagtc?gctcactggc?gggaggaagc?tgaacaagga?gcaggaggag?gtgctccgat 5940
ccaagcccat?cgtcatcgcg?ctcattgatg?agctcgagcg?gatgcgtgcc?ctgctcgccg 6000
acgccctcgc?cgaggagctc?tcctcctgcc?ccgccccttc?cctatctgtc?actccctcct 6060
cctccacctc?ctccggcgct?gatttgtccg?tcaaggatct?cctcacgctc?atctacttcg 6120
gctccctctt?cgacgtcaag?tcgcagatcg?agttcgtcac?caccatgctc?gcacgctaag 6180
gagctagact?gatgcatcac?ctacgactat?gtccgtcctt?gccgcagcac?gacttgctac 6240
ggtcccgcct?cacgccccgt?cgctcgccgg?tcccgccgcc?acttgcttct?catcggtgcg 6300
ggaagaagat?gggagaaaga?aggaagaaaa?cgggaaaaaa?agagatggat?gaaaaacgtg 6360
acagcaatag?cacggttcca?atttcgtaaa?atttcaatgg?caccgctacg?aatagaagaa 6420
ttgtagtagc?atttttctga?atcaacatat?ttgtaatggc?atggatccaa?taaaccccaa 6480
atttatttta?tgccaataca?aatattggca?actggtgtca?ttaacgtata?aatgggtcgc 6540
ctacataaaa?ccttccgcgt?ccttcttggt?tgaacaggta?attaattgca?accattttct 6600
gaaaaaattg?actggaagtc?tgaaaccgtc?cctgctactc?cctgaatgct?ttagttcaat 6660
ctctatgaag?ctccatccaa?acaaaatctc?cagatgatat?ttcattaaaa?acatcatgtc 6720
cagaactgtc?cagtatccaa?gaatggctat?gatcttttct?gaattctgga?ctcgggactt 6780
atattacatg?tatcaaatcc?agttattttc?tggagctaca?ccagatgaaa?tcaccaagta 6840
aaacaattat?ataaggatgg?tgagttgtta?attaattaca?gctttgatag?accactctgt 6900
ttgttaatgc?ctgacaagag?ttcacaaaga?aaaaaataca?caggattaca?aaacttttta 6960
gatactatct?gatgtgtgtt?aattctctca?aatactatgt?acctgaacaa?acaagagaga 7020
acatgttgtg?aattgtgatc?tcctcatgcg?agtgacctga?aactctctac?agggtcagac 7080
tcctcaagca?tcactgcagc?ctggaaacaa?tcagcagcat?cattgatcct?cccatcattc 7140
ctgtgaactc?tccctaaatg?aagccaagcc?atcctgttcg?taggctcaat?tctcagtgca 7200
tcagagagga?agcatctcgc?tgcagggaga?taccttgacc?cttgcttgca?gagaagtgca 7260
ccaatggcca?ccttggatgg?aacatgctct?agctctatcg?agaatgcgtt?gacgtaggca 7320
gccagtgcct?ccttgttctg?atctcgcgcc?tcgagcatga?aacctgaact?tatagcatcc 7380
acgagtcaga?ttttgatgtt?gaattcagtt?gaatgcagag?aattgtcatg?ttagtgttac 7440
atagaagtgg?tgaaagttca?agtttagttg?agttgatcac?cttctgcatg?cattgttgca 7500
gccgagtagg?attttagggc?tctagccttc?tgcagacata?tctcagcgtc?tctccagatt 7560
gagagactgg?agtacaggtt?tgcaagtcct?tgccatattt?caaactcact?tacactgtca 7620
ttctgtccct 7630
<210> 3
<211> 1142
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 3
Met?Glu?Ala?Ala?Ala?Met?Ala?Val?Thr?Ala?Ala?Thr?Gly?Ala?Leu?Ala
1 5 10 15
Pro?Val?Leu?Val?Lys?Leu?Ala?Ala?Leu?Leu?Asp?Asp?Gly?Glu?Cys?Asn
20 25 30
Leu?Leu?Glu?Gly?Ser?Arg?Ser?Asp?Ala?Glu?Phe?Ile?Arg?Ser?Glu?Leu
35 40 45
Glu?Ala?Val?His?Ser?Leu?Leu?Thr?Pro?Asn?Ile?Leu?Gly?Arg?Met?Gly
50 55 60
Asp?Asp?Asp?Ala?Ala?Cys?Lys?Asp?Gly?Leu?Ile?Ala?Glu?Val?Arg?Glu
65 70 75 80
Leu?Ser?Tyr?Asp?Leu?Asp?Asp?Ala?Val?Asp?Asp?Phe?Leu?Glu?Leu?Asn
85 90 95
Phe?Glu?Gln?Arg?Arg?Ser?Ala?Ser?Pro?Phe?Gly?Glu?Leu?Lys?Ala?Arg
100 105 110
Val?Glu?Glu?His?Val?Ser?Asn?Arg?Phe?Ser?Asp?Trp?Lys?Leu?Pro?Ala
115 120 125
Ala?Ser?Leu?Pro?Pro?Ser?Ser?Val?His?Arg?Arg?Ala?Gly?Leu?Pro?Pro
130 135 140
Pro?Asp?Ala?Glu?Leu?Val?Gly?Met?Asp?Lys?Arg?Met?Glu?Glu?Leu?Thr
145 150 155 160
Lys?Leu?Leu?Glu?Gln?Gly?Ser?Asn?Asp?Ala?Ser?Arg?Trp?Arg?Lys?Arg
165 170 175
Lys?Pro?His?Phe?Pro?Leu?Arg?Lys?Thr?Gly?Leu?Lys?Gln?Lys?Ile?Val
180 185 190
Ile?Lys?Val?Ala?Met?Glu?Gly?Asn?Asn?Cys?Arg?Ser?Lys?Ala?Met?Ala
195 200 205
Leu?Val?Ala?Ser?Thr?Gly?Gly?Val?Asp?Ser?Val?Ala?Leu?Val?Gly?Asp
210 215 220
Leu?Arg?Asp?Lys?Ile?Glu?Val?Val?Gly?Tyr?Gly?Ile?Asp?Pro?Ile?Lys
225 230 235 240
Leu?Ile?Ser?Ala?Leu?Arg?Lys?Lys?Val?Gly?Asp?Ala?Glu?Leu?Leu?Gln
245 250 255
Val?Ser?Gln?Ala?Lys?Lys?Asp?Val?Lys?Glu?Thr?Thr?Pro?Met?Leu?Ala
260 265 270
Pro?Val?Lys?Ser?Ile?Cys?Glu?Phe?His?Lys?Val?Lys?Thr?Val?Cys?Ile
275 280 285
Leu?Gly?Leu?Pro?Gly?Gly?Gly?Lys?Thr?Thr?Val?Ala?Arg?Glu?Leu?Tyr
290 295 300
Asp?Ala?Leu?Gly?Thr?His?Phe?Pro?Cys?Arg?Val?Phe?Val?Ser?Val?Ser
305 310 315 320
Pro?Ser?Ser?Ser?Pro?Ser?Pro?Asn?Leu?Thr?Lys?Thr?Leu?Ala?Asp?Ile
325 330 335
Phe?Ala?Gln?Ala?Gln?Leu?Gly?Val?Thr?Asp?Thr?Leu?Ser?Thr?Ser?Tyr
340 345 350
Gly?Gly?Ser?Gly?Thr?Gly?Arg?Ala?Leu?Gln?Gln?His?Leu?Ile?Asp?Asn
355 360 365
Ile?Ser?Ala?Phe?Leu?Leu?Asn?Lys?Lys?Tyr?Leu?Ile?Val?Ile?Asp?Asp
370 375 380
Ile?Trp?His?Trp?Glu?Glu?Trp?Glu?Val?Ile?Arg?Lys?Ser?Ile?Pro?Lys
385 390 395 400
Asn?Asp?Leu?Gly?Gly?Arg?Ile?Ile?Met?Thr?Thr?Arg?Leu?Asn?Ser?Ile
405 410 415
Ala?Gly?Lys?Cys?His?Thr?Asp?Asp?Asn?Asp?Val?Phe?Val?Tyr?Glu?Val
420 425 430
Gly?Asp?Leu?Asp?Asn?Asn?Asp?Ala?Leu?Ser?Leu?Ser?Trp?Gly?Ile?Ala
435 440 445
Thr?Lys?Ser?Gly?Ala?Gly?Asn?Arg?Ile?Gly?Thr?Gly?Glu?Asp?Ser?Pro
450 455 460
Cys?Tyr?Asp?Ile?Val?Asn?Met?Cys?Tyr?Gly?Met?Pro?Leu?Ala?Leu?Ile
465 470 475 480
Trp?Leu?Ser?Ser?Ala?Leu?Val?Gly?Glu?Ile?Glu?Glu?Leu?Gly?Gly?Ala
485 490 495
Glu?Val?Lys?Lys?Cys?Arg?Asp?Leu?Arg?His?Ile?Glu?Asp?Gly?Ile?Leu
500 505 510
Asp?Ile?Pro?Ser?Leu?Gln?Pro?Leu?Ala?Glu?Ser?Leu?Cys?Leu?Gly?Tyr
515 520 525
Asn?His?Leu?Pro?Leu?Tyr?Leu?Arg?Thr?Leu?Leu?Leu?Tyr?Cys?Ser?Ala
530 535 540
Tyr?His?Trp?Ser?Asn?Arg?Ile?Glu?Arg?Gly?Arg?Leu?Val?Arg?Arg?Trp
545 550 555 560
Ile?Ala?Glu?Gly?Phe?Val?Ser?Glu?Glu?Lys?Glu?Ala?Glu?Gly?Tyr?Phe
565 570 575
Gly?Glu?Leu?Ile?Asn?Arg?Gly?Trp?Ile?Thr?Gln?His?Gly?Asp?Asn?Asn
580 585 590
Ser?Tyr?Asn?Tyr?Tyr?Glu?Ile?His?Pro?Val?Met?Leu?Ala?Phe?Leu?Arg
595 600 605
Cys?Lys?Ser?Lys?Glu?Tyr?Asn?Phe?Leu?Thr?Cys?Leu?Gly?Leu?Gly?Ser
610 615 620
Asp?Thr?Ser?Thr?Ser?Ala?Ser?Ser?Pro?Arg?Leu?Ile?Arg?Arg?Leu?Ser
625 630 635 640
Leu?Gln?Gly?Gly?Tyr?Pro?Val?Asp?Cys?Leu?Ser?Ser?Met?Ser?Met?Asp
645 650 655
Val?Ser?His?Thr?Cys?Ser?Leu?Val?Val?Leu?Gly?Asp?Val?Ala?Arg?Pro
660 665 670
Lys?Gly?Ile?Pro?Phe?Tyr?Met?Phe?Lys?Arg?Leu?Arg?Val?Leu?Asp?Leu
675 680 685
Glu?Asp?Asn?Lys?Asp?Ile?Gln?Asp?Ser?His?Leu?Gln?Gly?Ile?Cys?Glu
690 695 700
Gln?Leu?Ser?Leu?Arg?Val?Arg?Tyr?Leu?Gly?Leu?Lys?Gly?Thr?Arg?Ile
705 710 715 720
Arg?Lys?Leu?Pro?Gln?Glu?Met?Arg?Lys?Leu?Lys?His?Leu?Glu?Ile?Leu
725 730 735
Tyr?Val?Gly?Ser?Thr?Arg?Ile?Ser?Glu?Leu?Pro?Gln?Glu?Ile?Gly?Glu
740 745 750
Leu?Lys?His?Leu?Arg?Ile?Leu?Asp?Val?Arg?Asn?Thr?Asp?Ile?Thr?Glu
755 760 765
Leu?Pro?Leu?Gln?Ile?Arg?Glu?Leu?Gln?His?Leu?His?Thr?Leu?Asp?Val
770 775 780
Arg?Asn?Thr?Pro?Ile?Ser?Glu?Leu?Pro?Pro?Gln?Val?Gly?Lys?Leu?Gln
785 790 795 800
Asn?Leu?Lys?Ile?Met?Cys?Val?Arg?Ser?Thr?Gly?Val?Arg?Glu?Leu?Pro
805 810 815
Lys?Glu?Ile?Gly?Glu?Leu?Asn?His?Leu?Gln?Thr?Leu?Asp?Val?Arg?Asn
820 825 830
Thr?Arg?Val?Arg?Glu?Leu?Pro?Trp?Gln?Ala?Gly?Gln?Ile?Ser?Gln?Ser
835 840 845
Leu?Arg?Val?Leu?Ala?Gly?Asp?Ser?Gly?Asp?Gly?Val?Arg?Leu?Pro?Glu
850 855 860
Gly?Val?Cys?Glu?Ala?Leu?Ile?Asn?Gly?Ile?Pro?Gly?Ala?Thr?Arg?Ala
865 870 875 880
Lys?Cys?Arg?Glu?Val?Leu?Ser?Ile?Ala?Ile?Ile?Asp?Arg?Phe?Gly?Pro
885 890 895
Pro?Leu?Val?Gly?Ile?Phe?Lys?Val?Pro?Gly?Ser?His?Met?Arg?Ile?Pro
900 905 910
Lys?Met?Ile?Lys?Asp?His?Phe?Arg?Val?Leu?Ser?Cys?Leu?Asp?Ile?Arg
915 920 925
Leu?Cys?His?Lys?Leu?Glu?Asp?Asp?Asp?Gln?Lys?Phe?Leu?Ala?Glu?Met
930 935 940
Pro?Asn?Leu?Gln?Thr?Leu?Val?Leu?Arg?Phe?Glu?Ala?Leu?Pro?Arg?Gln
945 950 955 960
Pro?Ile?Thr?Ile?Asn?Gly?Thr?Gly?Phe?Gln?Met?Leu?Glu?Ser?Phe?Arg
965 970 975
Val?Asp?Ser?Arg?Val?Pro?Arg?Ile?Ala?Phe?His?Glu?Asp?Ala?Met?Pro
980 985 990
Asn?Leu?Lys?Leu?Leu?Glu?Phe?Lys Phe?Tyr?Ala?Gly?Pro Ala?Ser?Asn
995 1000 1005
Asp?Ala Ile?Gly?Ile?Thr?Asn Leu?Lys?Ser?Leu?Gln Lys?Val?Val
1010 1015 1020
Phe?Arg Cys?Ser?Pro?Trp?Tyr Lys?Ser?Asp?Ala?Pro Gly?Ile?Ser
1025 1030 1035
Ala?Thr Ile?Asp?Val?Val?Lys Lys?Glu?Ala?Glu?Glu His?Pro?Asn
1040 1045 1050
Arg?Pro Ile?Thr?Leu?Leu?Ile Asn?Ala?Gly?Tyr?Lys Glu?Ile?Ser
1055 1060 1065
Thr?Glu Ser?His?Gly?Ser?Ser Glu?Asn?Ile?Ala?Gly Ser?Ser?Gly
1070 1075 1080
Ile?Asp Thr?Glu?Pro?Ala?Gln Ala?Gln?His?Asp?Asn Leu?Pro?Ala
1085 1090 1095
Val?Arg Asp?Asp?Tyr?Lys?Gly Lys?Gly?Ile?Leu?Leu Asp?Gly?Arg
1100 1105 1110
Cys?Pro Thr?Cys?Gly?Arg?Ala Thr?Lys?Ile?Glu?Glu Glu?Thr?Gln
1115 1120 1125
Asp?Arg Val?Ala?Asp?Ile?Glu Ile?Gln?Thr?Glu?Thr Thr?Ser
1130 1135 1140
<210> 4
<211> 1021
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 4
Met?Glu?Leu?Val?Val?Gly?Ala?Ser?Glu?Ala?Thr?Met?Lys?Ser?Leu?Leu
1 5 10 15
Gly?Lys?Leu?Gly?Asn?Leu?Leu?Ala?Gln?Glu?Tyr?Ala?Leu?Ile?Ser?Gly
20 25 30
Ile?Arg?Gly?Asp?Ile?Gln?Tyr?Ile?Asn?Asp?Glu?Leu?Ala?Ser?Met?Gln
35 40 45
Ala?Phe?Leu?Arg?Asp?Leu?Ser?Asn?Val?Pro?Glu?Gly?His?Ser?His?Gly
50 55 60
His?Arg?Met?Lys?Asp?Trp?Met?Lys?Gln?Ile?Arg?Asp?Ile?Ala?Tyr?Asp
65 70 75 80
Val?Glu?Asp?Cys?Ile?Asp?Asp?Phe?Ala?His?Arg?Leu?Pro?Gln?Asp?Ser
85 90 95
Ile?Ser?Asp?Ala?Lys?Trp?Ser?Phe?Leu?Leu?Thr?Lys?Ile?Tyr?Glu?Leu
100 105 110
Trp?Thr?Trp?Trp?Pro?Arg?Arg?Val?Ile?Ala?Ser?Asn?Ile?Ala?Gln?Leu
115 120 125
Lys?Val?Arg?Ala?Gln?Gln?Ile?Ala?Asp?Arg?Arg?Ser?Arg?Tyr?Gly?Val
130 135 140
Asn?Asn?Pro?Glu?His?Leu?Asp?Ser?Ser?Ser?Ser?Ala?Arg?Thr?Arg?Ala
145 150 155 160
Val?Asn?Tyr?Glu?Ile?Ala?Glu?Tyr?Gln?Val?Thr?Ser?Pro?Gln?Ile?Ile
165 170 175
Gly?Ile?Lys?Glu?Pro?Val?Gly?Met?Lys?Thr?Val?Met?Glu?Glu?Leu?Glu
180 185 190
Val?Trp?Leu?Thr?Asn?Pro?Gln?Ala?Glu?Asn?Gly?Gln?Ala?Val?Leu?Ser
195 200 205
Ile?Val?Gly?Phe?Gly?Gly?Val?Gly?Lys?Thr?Thr?Ile?Ala?Thr?Ala?Leu
210 215 220
Tyr?Arg?Lys?Val?Ser?Asp?Lys?Phe?Gln?Cys?Arg?Ala?Ser?Val?Ala?Val
225 230 235 240
Ser?Gln?Asn?Tyr?Asp?Gln?Gly?Lys?Val?Leu?Asn?Ser?Ile?Leu?Ser?Gln
245 250 255
Val?Ser?Asn?Gln?Glu?Gln?Gly?Ser?Ser?Thr?Thr?Ile?Ser?Glu?Lys?Lys
260 265 270
Asn?Leu?Thr?Ser?Gly?Ala?Lys?Ser?Met?Leu?Lys?Thr?Ala?Leu?Ser?Leu
275 280 285
Leu?Arg?Gly?Asn?Cys?Ile?Cys?Gln?Pro?Glu?Asn?Asp?Gly?Asn?Pro?Asp
290 295 300
Asn?Thr?Pro?Ile?Arg?Leu?Gln?Glu?Thr?Thr?Asp?Asp?Asp?Gln?Asn?Pro
305 310 315 320
Arg?Lys?Leu?Glu?Gln?Leu?Leu?Ala?Glu?Lys?Ser?Tyr?Ile?Leu?Leu?Ile
325 330 335
Asp?Asp?Ile?Trp?Ser?Ala?Glu?Thr?Trp?Glu?Ser?Ile?Arg?Ser?Ile?Leu
340 345 350
Pro?Lys?Asn?Asn?Lys?Gly?Gly?Arg?Ile?Ile?Val?Thr?Thr?Arg?Phe?Gln
355 360 365
Ala?Val?Gly?Ser?Thr?Cys?Ser?Pro?Leu?Glu?Thr?Asp?Arg?Leu?His?Thr
370 375 380
Val?Asp?Phe?Leu?Thr?Asp?Asp?Glu?Ser?Gln?Asn?Leu?Phe?Asn?Thr?Ser
385 390 395 400
Ile?Cys?Glu?Ser?Lys?Ile?Arg?Lys?Asp?Ser?Asn?Lys?Val?Asp?Glu?Gln
405 410 415
Val?Pro?Glu?Glu?Ile?Trp?Lys?Ile?Cys?Gly?Gly?Leu?Pro?Leu?Ala?Ile
420 425 430
Val?Thr?Met?Ala?Gly?Leu?Val?Ala?Cys?Asn?Pro?Arg?Lys?Ala?Cys?Cys
435 440 445
Asp?Trp?Ser?Lys?Leu?Cys?Lys?Ser?Leu?Phe?Pro?Glu?Gln?Glu?Thr?Pro
450 455 460
Leu?Thr?Leu?Asp?Gly?Val?Thr?Arg?Ile?Leu?Asp?Cys?Cys?Tyr?Asn?Asp
465 470 475 480
Leu?Pro?Ala?Asp?Leu?Lys?Thr?Cys?Leu?Leu?Tyr?Leu?Ser?Ile?Phe?Pro
485 490 495
Lys?Gly?Trp?Lys?Ile?Ser?Arg?Lys?Arg?Leu?Ser?Arg?Arg?Trp?Ile?Ala
500 505 510
Glu?Gly?Phe?Ala?Asn?Glu?Lys?Gln?Gly?Leu?Thr?Gln?Glu?Arg?Val?Ala
515 520 525
Glu?Ala?Tyr?Phe?Asn?Gln?Leu?Thr?Arg?Arg?Asn?Leu?Val?Arg?Pro?Met
530 535 540
Glu?His?Gly?Ser?Asn?Gly?Lys?Val?Lys?Thr?Phe?Gln?Val?His?Asp?Met
545 550 555 560
Val?Leu?Glu?Tyr?Ile?Met?Ser?Lys?Ser?Ile?Glu?Glu?Asn?Phe?Ile?Thr
565 570 575
Val?Val?Gly?Gly?His?Trp?Gln?Met?Thr?Ala?Pro?Ser?Asn?Lys?Val?Arg
580 585 590
Arg?Leu?Ser?Met?Gln?Ser?Ser?Gly?Ser?Asn?Arg?Gly?Ser?Ser?Thr?Lys
595 600 605
Gly?Leu?Asn?Leu?Ala?Gln?Val?Arg?Ser?Leu?Thr?Val?Phe?Gly?Asn?Leu
610 615 620
Asn?His?Met?Pro?Phe?His?Ser?Phe?Asn?Tyr?Gly?Ile?Ile?Gln?Val?Leu
625 630 635 640
Asp?Leu?Glu?Asp?Trp?Lys?Gly?Leu?Lys?Glu?Arg?His?Met?Thr?Glu?Ile
645 650 655
Cys?Gln?Met?Leu?Leu?Leu?Lys?Tyr?Leu?Ser?Ile?Arg?Arg?Thr?Glu?Ile
660 665 670
Ser?Lys?Ile?Pro?Ser?Lys?Ile?Gln?Lys?Leu?Glu?Tyr?Leu?Glu?Thr?Leu
675 680 685
Asp?Ile?Arg?Glu?Thr?Tyr?Val?Arg?Asp?Leu?Pro?Lys?Ser?Ile?Val?Gln
690 695 700
Leu?Lys?Arg?Ile?Ile?Ser?Ile?Leu?Gly?Gly?Asn?Lys?Asn?Thr?Arg?Lys
705 710 715 720
Gly?Leu?Arg?Leu?Pro?Gln?Glu?Lys?Ser?Lys?Lys?Pro?Ile?Lys?Asn?Pro
725 730 735
Ser?Pro?Gln?Gly?Lys?Thr?Lys?Glu?Pro?Ala?Lys?Lys?Gly?Phe?Leu?Ser
740 745 750
Gln?Glu?Lys?Gly?Lys?Gly?Ala?Met?Lys?Ala?Leu?Arg?Val?Leu?Ser?Gly
755 760 765
Ile?Glu?Ile?Val?Glu?Glu?Ser?Ser?Glu?Val?Ala?Ala?Gly?Leu?His?Gln
770 775 780
Leu?Thr?Gly?Leu?Arg?Lys?Leu?Ala?Ile?Tyr?Lys?Leu?Asn?Ile?Thr?Lys
785 790 795 800
Gly?Gly?Asp?Thr?Phe?Lys?Gln?Leu?Gln?Ser?Ser?Ile?Glu?Tyr?Leu?Gly
805 810 815
Ser?Cys?Gly?Leu?Gln?Thr?Leu?Ala?Ile?Asn?Asp?Glu?Asn?Ser?Glu?Phe
820 825 830
Ile?Asn?Ser?Leu?Gly?Asp?Met?Pro?Ala?Pro?Pro?Arg?Tyr?Leu?Val?Ala
835 840 845
Leu?Glu?Leu?Ser?Gly?Lys?Leu?Glu?Lys?Leu?Pro?Lys?Trp?Ile?Thr?Ser
850 855 860
Ile?Thr?Thr?Leu?Asn?Lys?Leu?Thr?Ile?Ser?Val?Thr?Val?Leu?Arg?Thr
865 870 875 880
Glu?Thr?Leu?Glu?Ile?Leu?His?Ile?Leu?Pro?Ser?Leu?Phe?Ser?Leu?Thr
885 890 895
Phe?Ala?Phe?Ser?Leu?Ser?Ala?Ala?Lys?Gln?Asp?Gln?Asp?Ile?Ile?Lys
900 905 910
Asp?Ile?Leu?Glu?Asn?Asn?Lys?Leu?Asp?Ser?Asp?Gly?Glu?Ile?Val?Ile
915 920 925
Pro?Ala?Glu?Gly?Phe?Lys?Ser?Leu?Lys?Leu?Leu?Arg?Phe?Phe?Ala?Pro
930 935 940
Leu?Val?Pro?Lys?Leu?Ser?Phe?Leu?Asp?Lys?Asn?Ala?Met?Pro?Ala?Leu
945 950 955 960
Glu?Ile?Ile?Glu?Met?Arg?Phe?Lys?Asp?Phe?Glu?Gly?Leu?Phe?Gly?Ile
965 970 975
Glu?Ile?Leu?Glu?Asn?Leu?Arg?Glu?Val?His?Leu?Lys?Val?Ser?Asp?Gly
980 985 990
Ala?Glu?Ala?Ile?Thr?Lys?Phe?Leu Val?Asn?Asp?Leu?Lys Val?Asn?Thr
995 1000 1005
Glu?Lys Pro?Lys?Val?Phe?Val Asp?Gly?Ile?Val?Thr Ala
1010 1015 1020
<210> 5
<211> 10321
<212> DNA
＜213〉Oryza paddy rice (Orysa sativa L.)
<220>
<221> promoter
<222> (1)..(1220)
<220>
<221> 5'UTR
<222> (1221)..(1324)
<220>
<221> CDS
<222> (1325)..(1888),?(2039)..(2607),?(5380)..(7675)
<220>
<221> 3'UTR
<222> (7676)..(7865)
<400> 5
gggggggaca?gcggcgcggt?gggaagattg?gggccttggg?ggtgaggctt?ttgggcggag 60
gccaataata?ctgcactgca?ttcgcagact?cgttgactga?ctcgtggtca?tgccgtttct 120
ccctaatatt?tcctccgtcc?tttaatataa?tattaaagtc?tttaatatta?tacttgtact 180
actccctcca?ttataaaata?taagtcataa?ccacccctaa?cccaaacacc?aagaaaataa 240
ttattattat?cttgtagttt?agaacatcct?aataaataca?atgcatgcat?ccaatagaat 300
cagagagcat?gaataataat?ttaataaaaa?agaggtcata?gttaattgcc?tatatgcatg 360
catgccttat?attatgaaac?atctaagaaa?agtggttgtg?ccttatatta?tggaatagag 420
ggagtcctat?ttaaccattt?atcttatttt?aaaaaaatta?tgcaaataat?aaaaataaaa 480
agttgtgctt?aaaagatttt?agataataaa?ataagtaaaa?gaaaattaaa?taataatttt 540
caaacttttt?tttaataaaa?cgaaggatcg?tactccctcc?attctaaatt?gatctacgta 600
tttcataggt?acaccaagac?caagaaaaac?taataactct?ttcatattat?atttactcta 660
acaacaaact?caatgcatgc?atcatcccca?atatttccta?gccaatagca?aatcaagata 720
ttgcatgtgg?gttataaata?cttgtgtgca?tggaagcatg?catcaatgtc?catttactcc 780
aatgcacaca?aataacgaat?agacttaata?aatgaacaca?aatatataga?tcatttagga 840
ataacctaaa?aaaactatat?atagatcaat?ttagaatgaa?gggagtacaa?agtaaaatgt 900
taaaatacct?tatattagag?aacaaacgaa?ctaattatgt?gaaagcagtt?ctctaaccca 960
ttgcgagagg?accgagaaaa?ataccaccac?tttaagagca?gttacaatag?caggctataa 1020
gccaactgca?aacatatttt?aaggagataa?ataaggagag?agaagggtag?cgggctatag 1080
atttgtagcc?aactgtagca?cagactccaa?gacacagtgt?gtatgacagg?tgggaccagg 1140
tattaatagt?atagtacttg?tatgaataag?ctattagatt?ggctataaat?aaattgaagc 1200
tactacttgg?ctgtactgtt?aaccttgctc?taattacact?cggagtcgga?gagtcaggag 1260
gtgagagagt?agcactcaac?gcaaaagggg?atcggccgag?ccgccgatcg?aggcgcgagt 1320
agggatggag?gcggctgcca?tggccgtaac?cgcagccacg?ggggccttgg?cgcccgtgct 1380
agtgaagctg?gccgctttgc?tggacgacgg?ggagtgcaat?cttctggagg?ggagccggag 1440
cgacgcagag?ttcatcagat?ccgagctgga?ggccgttcat?tctctcctca?ccccaaatat 1500
cttggggagg?atgggggatg?acgatgcggc?gtgcaaggat?ggcttgattg?cggaggtccg 1560
ggagctgtcc?tacgacctgg?atgatgccgt?cgacgacttc?ttggagctca?atttcgagca 1620
gcgaagaagc?gcaagccctt?tcggtgagct?caaggcaaga?gttgaggagc?atgtctccaa 1680
tcgcttctct?gactggaagc?taccggcggc?gagccttccg?ccgtcgtcgg?tacaccgccg 1740
agctggcttg?ccgccaccag?atgcagagct?ggtggggatg?gacaaacgta?tggaagagct 1800
caccaaattg?ctggaacaag?ggagcaatga?tgcttcacga?tggcgcaagc?gaaaaccgca 1860
tttcccgctc?agaaaaacag?ggctaaaggt?acggttggat?ctcgattctt?cacaaatata 1920
gcttcctccg?atagcagtgc?caatgaattt?gtttacttct?ctcttgattc?tttaatttgg 1980
aagtactgta?taacaaacat?ggagggatcg?tcatttaact?taattttttt?tgttgcagca 2040
aaaaatcgtg?atcaaggttg?ccatggaggg?caataattgc?cgttcaaaag?caatggcttt 2100
agttgcgagc?actggaggag?tggactcggt?tgcgctcgta?ggtgatctaa?gagacaagat 2160
agaggtggtc?ggttatggca?ttgaccccat?caagctgatc?tccgcgctcc?ggaagaaggt 2220
gggcgatgcg?gagttgctgc?aggtcagcca?agcaaaaaaa?gatgtgaagg?agacgacgcc 2280
gatgcttgcg?ccggtgaaat?ccatatgtga?atttcacaag?gtcaaaacag?tttgcatcct 2340
tggattgcca?ggtggaggca?aaacaacggt?tgccagagaa?ttatatgacg?ccttgggaac 2400
gcacttccca?tgccgggttt?tcgtgtcagt?ctctccaagt?tctagtccca?gtcccaatct 2460
cacaaagact?cttgcagaca?ttttcgctca?agcacaacta?ggagtaaccg?atacacttag 2520
cacaccatat?ggtgggagtg?ggaccgggag?agctcttcaa?caacatctca?tcgacaacat 2580
atcagctttc?ctcctcaaca?aaaagtaagc?aatatcttat?atctcttatc?tagcttgtcc 2640
ttaatccggc?ttcccaaatt?aaagtgaaca?ggctatatgt?ccatataatg?ttgggttttt 2700
ttttttctgt?cctcgatgag?gtatatatca?agatatgcca?aacttttttt?aattagcgtt 2760
actttattct?acctagtaaa?tagatacaga?aatggggcag?gcccctcctt?tgtgacaggc 2820
caatggtttt?atgatgtgga?aacaactccc?ttatcactga?agctcttgct?attactcgtg 2880
atggtactga?tcttgcaaag?gcttgcagta?tttgtaaatc?cacagggagt?ggtcatcttt 2940
ttttttttaa?gataatgaat?agaaatctgg?cctctatata?gaaagccaaa?ggttacacaa 3000
gtgcatacac?tccaaatctc?aaagctgaga?aacacgaaaa?acaaacgacc?aaaaagaaaa 3060
gacgataaga?ttaagtttca?agcttttcct?ccttgcttca?gaaaacaggg?aaatgcagag 3120
ctagcccgct?cttcccctgc?catgccctct?cactgccatt?gcaactacca?caaaagctcc 3180
cctgtttcgc?cgtgagcgaa?gggaggggat?ggaactagtc?tgctgctttg?ttgtcgccaa 3240
gcactggttt?catgctgccc?aaacaaccta?tgccccgcta?gcgataacga?gtctgttgcc 3300
gccatgctgt?tgtcgctgga?gagcacttgt?cgctgctcag?ctatgtgtta?agtaagctac 3360
taacaatctc?tccattctct?tgtagactgc?ttataaaaga?ttgtacttca?actttttatt 3420
aatgaaatag?agttcctgcc?ttacaacaac?aagaacgaga?gagagagaga?gagccaatat 3480
cacgagttag?cactgtgaag?acttcctgac?tgttatgtct?tcaagaacag?tataaaagca 3540
tttgccacta?taaaaatatg?atagccctca?agatcattaa?aaatatgtca?tgttctttta 3600
ccttcataac?aaccagtatc?acaaatatga?aaacatttaa?aggaaaatca?gtatttgcca 3660
tttatgtaaa?gaaaaactag?actagaactc?tgggctttta?ttttagtgca?cactgtatac 3720
atgtgtgttc?tttgacgtat?atacttgata?ttttttcaaa?aacttttggg?ggcatatctg 3780
taacccatgc?cccatgcatc?caaagtagta?gtgagacaac?tttcgtatca?atggacatgt 3840
ggcattaaat?ttaatcccaa?tatttgttct?ctcgaagtcc?tgaacatata?attggacaaa 3900
attatataat?ttaattaggc?caattgagcc?atatatacac?acactataag?aaacttctac 3960
aaaacaaaca?ttcgctcctt?ttaggttttg?accagtctat?acatgaacca?gccaacggtg 4020
tgctggtctg?actataaatg?tttttttaga?gagtaaaggc?accttccagt?acctctctcg 4080
aggacagtaa?aaacacccat?gctttaaggt?tatgaacaac?aaagcataga?acaaccacaa 4140
gaaaaaaaaa?aacaactaga?acaagttctg?gaactagtta?gggattcggg?aagccattgc 4200
ttgctggctt?gggacaagct?atgcctgcca?ttggactatg?gtggagactg?ggcataaagg 4260
atctcaatct?cttggagatt?ggcctatgtc?ctaggtggcc?atggctgact?gcaaggagat 4320
atatttcttg?caacggaaat?tttcattgca?aaagctgaaa?atcgttgcga?tatgtaccta 4380
ttgtgacata?attgaatcca?ttgggagccg?tagcaataaa?tcccgtggta?ataggctatt 4440
gcaatgattt?tccgatggtt?gcataaaaag?gtgctattac?aatggttttg?cattgctatt 4500
gcaacaactt?gatatgtcat?aggtatttat?tgcaacagtt?tgtaccatgc?tgcaataaga 4560
tttcgcaaca?cagacctatt?cattaaatag?cctatttcca?cacattcatt?tttgtggcaa 4620
taattcagtg?cgacaagcat?gttctatagc?tataacctga?tgcaacgggt?tagacttgtt 4680
gcagtaactt?attagcacat?ttaatttttt?actaaattta?tattgattca?actatttcaa 4740
catcattcaa?tacagtaaat?actggaaaat?gcaagcaatc?tccaaaaatt?caccaataag 4800
agaaacgaat?taaatcatat?acacaattat?ttcacaccgt?acagtgcact?taagtgtagg 4860
aaatataatg?ctatatacat?ttccaaccct?caatacaggt?tctgtaaata?atgaaaagaa 4920
acatcaattt?gatttcttga?ccggtccctc?tgagacacac?agtgctttcc?tcagcaacat 4980
cgttgccgat?ctatgtaact?tgtaaactcc?ttgtgcttaa?taaattctgg?ccagggttac 5040
ttcagcctgc?atggcgaaaa?aaaagaactt?gttagggaga?tcgcaaacaa?atgttagctg 5100
ccccatttct?tctctactga?ccataaaagc?tctaggatca?ggtcatgaaa?acaatgccgt 5160
cagaccggaa?atactcaaga?ttcagaacac?gactcctagg?aactgcaagt?ttaaatttca 5220
acaaaagcaa?aatacaacca?gatgacaaac?taatatatat?cagctgactg?ttcatctcaa 5280
gtggactcac?atctgtgaaa?ttgttagttc?tatgcatata?tgctaatgta?atactaatat 5340
gctattgagg?cttattactc?ttctcgactt?ttataggtat?ctcattgtaa?tcgatgacat 5400
ttggcattgg?gaagaatggg?aagtcatcag?aaagtccatt?cccaagaatg?atctgggtgg 5460
tagaataatc?atgactactc?gtcttaattc?aatagctgag?aagtgccaca?ctgatgacaa 5520
tgatgttttt?gtctacgaag?ttggggatct?agataataat?gatgctttgt?cgttgtcttg 5580
ggggatagca?acaaagtctg?gggcaggcaa?caggatcgga?actggagagg?ataatccatg 5640
ctatgatatt?gtgaacatgt?gttatggtat?gcctttagca?cttatttggc?tgtcgtcagc 5700
attggttgga?gagatagaag?aattaggtgg?tgctgaagtg?aaaaaatgta?gggatttgag 5760
acacatagag?gatggtattt?tggacatccc?atccttacaa?ccattggcgg?agagtttatg 5820
ccttggttat?aaccatcttc?ctctttatct?gaggactttg?ttgttgtact?gtagtgcata 5880
ccattggtct?aacagaatcg?aaaggggtcg?tctggtcagg?aggtggattg?cggaaggatt 5940
tgtgtcggaa?gagaaagaag?cagaaggtta?ctttggcgag?cttattaaca?gaggatggat 6000
tacgcagcac?ggagacaaca?acagttataa?ttactatgag?atccaccccg?tgatgctggc 6060
cttcctgaga?tgcaagtcca?aggagtacaa?ttttttaaca?tgcttgggtc?tgggatctga 6120
tactagtact?agtgcatcct?ccccaaggtt?gattcgccgg?ctgtctcttc?agggggggta 6180
tccagtggac?tgcttgtcaa?gcatgagtat?ggatgtgtca?cacacttgca?gccttgtcgt 6240
ccttggtgac?gtggcgcgac?ccaagggaat?ccccttctat?atgtttaagc?gcttgcgagt 6300
gttggacctt?gaagataata?aggatataca?ggattctcat?ctgcagggca?tatgtgaaca 6360
gttaagcctc?agagtgaggt?accttggtct?caagggaacg?cggatccgaa?agctccctca 6420
ggagatgagg?aagctgaagc?atttggagat?tttgtatgtg?gggagcactc?ggatcagtga 6480
acttccgcaa?gagattggag?agctgaagca?tctgcggatt?ctggacgtga?gaaacacgga 6540
catcactgag?ctcccactgc?agatacggga?gctgcagcat?ctgcacactc?tggacgtgag 6600
gaacactcca?atcagtgagc?tcccgccgca?ggttggcaag?ctgcagaatc?tcaagattat 6660
gtgcgtgagg?agcactgggg?ttagggagct?cccaaaggag?attggggagc?tgaatcatct 6720
acagactctg?gacgtgagaa?acacgagggt?gagagagctg?ccatggcaag?ctggccagat 6780
ctcccaatcg?ttgcgcgtgc?ttgccggtga?cagtggcgat?ggcgtgcggt?tgcccgaagg 6840
cgtctgcgaa?gctctgatca?acggtattcc?aggggctacg?cgtgcaaaat?gcagggaggt 6900
tctgtccatc?gcgatcatcg?atcgtttcgg?acctcccctt?gttgggatat?tcaaagttcc 6960
cggcagtcat?atgcgtatcc?cgaagatgat?caaagaccac?ttccgcgttc?tttcttgcct 7020
agacatcagg?ctctgccaca?agcttgagga?tgatgaccaa?aagttcctcg?ccgagatgcc 7080
caacctgcag?acgctcgtgc?tgaggttcga?ggccctacca?agacaaccca?taaccatcaa 7140
cggcacaggc?ttccagatgc?tggagagctt?ccgtgtcgac?agccgggtgc?caaggatagc 7200
cttccatgaa?gacgccatgc?ccaacctcaa?gcttctcgag?ttcaagttct?acgccggccc 7260
agcaagcaac?gatgccatcg?gcatcaccaa?cctgaagagc?ctccaaaagg?tggtctttcg 7320
gtgctcgcca?tggtacaaga?gcgacgcccc?tggcatcagc?gccaccattg?acgtcgtgaa 7380
gaaagaagcc?gaggagcatc?ccaaccggcc?gatcaccctc?ctcatcaatg?ctgggtataa 7440
ggagatatca?actgagtcac?acgggagcag?tgaaaacatt?gcgggcagca?gtgggatcga 7500
tactgagcct?gcacaggcac?agcatgataa?tctccctgct?gttcgagatg?actacaaggg 7560
aaaagggatt?cttcttgatg?gcaggtgtcc?tacctgcggc?cgagcgacta?aaattgaaga 7620
ggaaacccaa?gatcgagtag?cagatattga?aattcaaaca?gaaactacta?gctagctagt 7680
accgctgtct?aattttattt?gtattaaata?ctctccttca?tgtaatactc?taagtccccg 7740
ctcaattttt?cttgcctccg?caactctaca?tgatactcaa?aactgatttc?ttacctccct 7800
ttgattgtag?aaaaaacatg?ggaagtttgg?aggatttcaa?tcctatgaaa?aggactttga 7860
gaaacaaatt?acggaatcct?atcttttcct?ttaaaagata?tataatagaa?aatcctatag 7920
agatttttat?aggaaagtta?acaaaagcct?caatcttatg?gagaattcct?gtgtttattt 7980
gcatagagga?aagtgagact?cacctaatca?ggggcggttc?tagtgggtgg?tccaggtgat 8040
ccctggacca?ccctaaaatt?tggcccatga?gaaccgcccc?ccccctcctc?ctcccggggt 8100
tggtcgaaac?cagaaaaaag?gccactgagc?taagctaggg?ttagggagag?gtgtagccat 8160
gaactagcca?cagcagcacg?catcgctggc?tgccgcctcc?gcctctgcgt?cagcgccagc 8220
gtgccgtctc?cccggctctc?gactctgcct?ccgcctccgc?cttggcgccg?atgcgtcgcc 8280
tcctcggctc?ccgcttctac?ctcagcgcca?gcgtgccgcc?tccgccttag?cgccgcctcc 8340
tcgcctcctc?ccttccccga?ctcctccagt?cccccactcc?tgtcggttgc?tatcgtcggc 8400
gggcggcgac?caacgcctac?aagccaacta?cggctgcctg?ggcaagccgg?cggccacccc 8460
cgcccctgga?aagggaaaac?attgccattc?cacaggcggc?gccaggtccc?ctttctctct 8520
agctttcttg?ttgctcagca?aagttcaaag?gtcagtagac?atttcttgtt?ggttttttgc 8580
aatgttgccc?tatgcagtag?tgagtagtca?gtactcagta?gtagtgctag?tgaaaaattt 8640
ctgccttgag?tgtagtgaaa?agcaagctga?gaaatagcat?gtgtgacaaa?ttattaaatg 8700
atggtttaat?cacatctatt?gagcgggtta?ttttctctca?agttagcaaa?gaagacatta 8760
tgcataattt?catgtctata?tatgaacgga?gagtagaaaa?gaagtagggt?tttgtaatct 8820
tctacttatc?tattataaga?tatttgaatg?attatgttct?aactttcgta?acttcaaatt 8880
tagatgttgg?ttttaagcaa?gttgtgatgt?tgtgagatat?attgctacat?ttcaattata 8940
tttttattat?ttttgacaca?tttggcttga?atttgtaaca?atgtgacaat?ttggagcatc 9000
aagtaggact?acccgacgat?tcatgaaacc?aatgtgccga?tatttagcgg?ttcttaatca 9060
tactgaggta?agaaggcaac?attttgcaaa?agtagaattt?cttcatgaaa?atcaggctta 9120
tagctttaat?gttcacaaac?tagctaagtt?tccttgtacc?ttagaggagg?ggcatcatgt 9180
tcgattctca?aatactcctt?gtaatctaag?taggaatgta?aataatttgg?ttgttaatga 9240
ataaaatgcc?agaattttat?tctaaaagaa?tatgtaattc?aaattaatat?tattctagat 9300
gtatcttgaa?tagcccatta?gcactggacc?agtctttcaa?gttgggtcag?tggtcggtac 9360
cattgcctgg?cccatcatgg?aacagaatgg?ccatggtctg?atcgcaatgg?gccgaggcat 9420
gacgcgctgc?gctttcgaaa?tcacgggcct?gagctgtcat?gagggctatc?ctgggccagg 9480
cccgcgagac?aagagggtgt?cggacaatgc?aacaacaacg?agaggcaata?agcagagctt 9540
atgcattgca?cgaccaacaa?agttgtcact?tacatccctt?attattctca?atcttaatac 9600
tatctccgtt?caaaaaaaag?tagactttta?gatacgaatg?tgaacaaacg?tcctcatcaa 9660
tcttgcctgc?tgataaagca?accgcagcta?ccacgcacta?tgcagggatc?gatcgatcga 9720
tggatggaca?tattattact?caacaaagta?gaggcattaa?tccgcttgca?gactaatcag 9780
attcaggcga?cagcacgcgg?ctgctgattc?atcagatggc?attgcttcaa?attgttcgct 9840
ttcaccatgc?cctgcaccat?gcatcattta?gatatttatt?ttactgtact?catagtaatt 9900
aaccactgaa?aattcactct?aggaaatcgt?gtgttaactg?ttaacctggt?agattttgat 9960
catgaattgg?ttgatgtcgt?cgagcgatat?gacgccctcg?tacgcggcgt?tgaaacggta 10020
gctgtcgtca?tcgcgtccag?acgccaccag?cagcggcggc?gcaggcggca?gctgctccac 10080
gcagctgtac?tcgcactcgt?cgtggcactc?gccgtcgccg?ccgccgccgc?cgccgccgtt 10140
ctccgccgtg?atcgccacct?gcagcgtcag?gtgcacctcc?agcgtcacga?acacgcccac 10200
caccttcgcc?ggcgacccca?tcgccgtcgg?ccgctgcatc?ttgtagctcg?acatccacga 10260
gaatatgtac?gccgccatcg?acgacgagac?gccgacgatg?ttctgcttcc?tcaggctgtt 10320
c 10321
<210> 6
<211> 8839
<212> DNA
＜213〉Oryza paddy rice (Orysa sativa L.)
<220>
<221> promoter
<222> (1)..(1209)
<220>
<221> 5'UTR
<222> (1210)..(2441)
<220>
<221> CDS
<222> (2442)..(3433),?(3598)..(5671)
<220>
<221> 3'UTR
<222> (5672)..(5915)
<400> 6
ctactctctc?acctcctgac?tctccgactc?cgagtgtaat?tagagcaagg?ttaacagtac 60
agccaagtag?tagcttcaat?ttatttatag?ccaatctaat?agcttattca?tacaagtact 120
atactattaa?tacctggtcc?cacctgtcat?acacactgtg?tcttggagtc?tgtgctacag 180
ttggctacaa?atctatagcc?cgctaccctt?ctctctcctt?atttatctcc?ttaaaatatg 240
tttgcagttg?gcttatagcc?tgctattgta?actgctctta?aagtggtggt?atttttctcg 300
gtcctctcgc?aatgggttag?agaactgctt?tcacataatt?agttcgtttg?ttctctaata 360
taaggtattt?taacatttta?ctttgtactc?ccttcattct?aaattgatct?atatatagtt 420
tttttaggtt?attcctaaat?gatctatata?tttgtgttca?tttattaagt?ctattcgtta 480
tttgtgtgca?ttggagtaaa?tggacattga?tgcatgcttc?catgcacaca?agtatttata 540
acccacatgc?aatatcttga?tttgctattg?gctaggaaat?attggggatg?atgcatgcat 600
tgagtttgtt?gttagagtaa?atataatatg?aaagagttat?tagtttttct?tggtcttggt 660
gtacctatga?aatacgtaga?tcaatttaga?atggagggag?tacgatcctt?cgttttatta 720
aaaaaaagtt?tgaaaattat?tatttaattt?tcttttactt?attttattat?ctaaaatctt 780
ttaagcacaa?ctttttattt?ttattatttg?cataattttt?ttaaaataag?ataaatggtt 840
aaataggact?ccctctattc?cataatataa?ggcacaacca?cttttcttag?atgtttcata 900
atataaggca?tgcatgcata?taggcaatta?actatgacct?cttttttatt?aaattattat 960
tcatgctctc?tgattctatt?ggatgcatgc?attgtattta?ttaggatgtt?ctaaactaca 1020
agataataat?aattattttc?ttggtgtttg?ggttaggggt?ggttatgact?tatattttat 1080
aatggaggga?gtagtacaag?tataatatta?aagactttaa?tattatatta?aaggacggag 1140
gaaatattag?ggagaaacgg?catgaccacg?agtcagtcaa?cgagtctgcg?aatgcagtgc 1200
agtattattg?gcctccgccc?aaaagcctca?cccccaaggc?cccaatcttc?ccaccgcgcc 1260
gctgtccccc?cccccccccc?cccccccaat?cttctggcct?ggccagctct?ggtcggagga 1320
gggttcagtt?ccatgggtgc?gccccctgcc?catccctcca?cttctacttt?cgtcttgaga 1380
tctcgccgtt?tctgatctcc?ttgccatggc?aaccagttga?tttggctgcc?aagatcgtcc 1440
gtgctttgca?aaggtgaaca?atctttttct?tcttgggctt?tcactttgtt?gtgttaatag 1500
actcagcgcc?gtcgcaactt?gcaaataaaa?aggttcagat?cggaaaatgg?aaataccgta 1560
cacagtagtc?tatagagaat?cgactagtat?ttcctgactg?taagtaagga?agttgtaggt 1620
accatgttct?gatgattatc?tttgaagctt?ggagggggac?aaaaagttgg?gagagaaaca 1680
agaatgtatt?tgttcacttg?attgggggca?gtaggtaaaa?tctcagcgtt?aggaatttgc 1740
acctctttat?taagtttgac?taaatttata?gaaaaaaatt?agcaacactt?aaaacaccaa 1800
attagtttca?ttgaatccaa?cattgaatat?attttgataa?tatgtttact?ttgtgttcaa 1860
aatgttacta?tatttttcta?taaatttgat?caaatttcaa?taagtttgac?tagaaaaaaa 1920
agtcaaaccg?acttataata?tgaatataaa?tggagggagt?agattataaa?ttatctttat 1980
tataatactt?tgagtgtaca?aacgaatgaa?taaagtttac?aaagttgaaa?agttattttt 2040
aaatactatt?ccgataaacc?tgtatataga?gaacttgtga?aaaaaaacac?cgtttgaaat 2100
gtgtctgtga?taatctataa?gaggaacggg?gcctaaatat?attccttttt?tcctacgaaa 2160
atgcaagaag?tattgcctaa?tatattgata?gagctgaagt?tttaaagtaa?aatgaaacat 2220
ttgcatgagg?cagcactgga?caaaaagcgc?ttgtgaaaaa?aatatgttcc?aaatattatt 2280
aattcattca?tggtatggtc?tttattttca?ttttcccccc?ttatccatgg?gcaggacacg 2340
gaaattctca?gcaggttcgc?gcttgatctg?aactgtctgt?ggctcatact?ctcttgtgct 2400
tgcaacagct?gaaagttgca?gtgagaagta?cagagaacaa?gatggagttg?gtggtaggtg 2460
cttccgaagc?caccatgaaa?tctctcttgg?gcaagctggg?caatcttcta?gcccaggagt 2520
atgctctcat?cagcggtatc?cgtggtgaca?tccagtacat?caatgacgag?cttgccagca 2580
tgcaggcctt?cctccgtgat?ctcagcaacg?tgccagaggg?tcacagtcat?ggccaccgga 2640
tgaaggactg?gatgaagcag?atccgagaca?tcgcctatga?tgttgaggac?tgtatcgatg 2700
actttgccca?ccgcctccct?caggattcca?tcagcgatgc?caaatggtcc?ttcctactca 2760
caaaaatcta?tgaactatgg?acatggtggc?cacgtcgtgt?gattgcttcc?aacattgccc 2820
aactcaaggt?acgggcacaa?cagatcgcag?atcgacgtag?tagatacgga?gtgaacaacc 2880
cagaacacct?tgacagtagc?agcagtgcca?ggacccgtgc?tgtcaattac?gaaattgctg 2940
agtatcaggt?cacaagccct?cagatcattg?gtataaagga?gcctgtgggg?atgaagacgg 3000
tcatggagga?gcttgaggtt?tggttaacta?atcctcaagc?tgaaaatggg?caagctgttc 3060
tgtccatagt?cggttttgga?ggtgtgggaa?agactaccat?tgccacagca?ttgtacagaa 3120
aagtcagtga?taaatttcag?tgccgggcat?cagtagctgt?gtctcagaac?tatgaccaag 3180
gcaaagtcct?caatagtatt?ctgagtcaag?tcagcaatca?ggagcagggc?agcagcacaa 3240
caattagtga?gaaaaagaac?ctcacctcag?gcgctaagag?catgttgaag?acagccctgt 3300
cactgctcag?aggtaattgt?atatgtcagc?cagaaaatga?tggaaaccct?gataatacac 3360
caatcaggct?gcaggaaaca?acggacgatg?atcaaaaccc?cagaaaactg?gaacagctcc 3420
tggccgaaaa?gaggtacctt?tttttgtaaa?taaaattgct?ttgcttatct?gtaaattaac 3480
ttactcatcc?cactctaaat?ctaatgttta?tttccttcta?tacacagcac?aactccatct 3540
tttgaatggg?ttttattttt?ctcacttgtg?ctcatttttt?ttttatcatc?tctgcagtta 3600
tatcctcttg?attgatgaca?tttggtctgc?cgaaacatgg?gagagtatca?gatcgatttt 3660
gcctaaaaat?aataaaggcg?gtagaataat?agtgactaca?agatttcaag?ctgttggttc 3720
aacatgctcc?cctcttgaaa?ctgatcgttt?gcatacagtt?gattttctca?ccgatgacga 3780
gtcccaaaac?ttattcaata?caagtatttg?tgaatcaaag?ataagaaaag?atagcaacaa 3840
agtagacgag?caagtccctg?aggaaatatg?gaaaatatgt?gggggattgc?ctttggccat 3900
agtcaccatg?gctggtcttg?tcgcctgcaa?cccaaggaaa?gcctgctgcg?attggagtaa 3960
actttgcaaa?tcattatttc?cagagcaaga?aactcctctt?accctcgatg?gtgttacaag 4020
gatactggat?tgttgttaca?atgatttgcc?tgcggatctg?aagacttgct?tattgtactt 4080
gagtatattt?ccgaagggtt?ggaaaattag?taggaaacgt?ttgtcccggc?gatggatagc 4140
tgaaggtttt?gctaatgaga?agcaagggtt?aacccaggaa?agagttgcag?aggcatactt 4200
taatcaactc?acaagaagga?acttagtacg?tcccatggag?catggcagca?atgggaaggt 4260
aaaaacgttt?caagttcatg?acatggttct?tgaatacatc?atgtccaaat?caatcgaaga 4320
gaattttatt?actgtggttg?gtggacactg?gcagatgact?gcaccaagca?ataaagtccg 4380
tcgactgtcg?atgcaaagca?gtggatccaa?tcgtggaagt?tcaacaaaag?gcctgaactt 4440
ggctcaagtg?agatcactga?cggtgtttgg?gaacctgaac?catatgccat?tccattcatt 4500
caactatggg?ataatacagg?tgctggatct?tgaggactgg?aagggtttga?aagagagaca 4560
tatgacggag?atatgtcaaa?tgcttttact?caagtatttg?agcatccgac?gaacagaaat 4620
ttccaaaatt?ccctccaaga?ttcagaaact?tgagtacttg?gaaactcttg?acataaggga 4680
gacatatgtc?agggacctgc?ctaagtcaat?agtccagcta?aaacggatca?ttagcatact 4740
tggagggaat?aaaaacacac?ggaaggggct?gaggttgcct?caagaaaaaa?gtaagaagcc 4800
aattaaaaac?ccgtcgcctc?aaggaaaaac?aaaggagccc?gcaaagaaag?gattcttatc 4860
ccaagaaaaa?ggtaaaggcg?caatgaaagc?actccgtgta?ctgtcaggga?ttgagattgt 4920
tgaggaatca?tcagaagtag?ctgcaggcct?tcatcagttg?acagggctaa?ggaagcttgc 4980
catatacaag?ctcaatataa?caaagggtgg?tgataccttc?aaacaattac?agtcctccat 5040
tgagtacctt?ggcagctgtg?gtctgcagac?tctggccatc?aatgatgaga?attctgaatt 5100
tatcaactca?ctgggcgaca?tgcccgcgcc?tccaagatat?cttgtcgccc?ttgagctgtc 5160
tggcaagttg?gagaagctac?ccaagtggat?caccagcatc?actactctca?acaagctaac 5220
catatctgta?acagttctta?ggactgaaac?tttggagatc?ctccacattt?taccttcatt 5280
gttttccctc?accttcgcct?tttcacttag?tgcagcgaag?caggatcagg?acataataaa 5340
ggacatcctt?gagaataata?aattggacag?tgatggggaa?atcgtcattc?cagctgaagg 5400
attcaagagt?cttaagctgc?ttcgcttctt?tgcaccttta?gtgccgaagc?tcagcttttt 5460
ggacaagaat?gcaatgccag?cactcgaaat?cattgaaatg?cggtttaaag?acttcgaagg 5520
tctatttggc?atcgaaatcc?ttgaaaatct?ccgtgaggtg?catctcaaag?ttagtgatgg 5580
ggcagaagca?ataaccaagt?tccttgtaaa?tgatttgaag?gttaatactg?agaaaccaaa 5640
agtatttgtt?gatggcatcg?tcactgcatg?agaagtaaaa?ttgctgcaaa?tcggagaact 5700
taccaatcat?ctgaggcttc?ccctctatta?ttactctctt?agaatatatt?gttattattg 5760
ctcaccttgc?aaaataaaat?agggatggca?tagcatattg?ctacaacgta?ccatggttcc 5820
atcatagttg?atttcacttg?tcattacagt?gtctgttcag?ttgtgttttc?tattaataaa 5880
agggagatct?ccgcaagaaa?ccattattat?acttatattc?ggttattgaa?ctctataaat 5940
gatgggattg?ctatatttat?ggtgccacaa?tttccatgag?tgcggtattt?ttttttctag 6000
cagttggctg?gtgttaagat?ttgtgctgcc?attgctcctc?tattattggt?gcccaaaatt 6060
acgctttgca?ctatgttcac?agttgtaaaa?cttacctaaa?tttcgtgtat?tagtactgta 6120
atgttgtgat?tttcgcgtcc?agttatattt?ttttctttgc?cagaagtttg?atttcaaggt 6180
atatctggta?agcttcagcc?ggattcgtta?agtttttagt?ttaatcagct?aaacttttaa 6240
cagtatgcat?gcactagttt?ctcccgttat?cttatccaat?ataattaatg?ggctaattgg 6300
atctatgcca?ttacaaacat?ggcaagattc?agaaaaatgc?tactacaatt?tgtctattca 6360
tagctgtgct?agtgaaattt?tacaaaattg?gaaccgtgct?attgatatca?cgttttccat 6420
ccatcttttc?ttttttttcc?ttttcttctt?tatcccgtct?tcttcccgca?ccgacgagag 6480
gcgagtggcg?gcgggaccgg?caagcgatgg?caggacctcg?gcagctcagt?ggtggcagcg 6540
gcaaaaggga?aaggggaagg?ggtaggagag?aacctggccc?gccgacgcaa?gcatgttggt 6600
cgtcgtcttc?cccgaggagc?ttgagcagtg?gcaatggtag?aggaatccaa?ggaggccgag 6660
gaggttgagc?ggcactaatg?gtagaggatg?ccgaggaggt?cgagcatcag?cgagcttgcc 6720
ctgggtgggc?gagtgaggga?gagctctccc?aagtgtctgc?gaagctctca?tcttcgtttt 6780
cctcatcccc?actttgctcc?tcttccacta?ctgctgttga?agctagcggc?cctctctcac 6840
cagatctggg?cggagctcaa?gcgaggcgcc?accaccgacg?atggagcttc?gcgtggaccc 6900
cacagcctca?cccgattgcc?atccctccta?ccctcatcac?tccatctcca?agcccaaatc 6960
ccacctcccc?caccggctcc?tcctcctcag?cccctgccgt?ggcagccgag?gccaccgatg 7020
ggccaaccct?caacatcgtc?tcgaagcagc?tccgcgcact?gtggaagaag?cacaaccaaa 7080
tcctccagat?ggaggagtcg?ctcactggcg?ggaggaagct?gaacaaggag?caggaggagg 7140
tgctccgatc?caagcccatc?gtcatcgcgc?tcattgatga?gctcgagcgg?atgcgtgccc 7200
tgctcgccga?cgccctcgcc?gaggagctct?cctcctgccc?cgccccttcc?ctatctgtca 7260
ctccctcctc?ctccacctcc?tccggcgctg?atttgtccgt?caaggatctc?ctcacgctca 7320
tctacttcgg?ctccctcttc?gacgtcaagt?cgcagatcga?gttcgtcacc?accatgctcg 7380
cacgctaagg?agctagactg?atgcatcacc?tacgactatg?tccgtccttg?ccgcagcacg 7440
acttgctacg?gtcccgcctc?acgccccgtc?gctcgccggt?cccgccgcca?cttgcttctc 7500
atcggtgcgg?gaagaagatg?ggagaaagaa?ggaagaaaac?gggaaaaaaa?gagatggatg 7560
aaaaacgtga?cagcaatagc?acggttccaa?tttcgtaaaa?tttcaatggc?accgctacga 7620
atagaagaat?tgtagtagca?tttttctgaa?tcaacatatt?tgtaatggca?tggatccaat 7680
aaaccccaaa?tttattttat?gccaatacaa?atattggcaa?ctggtgtcat?taacgtataa 7740
atgggtcgcc?tacataaaac?cttccgcgtc?cttcttggtt?gaacaggtaa?ttaattgcaa 7800
ccattttctg?aaaaaattga?ctggaagtct?gaaaccgtcc?ctgctactcc?ctgaatgctt 7860
tagttcaatc?tctatgaagc?tccatccaaa?caaaatctcc?agatgatatt?tcattaaaaa 7920
catcatgtcc?agaactgtcc?agtatccaag?aatggctatg?atcttttctg?aattctggac 7980
tcgggactta?tattacatgt?atcaaatcca?gttattttct?ggagctacac?cagatgaaat 8040
caccaagtaa?aacaattata?taaggatggt?gagttgttaa?ttaattacag?ctttgataga 8100
ccactctgtt?tgttaatgcc?tgacaagagt?tcacaaagaa?aaaaatacac?aggattacaa 8160
aactttttag?atactatctg?atgtgtgtta?attctctcaa?atactatgta?cctgaacaaa 8220
caagagagaa?catgttgtga?attgtgatct?cctcatgcga?gtgacctgaa?actctctaca 8280
gggtcagact?cctcaagcat?cactgcagcc?tggaaacaat?cagcagcatc?attgatcctc 8340
ccatcattcc?tgtgaactct?ccctaaatga?agccaagcca?tcctgttcgt?aggctcaatt 8400
ctcagtgcat?cagagaggaa?gcatctcgct?gcagggagat?accttgaccc?ttgcttgcag 8460
agaagtgcac?caatggccac?cttggatgga?acatgctcta?gctctatcga?gaatgcgttg 8520
acgtaggcag?ccagtgcctc?cttgttctga?tctcgcgcct?cgagcatgaa?acctgaactt 8580
atagcatcca?cgagtcagat?tttgatgttg?aattcagttg?aatgcagaga?attgtcatgt 8640
tagtgttaca?tagaagtggt?gaaagttcaa?gtttagttga?gttgatcacc?ttctgcatgc 8700
attgttgcag?ccgagtagga?ttttagggct?ctagccttct?gcagacatat?ctcagcgtct 8760
ctccagattg?agagactgga?gtacaggttt?gcaagtcctt?gccatatttc?aaactcactt 8820
acactgtcat?tctgtccct 8839
<210> 7
<211> 38
<212> DNA
＜213〉artificial sequence
<400> 7
ttttggcgcg?ccggtgcggg?aagaagacgg?gataaaga 38
<210> 8
<211> 38
<212> DNA
＜213〉artificial sequence
<400> 8
ttttggcgcg?ccgccgacga?tagcaaccga?caggagtg 38
<210> 9
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 9
gaagctctga?tcaacggtat?tcc 23
<210> 10
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 10
tctttgatca?tcttcgggat?acg 23
<210> 11
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 11
tgaacttcca?cgattggatc?cac 23
<210> 12
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 12
acatggttct?tgaatacatc?atgtc 25
<210> 13
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 13
gcaggtcagc?caagcaat 18
<210> 14
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 14
caaccgttgt?tttgcctcc 19
<210> 15
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 15
cgtggaagtt?caacaaaagg 20
<210> 16
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 16
cagcacctgt?attatcccat 20
<210> 17
<211> 12
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 17
Gly?Leu?Pro?Gly?Gly?Gly?Lys?Thr?Thr?Val?Ala?Arg
1 5 10
<210> 18
<211> 12
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 18
Asn?Lys?Lys?Tyr?Leu?Ile?Val?Ile?Asp?Asp?Ile?Trp
1 5 10
<210> 19
<211> 15
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 19
Asp?Leu?Gly?Gly?Arg?Ile?Ile?Met?Thr?Thr?Arg?Leu?Asn?Ser?Ile
1 5 10 15
<210> 20
<211> 20
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 20
Glu?Asp?Ser?Pro?Cyc?Tyr?Asp?Ile?Val?Asn?Met?Cys?Tyr?Gly?Met?Pro?Leu?Ala?Leu
Ile
1 5 10 15
<210> 21
<211> 16
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 21
Val?Leu?Ser?Ile?Val?Gly?Phe?Gly?Gly?Val?Gly?Lys?Thr?Thr?Ile?Ala
1 5 10 15
<210> 22
<211> 18
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 22
Leu?Glu?Gln?Leu?Leu?Ala?Glu?Lys?Ser?Tyr?Ile?Leu?Leu?Ile?Asp?Asp?Ile?Trp
1 5 10 15
<210> 23
<211> 13
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 23
Gly?Gly?Arg?Ile?Ile?Val?Thr?Thr?Arg?Phe?Gln?Ala?Val
1 5 10
<210> 24
<211> 20
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 24
Glu?Gln?Val?Pro?Glu?Glu?Ile?Trp?Lys?Ile?Cys?Gly?Gly?Leu?Pro?Leu?Ala?Ile?Val
1 5 10 15
<210> 25
<211> 13
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 25
Cys?Leu?Leu?Tyr?Leu?Ser?Ile?Phe?Pro?Lys?Gly?Trp?Lys
1 5 10
<210> 26
<211> 13
<212> PRT
＜213〉Oryza paddy rice (Orysa sativa L.)
<400> 26
Lys?Thr?Phe?Gln?Val?His?Asp?Met?Val?Leu?Glu?Tyr?Ile
1 5 10
Claims (10)
1. rice blast resistance gene
Pi7, its nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:2, or the tandem sequence of SEQ ID NO:1 and SEQ ID NO:2.
2. according to claim 1 rice blast resistance gene
Pi7, encode a) at least and b) and a kind of in the described aminoacid sequence:
A) aminoacid sequence shown in the SEQ ID NO:3;
B) aminoacid sequence shown in the SEQ ID NO:4.
3. claim 1 or 2 described rice blast resistance genes
Pi7The cDNA sequence of gene.
4. claim 1 or 2 described rice blast resistance genes
Pi7The albumen of genes encoding.
5. by claim 1 or 2 described rice blast resistance genes
Pi7The expression cassette that described cDNA of gene or claim 3 and promotor make up.
6. contain claim 1 or 2 described rice blast resistance genes
Pi7The expression vector of the described cDNA of gene or claim 3.
7. claim 1 or 2 described rice blast resistance genes
Pi7The application in the preparation transgenic plant of gene, the described cDNA of claim 3, the described albumen of claim 4, the described expression cassette of claim 5 or the described expression vector of claim 6.
8. claim 1 or 2 described rice blast resistance genes
Pi7The application in improving rice anti-rice blast of gene, the described cDNA of claim 3, the described albumen of claim 4, the described expression cassette of claim 5 or the described expression vector of claim 6.
9. according to claim 1 or 2 described rice blast resistance genes
Pi7The molecule marker that gene produces.
10. the application of the described molecule marker of claim 9 in the assistant breeding of rice anti-rice blast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105786332A CN102094027B (en) | 2010-12-08 | 2010-12-08 | Rice blast resistance gene Pi7 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105786332A CN102094027B (en) | 2010-12-08 | 2010-12-08 | Rice blast resistance gene Pi7 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102094027A true CN102094027A (en) | 2011-06-15 |
| CN102094027B CN102094027B (en) | 2012-11-14 |
Family
ID=44127295
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105786332A Expired - Fee Related CN102094027B (en) | 2010-12-08 | 2010-12-08 | Rice blast resistance gene Pi7 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102094027B (en) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732531A (en) * | 2012-03-23 | 2012-10-17 | 南京大学 | Rice blast resistant gene RMg7, RMg8 or RMg9, and its application |
| CN102732511A (en) * | 2012-03-08 | 2012-10-17 | 华南农业大学 | Functional specificity molecule marker Pi7FNP of blast-resistance gene Pi7, method and application thereof |
| CN102747090A (en) * | 2012-07-02 | 2012-10-24 | 中山大学 | Rice disease resistance gene OsLYP4 and application thereof |
| CN103409433A (en) * | 2013-08-12 | 2013-11-27 | 江苏省农业科学院 | Novel broad-spectrum rice blast resistance allele pi21t and resistance application thereof |
| CN103421841A (en) * | 2013-08-15 | 2013-12-04 | 中国农业大学 | Os74 protein for rice and application of Os74 protein |
| CN104293799A (en) * | 2014-09-11 | 2015-01-21 | 南京大学 | Rice blast resistance gene RMg38 and application thereof |
| CN104372011A (en) * | 2014-09-11 | 2015-02-25 | 南京大学 | Rice blast resistance gene RMg41 and applications thereof |
| CN104845977A (en) * | 2014-12-22 | 2015-08-19 | 广东省农业科学院植物保护研究所 | Rice blast resistant gene Pi50, preparation method and application thereof |
| CN104404052B (en) * | 2014-09-11 | 2017-01-25 | 南京大学 | Rice blast resistance gene RMg39 and its application |
| CN106480051A (en) * | 2015-08-24 | 2017-03-08 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR010113 and its detection method |
| CN109280082A (en) * | 2018-10-19 | 2019-01-29 | 云南省农业科学院农业环境资源研究所 | A kind of rice blast resistance gene Pi57 and its coding albumen and application |
| CN113122649A (en) * | 2021-04-09 | 2021-07-16 | 武汉科技大学 | Primer and method for screening new allele of rice blast resistance Pik locus |
| CN113744800A (en) * | 2021-06-09 | 2021-12-03 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family |
| CN113789403A (en) * | 2021-09-02 | 2021-12-14 | 华南农业大学 | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems |
| CN116640774A (en) * | 2023-06-14 | 2023-08-25 | 江苏省农业科学院 | Rice blast resistance gene Pik-W25 and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1844393A (en) * | 2006-03-06 | 2006-10-11 | 华南农业大学 | Resistance gene Pi37 against rice blast and use thereof |
-
2010
- 2010-12-08 CN CN2010105786332A patent/CN102094027B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1844393A (en) * | 2006-03-06 | 2006-10-11 | 华南农业大学 | Resistance gene Pi37 against rice blast and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| CAMPBELL MA ET AL: "Debelopment of co-dominant amplified polymorphic sequence markers in rice that flank the magnaporthe grisea resistance gene Pi7(t) in recombinant inbred line 29", 《PHYTOPATHOLOGY》 * |
| 冯淑杰 等: "稻瘟病菌新无毒基因AvrPi7的遗传及物理作图", 《科学通报》 * |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732511A (en) * | 2012-03-08 | 2012-10-17 | 华南农业大学 | Functional specificity molecule marker Pi7FNP of blast-resistance gene Pi7, method and application thereof |
| CN102732531A (en) * | 2012-03-23 | 2012-10-17 | 南京大学 | Rice blast resistant gene RMg7, RMg8 or RMg9, and its application |
| CN102747090A (en) * | 2012-07-02 | 2012-10-24 | 中山大学 | Rice disease resistance gene OsLYP4 and application thereof |
| CN102747090B (en) * | 2012-07-02 | 2014-06-11 | 中山大学 | Rice disease resistance gene OsLYP4 and application thereof |
| CN103409433A (en) * | 2013-08-12 | 2013-11-27 | 江苏省农业科学院 | Novel broad-spectrum rice blast resistance allele pi21t and resistance application thereof |
| CN103421841A (en) * | 2013-08-15 | 2013-12-04 | 中国农业大学 | Os74 protein for rice and application of Os74 protein |
| CN103421841B (en) * | 2013-08-15 | 2015-04-15 | 中国农业大学 | Os74 protein for rice and application of Os74 protein |
| CN104404052B (en) * | 2014-09-11 | 2017-01-25 | 南京大学 | Rice blast resistance gene RMg39 and its application |
| CN104293799A (en) * | 2014-09-11 | 2015-01-21 | 南京大学 | Rice blast resistance gene RMg38 and application thereof |
| CN104372011A (en) * | 2014-09-11 | 2015-02-25 | 南京大学 | Rice blast resistance gene RMg41 and applications thereof |
| CN104293799B (en) * | 2014-09-11 | 2017-05-17 | 南京大学 | Rice blast resistance gene RMg38 and application thereof |
| CN104372011B (en) * | 2014-09-11 | 2017-01-11 | 南京大学 | Rice blast resistance gene RMg41 and applications thereof |
| WO2016101859A1 (en) * | 2014-12-22 | 2016-06-30 | 广东省农业科学院植物保护研究所 | Rice blast resistant gene pi50, preparation methods therefor, and applications thereof |
| CN104845977A (en) * | 2014-12-22 | 2015-08-19 | 广东省农业科学院植物保护研究所 | Rice blast resistant gene Pi50, preparation method and application thereof |
| CN106480051A (en) * | 2015-08-24 | 2017-03-08 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR010113 and its detection method |
| CN106480051B (en) * | 2015-08-24 | 2020-06-19 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR010113 and detection method thereof |
| CN109280082A (en) * | 2018-10-19 | 2019-01-29 | 云南省农业科学院农业环境资源研究所 | A kind of rice blast resistance gene Pi57 and its coding albumen and application |
| CN113122649A (en) * | 2021-04-09 | 2021-07-16 | 武汉科技大学 | Primer and method for screening new allele of rice blast resistance Pik locus |
| CN113744800A (en) * | 2021-06-09 | 2021-12-03 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family |
| CN113789403A (en) * | 2021-09-02 | 2021-12-14 | 华南农业大学 | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems |
| CN116640774A (en) * | 2023-06-14 | 2023-08-25 | 江苏省农业科学院 | Rice blast resistance gene Pik-W25 and application thereof |
| CN116640774B (en) * | 2023-06-14 | 2024-02-09 | 江苏省农业科学院 | Rice blast resistance gene Pik-W25 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102094027B (en) | 2012-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102094027B (en) | Rice blast resistance gene Pi7 and application thereof | |
| Zhou et al. | Structure, organization and expression of the metallothionein gene family in Arabidopsis | |
| CN101906427A (en) | Rice blast resistance gene Pi1 and application thereof | |
| CA2459079C (en) | Plant-derived resistance gene | |
| CN100569947C (en) | Resistance gene Pi 37 against rice blast and application thereof | |
| US8222485B2 (en) | Generation of plants with improved pathogen resistance | |
| CN102041262B (en) | Rice blast resistance gene Pik-p and application thereof | |
| WO2014127835A1 (en) | Plant-derived resistance gene | |
| KR100990370B1 (en) | Genes enhancing resistance to Magnaporthe oryzae and uses thereof | |
| CN102051368B (en) | Rice blast resistance gene Pik and application thereof | |
| EP2227485B1 (en) | Resistance gene and uses thereof | |
| CN109134633B (en) | Rice blast resistant protein and gene, isolated nucleic acid and application thereof | |
| CN1860230B (en) | Nucleic acids from rice conferring resistance to bacterial blight disease caused by xanthomonas spp. | |
| CN100556916C (en) | Resistance gene Pi 36 of rice blast and application thereof | |
| CN102021176A (en) | Rice blast resistance gene Pik-h and application thereof | |
| CN101050232B (en) | Pi15 resistance gene of rice blast, and application | |
| US20040216182A1 (en) | Generation of plants with improved pathogen resistance and drought tolerance | |
| CA2216406A1 (en) | Plant pathogen resistance genes and uses thereof | |
| WO2000008189A2 (en) | Plant resistance gene | |
| Fan | Identification of a novel receptor of bacterial PAMP RsE in Arabidopsis using genomic tools | |
| US8410337B2 (en) | Plant tubby-like proteins | |
| WO2016201038A1 (en) | Dreb repressor modifications and methods to increase agronomic performance of plants | |
| Valè et al. | A CC-NB-LRR gene confers leaf stripe resistance at the Rdg2a locus in barley | |
| Lin et al. | The Blast Resistance Gene Pi37 Encodes an NBS-LRR Protein and is a Member of | |
| Sun | Recombination and evolution of the rp1 rust resistance complex of maize |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121114 Termination date: 20211208 |