CN102094025B - Brassica napus AP2/ERF family transcription factor gene and preparation method thereof and application thereof - Google Patents
Brassica napus AP2/ERF family transcription factor gene and preparation method thereof and application thereof Download PDFInfo
- Publication number
- CN102094025B CN102094025B CN200910201013A CN200910201013A CN102094025B CN 102094025 B CN102094025 B CN 102094025B CN 200910201013 A CN200910201013 A CN 200910201013A CN 200910201013 A CN200910201013 A CN 200910201013A CN 102094025 B CN102094025 B CN 102094025B
- Authority
- CN
- China
- Prior art keywords
- transcription factor
- factor gene
- erf
- rape
- family transcription
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a brassica napus AP2/ERF family transcription factor gene and a preparation method thereof and application thereof. The brassica napus AP2/ERF family transcription factor gene is BnaERF-B3-8, the base sequence of the brassica napus AP2/ERF family transcription factor gene is SEQ ID No 1, and the protein amino acid sequence of the brassica napus AP2/ERF family transcription factor gene is SEQ ID No 2. The brassica napus AP2/ERF family transcription factor gene is cloned from rape seedlings by a polymerase amplification technology, and the obtained transcription factor gene is used for phytotransformation, and plant stress resistance is cultured and improved.
Description
Technical field
The present invention relates to field of crop genetic breeding, be specifically related to a kind of swede type rape AP2/ERF family transcription factor gene.
Background technology
Plant faces a lot of biologies and abiotic stress throughout one's life, has a strong impact on growth and development of plant, thereby influences the output of crop.Plant need be reacted to various adverse circumstances and growth signal in the responsing reaction that grows and stimulate to external world, and this carries out accuracy controlling with regard to requiring to the expression of various functional genes.Gene expression in plants exists the order property on accurate position, time and the space.Research shows: the major cause that causes this gene expression difference is the regulating effect of transcription factor on transcriptional level.Plant excites corresponding transcription factor through a series of signal conduction; Thereby starting the corresponding function gene transcription expresses; At last through gene product to external world signal make suitable response [Yamaguchi and Shinozaki at aspects such as Physiology and biochemistries; Annu Rev Plant Biol, 2006,57:781-803].A lot of genes are expressed by these stress-inducings, with the resistance of enhancement of plant to adverse circumstance.Transcription factor is one type of wherein important regulatory gene, regulates the adaptation of plant to various environment-stress through interacting with cis element.
Along with molecular biology and development of biology; People coerce the plant stress-resistance border from molecular level and have carried out many-sided research, and its research range mainly concentrates on aspect [Xiong etc., Plant Cell such as signal conduction and gene expression regulation; 2002,14:165-183].At present from plant separating clone tens of types with the relevant functional gene [Chinnusamy etc., J Exp Bot, 2004,55:225-236] of raising environment stress resistance.Function according to gene encoding production; Can they be divided into two big type: (1) coding directly protection cell is avoided the gene (enriching late period such as lea protein, antifreeze protein, aquaporin, ionophorous protein and chaperone etc. like fetal development) of the functional protein of environment stress injury; The gene (like sugar alcohol, proline(Pro), trimethyl-glycine etc.) of coding osmoregulation factor synthetic enzyme, the gene (like glutathione-S-transferase, superoxide-dismutase, katalase and ascorbate peroxidase enzyme etc.) of the degrading enzyme of coding toxicant.The clone of degeneration-resistant correlation function protein gene and functional study are for having opened up new way through the resistance of genetically engineered improvement plant.People will carry out genetic transformation with the relevant functional protein gene of raising environment stress resistance, and the resistance of render transgenic plant has had raising in various degree.Through the conversion of lea protein gene, proline(Pro) synthase gene and trimethyl-glycine synthase gene, the transgenic plant that some drought resistings, salt tolerance significantly improve have been obtained at present.(2) signal conduction and the relevant gene of transcriptional control under the environment stress; Comprise: the protein kinase (like map kinase, CDP kinases, receptor protein kinase, ribosomal protein kinases and transcriptional regulation protein kinases etc.) of signal is coerced in induction and transduction; The proteolytic enzyme (like phosphoesterase, Phospholipase C etc.) that plays an important role in the signal conduction; Degeneration-resistant relevant transcription factor gene has [Liu Qiang etc. such as bZIP transcription factor, WRKY transcription factor, MYC/MYB class, AREB class and AP2/ERF class transcription factor; Science Bulletin, 2000,45:1465-1474].AP2/ERF family is one type of important in plant transcription factor, and the AP2-DNA that comprises a high conservative combines the territory, and the product of its genes encoding has function [Okamuro etc., Proc.Natl.Acad.Sci.USA, 1997,94:7076-7081] widely.
Summary of the invention
Technical problem to be solved by this invention provides a kind of swede type rape AP2/ERF family transcription factor gene, and its base sequence is SEQ ID No 1.
Said transcription factor gene encoded protein matter, its aminoacid sequence are SEQ ID No 2.
Said swede type rape AP2/ERF family transcription factor gene is the BnaERF-B3-8 gene.
Said BnaERF-B3-8 genes encoding reading frame is made up of 603bp, is encoded into 200 amino acid whose protein.
The application of said swede type rape AP2/ERF family's transcription factor gene in preparation resistant transgenic plant.
Said swede type rape AP2/ERF family transcription factor gene is used for Plant Transformation.
The preparation method of said swede type rape AP2/ERF family transcription factor gene may further comprise the steps:
1) structure in rape cDNA library: choosing the rape seedling and extract total RNA, is that template, Oligo (dT) are primer with total RNA, synthetic cDNA under the effect of AMV ThermoScript II.
2) design a pair of primer: forward primer GGATCCATGGCAACTA TTGAGGAAATC, reverse primer GAGCTCTCAGAATTCGTTTGATGATGAATTGC; With above-mentioned cDNA is that template is carried out pcr amplification, obtains the rape AP2/ERF transcription factor gene BnaERF-B3-8 of family gene fragment.
3) above-mentioned amplified fragments is reclaimed rear clone and go into the T carrier, promptly obtain the degeneration-resistant AP2/ERF of the rape transcription factor BnaERF-B3-8 of family gene after the order-checking.
Above-mentioned preparing method's concrete experimental procedure is following:
1. the structure in rape cDNA library
The present invention is planted in black earth with Semen Brassicae campestris after 1% (v/v) NaOCl sterilization: perlite: in vermiculite (1: 1: the 1) mixed-matrix, and 22 ℃, 16h illumination cultivation growth 20d.Select the seedling of robust growth to extract total RNA.With total RNA is template, and Oligo (dT) is a primer, spins Shanghai bio tech ltd cDNA synthetic agent box explanation (http://www.bio-toyobo.cn/) with reference to Japan, synthetic cDNA under the effect of AMV ThermoScript II.
2. primer design is with synthetic
Design a pair of primer, the restriction enzyme site of Bam HI and Sac I is introduced at the primer two ends respectively.Forward primer GGATCCATGGCAACTA TTGAGGAAAT C; Reverse primer GAGCTCTCAGAATTCGTTTGATGATGAATTGC.Primer is given birth to worker's biotechnology ltd synthetic (http://www.sangon.com/) by Shanghai.
3.PCR method obtains the swede type rape AP2/ERF transcription factor BnaERF-B3-8 of family gene fragment
Pcr amplification adopts the PCR reagent of the precious biotechnology ltd in Dalian (http://takara.com.cn/), in the system of 50 μ l, carries out the PCR reaction, and reaction parameter is: 94 ℃ of sex change 30s; 55 ℃ of annealing 30s; 72 ℃ are extended 1min, 30 circulations of coamplification, and 72 ℃ are extended 10min again.It is the fragment (referring to Fig. 1) of a treaty 600bp that agarose gel electrophoresis through 1.0% detects amplified production.
4. the clone identifies and sequencing
Amplified fragments adopts the DNA of Hangzhou Wei Te clean biochemical technology ltd (www.axygen.com.cn/) sepharose to reclaim test kit, reclaims rear clone and to the pMD-18-Simple T carrier of the precious biotechnology ltd in Dalian (http://takara.com.cn/), clones evaluation and sequencing.
5. sequential analysis
Through the nucleotide sequencing analysis, obtain the swede type rape AP2/ERF transcription factor BnaERF-B3-8 of family gene fragment, it has following base and amino acid sequence information.
Base sequence:
1 ATGGCAACTATTGAGGAAATCTCTGATTTGGAGAAGCATCTCTTTGAAGACTTGATGATC
61 CCTGATGGTTTCATGGAAGATTTTGTCTTTGATGACGCTGCTTTTTTCTCAGGACTCTGG
121 TCTCTAGAACCCTTAAACCAAGTTCCTAAACAGGAGCCTAGTTCACCGGCTCTTGATCCA
181 GATTTCTATGTCCAAGAGTTTCTGCAAATGGAAGCAGAATCATCATCATCAACAACAACA
241 ACAACTACAACTACAACATCACCTGAGGTTGAAACTGTCTCAAACCGGAAAAGATCAAAG
301 AGAGCTGAAGAGACAAGGCATTACAGAGGCGTGAGAAGGAGGCCATGGGGAAAATTCGCA
361 GCAGAGATTCGAGATCCGGCGAAGAAAGGATCAAGGATTTGGCTAGGCACTTTTGAGAGT
421 GATATTGATGCTGCAAGAGCTTATGACCATGAAGCTTTTAAGCTCGGGGGAAGAAAAGCT
481 GTGCTCAACTTTCCTTTGGACGCAGGAAAGTATGATGCTCCGGTCAATTCTTGCCGGAAG
541 AGGAGAAGAAACGATGTGCCGGAGCCTCAAGGAACAACTACGAGCAATTCATCATCAAAC
601 TGA
Aminoacid sequence:
1 M A T I E E I S D L E K H L F E D L M I
21 P D G F M E D F V F D D A A F F S G L W
41 S L E P L N Q V P K Q E P S S P A L D P
61 D F Y V Q E F L Q M E A E S S S S T T T
81 T T T T T T S P E V E T V S N R K R S K
101 R A E E T R H Y R G V R R R P W G K F A
121 A E I R D P A K K G S R I W L G T F E S
141 D I D A A R A Y D H E A F K L G G R K A
161 V L N F P L D A G K Y D A P V N S C R K
181 R R R N D V P E P Q G T T T S N S S S N
The beneficial effect that the present invention realizes:
The present invention has cloned the transcription factor gene BnaERF-B3-8 of swede type rape AP2/ERF family; In order further to analyze the action and function of this gene in the low temperature adverse circumstance, compared the Arabidopis thaliana plant that changes the BnaERF-B3-8 gene and wild-type Arabidopis thaliana plant tolerance to low temperature stress.The result shows: wild-type has evident difference with commentaries on classics BnaERF-B3-8 gene Arabidopis thaliana plant on survival rate; Transfer-gen plant has tangible freezing tolerance than wild-type Arabidopis thaliana, and this shows that also changing over to of BnaERF-B3-8 improved the cryophylactic ability of Arabidopis thaliana plant.
Description of drawings
Fig. 1 detects pcr amplification product for agarose gel electrophoresis.
The Arabidopis thaliana plant and wild-type Arabidopis thaliana plant tolerance to low temperature stress of Fig. 2 for changeing the BnaERF-B3-8 gene, wherein A is the Arabidopis thaliana plant of commentaries on classics BnaERF-B3-8 gene, B is a wild-type Arabidopis thaliana plant.
Embodiment
Below in conjunction with specific embodiment technical scheme of the present invention is described in further detail.
Among the following embodiment, used test materials and source thereof are distinguished as follows:
After sterilizing through 1% (v/v) NaOCl, the seed of two low swede type rapes Shanghai oil 15 (Brassica napus L.Huyou15) is planted in black earth: perlite: in the matrix of vermiculite (1: 1: 1), 22 ℃, cultivate (16h illumination, 8h is dark, cold light source) growth 20 days.
Intestinal bacteria (Escherichia coli) DH5 α and Wine brewing yeast strain are preserved by Academy of Agricultural Sciences, Shanghai City biotechnology research institute plant genetic engineering research department.Cloning vector pMD-18-SimpleT, all kinds of restriction enzyme, Taq polysaccharase, ligase enzyme, dNTP, 10 * PCR buffer and DNA marker are available from precious biotechnology Dalian ltd.All chemical reagent are all bought from U.S.'s sigma chemical company and Shanghai traditional Chinese medicines chemical reagents corporation.ABI PRIAM Big-DyeTerminator dna sequencing kit is available from U.S. application system company.
Genetic manipulation conventional among the following embodiment is carried out [Sambrook J, Frets E F, Mannsdes T et al.In:Molecular Cloning.2nd ed.Cold SpringHarbor Laboratory Press, 1989] with reference to the molecular cloning document.
Embodiment 1
Extracting and the cDNA of two low swede type rapes Shanghai oil 15 seedling RNA are synthetic
(1) TP:
1, the extracting of RNA
(rape RNA extracts buffer formulation: CTAB 3% (W/V) to add 100mL extraction damping fluid; PVP 3% (W/V) (Mw 4000); EDTA 25mM; NaCl 2.0M; Tris-HCl100mM, pH 8.0; Spermidine 0.5g/L; DEPC 0.1% (V/V); The SDS 0.5% (W/V) that 0.1%DEPC handles; The LiCl 10M that 0.1%DEPC handles) to the 50mL PA tube, 65 ℃ of preheatings;
Take by weighing the 5g vegetable material and pour liquid nitrogen into and material is remained freeze and frangible state, grind;
Grind the 50mL centrifuge tube that the back fine powder is transferred to the extraction damping fluid that adds 65 ℃ of preheatings in advance;
Centrifuge tube is put into 65 ℃ of water-bath 45min, and shake once in a while to mix each composition;
Add equal-volume chloroform-primary isoamyl alcohol mixed solution, softly put upside down up and down and mix about 10min;
At 18 ℃, in the centrifugal 10min of 12000g;
Draw supernatant, repeat 5,6 procedure;
Draw supernatant, add the 10M LiCl solution of 1/4 volume, thoroughly mixing is placed 12h for 4 ℃;
At 4 ℃, the centrifugal 30min of 12000g;
The RNA deposition is softly dissolved with 500 μ L 0.5%SDS, with chloroform-primary isoamyl alcohol mixed solution extracting, 4 ℃, the centrifugal 30min of 12000g;
Supernatant is transferred to another new pipe, adds 2 times of volume-20 ℃ ice-cold absolute ethyl alcohols, and thorough mixing is placed on 2h under-20 ℃ of conditions, precipitates total RNA;
12000g, 4 ℃ of centrifugal 30min with 75% ethanol rinsing twice, keep RNA, and vacuum is air-dry;
The deionized water of handling with 200 μ L DEPC dissolves again, and taking a morsel is used for the detection of RNA quality and concentration, and all the other are stored in-70 ℃, and are subsequent use.
2, cDNA is synthetic
Add Oligo (dT) 20 (10pmol/ μ L) 1 μ l; Total RNA:10～100ng; Supply RNase Free H2O to 12 μ L.
65 ℃, behind the 5min, place on ice immediately.
Add 5 * RT Buffer, 4 μ L again; DNTP Mixture (each 10mM) 2 μ L; RNaseInhibitor (10U/ μ L) 1 μ L; ThermoScript II 1 μ L.
The reverse transcription reaction process is: 30 ℃ of 10min; 42 ℃ of 20min; 85 ℃ of 5min; 4 ℃ of 5min.
Moment is centrifugal, preserves.
(2) test-results:
Adopt agarose gel electrophoresis to identify total RNA product, the visible significantly RNA band of result.
Embodiment 2
PCR method obtains the swede type rape AP2/ERF transcription factor gene BnaERF-B3-8 of family gene fragment
(1) TP:
To design a pair of forward and reverse primer, to identify the needs that wait structure in order cloning, the restriction enzyme site of Bam HI and Sac I is introduced at the primer two ends respectively.
PCR reaction system: 10 * PCR buffer, 5.0 μ L; DNTPs (each 2.5mM) 4 μ L; The cDNA template 1 μ L (20ng) of two low swede type rapes Shanghai oil 15; Forward primer 0.5 μ L; Reverse primer 0.5 μ L; Ex-Taq 0.4 μ L (adding after the sex change in advance); Add sterilized water and be settled to 50 μ L.The PCR response procedures: 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 1min, 30 circulations of coamplification, 72 ℃ are extended 10min again.
(2) test-results:
It is the fragment (referring to Fig. 1) of a treaty 600bp that agarose gel electrophoresis through 1.0% detects amplified production.
Embodiment 3
The clone identifies, sequencing
(1) TP:
Amplified fragments adopts the clean biochemical technology of the Hangzhou Wei Te DNA of ltd sepharose to reclaim test kit recovery rear clone and to the pMD-18-Simple T carrier of the precious biotechnology in Dalian ltd, clones evaluation and sequencing.
Through the nucleotide sequencing analysis, finally obtain the transcription factor gene BnaERF-B3-8 of swede type rape AP2/ERF family gene, have base and amino acid sequence information (referring to sequence table) like SEQ ID No 1 and SEQ ID No 2.
(2) test-results:
The sequencing analysis result shows that the transcription factor gene BnaERF-B3-8 of swede type rape AP2/ERF family genes encoding reads frame and be made up of 603bp, is encoded into 200 amino acid whose protein.
Embodiment 4
Arabidopis thaliana transforms
(1) TP:
1. the preparation of Agrobacterium
1) the single bacterium of picking Agrobacterium is inoculated in the 5mL LB liquid nutrient medium (Rifampin 50 μ g/mL, paraxin 100 μ g/mL), 28 ℃, cultivates 20h for 250 rev/mins.
2) get 1mL bacterium liquid and transfer in the 20-30mL LB liquid nutrient medium (Rifampin 50 μ g/mL, paraxin 100 μ g/mL), 28 ℃, cultivate about 12h for 250 rev/mins, survey OD 600 ≈ 1.5.
3) 8000 rev/mins, 4 ℃, the centrifugal collection thalline of 10min is resuspended in Agrobacterium-mediated Transformation penetrating fluid (5% sucrose, 0.05%Silwet L-77) and is diluted to OD 600 ≈ 0.8.
2. Arabidopis thaliana dips in colored method conversion
1) the colored tongue of Arabidopis thaliana is immersed in the penetrating fluid, taken out behind the about 10s of stirring gently, after all conversion finishes, add entry in the pallet, cover Arabidopis thaliana with preservative film, to keep moist environment, 22 ℃ of lucifuges of horizontal positioned are cultivated, and 24h removes preservative film and uprightly cultivates.
2) transform four days for the first time after, can once transform again, repeat twice, total cotransformation three times can transform the bud of the different times of growing on the inflorescence like this, improves transformation efficiency.
3) growth is collected seed approximately after two months, and 4 ℃ of freezer storages are for use.
(2) test-results:
Arabidopis thaliana growth through dipping in colored method conversion is about after two months, the knot of normally blooming.
Embodiment 5
The screening of Arabidopis thaliana seed
(1) TP:
1) title 25-30mg seed is put into the 1.5mL centrifuge tube.
2) 1mL 75% ethanol disinfection 1min (not stopping to rock vibration), 8000 rev/mins of centrifugal 5s remove supernatant.
3) chlorinated lime (5%) the sterilization 15min (not stopping to rock vibration, sufficiently sterilised) after adding 1mL filters, 8000 rev/mins of centrifugal 5s remove supernatant.
4) the sterilized water washing is 3-4 time.
5) seed is sowed on the 1/2MS dull and stereotyped (Totomycin 50 μ g/mL) uniformly, the Parafilm film seals, and 4 ℃ of refrigerators were placed two days, and 22 ℃, 16h illumination cultivation 6 days.
6) resistant plant is transplanted in the basin cultivates, after seedling is big slightly, carry out that GUS is active to be detected, select positive plant (T
0) be cultured to and blossom and bear fruit, collect T
0The T that ties on the plant
1Seed.
Embodiment 6
Transcription factor gene BnaERF-B3-8 transforms the degeneration-resistant analysis behind the plant
Seedling was positioned over-20 ℃ of freezing treatment 50 minutes after around the growth of seedling,, recovers to take pictures after one week of growth after 24 hours in-4 ℃ of recoveries then in the illumination cultivation chamber.
The result shows: wild-type with change the swede type rape AP2/ERF transcription factor gene BnaERF-B3-8 of family Arabidopis thaliana plant and on seedling phase anti-freezing property, evident difference arranged, transfer-gen plant is than wild-type Arabidopis thaliana freezing tolerance be significantly improved (referring to Fig. 2).
Should be noted that at last; Above embodiment is only unrestricted in order to technical scheme of the present invention to be described; Although with reference to preferred embodiment the present invention is specified, those of ordinary skill in the art should be appreciated that and can make amendment or be equal to replacement the technical scheme of invention; And not breaking away from the spirit and the scope of technical scheme of the present invention, it all should be encompassed in the claim scope of the present invention.
Sequence table
< 110>Academy of Agricultural Sciences, Shanghai City
< 120>a kind of swede type rape AP2/ERF family transcription factor gene
<160>2
<170>PatentIn?version?3.3
<210>SEQ?ID?No?1
<211>603
<212>DNA
< 213>swede type rape (Brassica napus)
<400>
1 ATGGCAACTATTGAGGAAATCTCTGATTTGGAGAAGCATCTCTTTGAAGACTTGATGATC
61 CCTGATGGTTTCATGGAAGATTTTGTCTTTGATGACGCTGCTTTTTTCTCAGGACTCTGG
121 TCTCTAGAACCCTTAAACCAAGTTCCTAAACAGGAGCCTAGTTCACCGGCTCTTGATCCA
181 GATTTCTATGTCCAAGAGTTTCTGCAAATGGAAGCAGAATCATCATCATCAACAACAACA
241 ACAACTACAACTACAACATCACCTGAGGTTGAAACTGTCTCAAACCGGAAAAGATCAAAG
301 AGAGCTGAAGAGACAAGGCATTACAGAGGCGTGAGAAGGAGGCCATGGGGAAAATTCGCA
361 GCAGAGATTCGAGATCCGGCGAAGAAAGGATCAAGGATTTGGCTAGGCACTTTTGAGAGT
421 GATATTGATGCTGCAAGAGCTTATGACCATGAAGCTTTTAAGCTCGGGGGAAGAAAAGCT
481 GTGCTCAACTTTCCTTTGGACGCAGGAAAGTATGATGCTCCGGTCAATTCTTGCCGGAAG
541 AGGAGAAGAAACGATGTGCCGGAGCCTCAAGGAACAACTACGAGCAATTCATCATCAAAC
601 TGA
<210>SEQ?ID?No?2
<211>200
<212>PRT
< 213>swede type rape (Brassica napus)
<400>
1 M A T I E E I S D L E K H L F E D L M I
21 P D G F M E D F V F D D A A F F S G L W
41 S L E P L N Q V P K Q E P S S P A L D P
61 D F Y V Q E F L Q M E A E S S S S T T T
81 T T T T T T S P E V E T V S N R K R S K
101 R A E E T R H Y R G V R R R P W G K F A
121 A E I R D P A K K G S R I W L G T F E S
141 D I D A A R A Y D H E A F K L G G R K A
161 V L N F P L D A G K Y D A P V N S C R K
181 R R R N D V P E P Q G T T T S N S S S N
Claims (5)
1. a swede type rape AP2/ERF family transcription factor gene is characterized in that the base sequence of said transcription factor gene is shown in SEQ ID No 1.
2. swede type rape AP2/ERF as claimed in claim 1 family transcription factor gene is characterized in that the aminoacid sequence of said transcription factor gene encoded protein matter is shown in SEQ ID No 2.
3. method for preparing the described rape AP2/ERF of claim 1 family transcription factor gene may further comprise the steps:
1) structure in rape cDNA library: choosing the rape seedling and extract total RNA, is that template, Oligo (dT) are primer with total RNA, synthetic cDNA under the effect of AMV ThermoScript II;
2) design a pair of primer: forward primer GGATCCATGGCAACTA TTGAGGAAAT C, reverse primer GAGCTCTCAGAATTCGTTTGATGATGAATTGC; With above-mentioned cDNA is that template is carried out pcr amplification, obtains rape AP2/ERF family transcription factor gene fragment;
3) above-mentioned amplified fragments is reclaimed rear clone and go into the T carrier, promptly obtain rape AP2/ERF family transcription factor gene after the order-checking.
4. the application of the described swede type rape AP2/ERF of claim 1 family transcription factor gene in the anti-low temperature transgenic plant of preparation.
5. the application of the described swede type rape AP2/ERF of claim 1 family transcription factor gene in Plant Transformation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910201013A CN102094025B (en) | 2009-12-11 | 2009-12-11 | Brassica napus AP2/ERF family transcription factor gene and preparation method thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910201013A CN102094025B (en) | 2009-12-11 | 2009-12-11 | Brassica napus AP2/ERF family transcription factor gene and preparation method thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102094025A CN102094025A (en) | 2011-06-15 |
| CN102094025B true CN102094025B (en) | 2012-08-29 |
Family
ID=44127293
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910201013A Expired - Fee Related CN102094025B (en) | 2009-12-11 | 2009-12-11 | Brassica napus AP2/ERF family transcription factor gene and preparation method thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102094025B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160516B (en) * | 2013-03-08 | 2014-04-02 | 中国农业科学院油料作物研究所 | Rape stress resistance gene and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100430415C (en) * | 2005-09-21 | 2008-11-05 | 中国农业科学院作物科学研究所 | Thinopyrum intermedium ERF-transcription factor and its coding gene and use |
-
2009
- 2009-12-11 CN CN200910201013A patent/CN102094025B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100430415C (en) * | 2005-09-21 | 2008-11-05 | 中国农业科学院作物科学研究所 | Thinopyrum intermedium ERF-transcription factor and its coding gene and use |
Non-Patent Citations (3)
| Title |
|---|
| 庄静等.一个小麦AP2 /ERF 转录因子家族单独亚族基因的克隆及分.《麦类作物学报》.2009,第29卷(第5期),752-753. * |
| 庄静等.油菜AP2 /ERF家族转录因子的分离及其生物学功能.《中国油料作物学报》.2009,第31卷(第3期),391-400. * |
| 庄静等.油菜沪油15 中AP2/ERF-B3 亚族转录因子的克隆和生物信息学分析.《分子细胞生物学学报》.2008,第41卷(第3期),192-206. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102094025A (en) | 2011-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102776203B (en) | Cold resistant transcription factor PtrICE1 gene of trifoliate orange and application thereof in cold resistant improvement of plant | |
| CN110004156A (en) | GhCML20 gene relevant to resistance to verticillium wilt and its application | |
| CN101736012B (en) | Stress resistance ERF transcription factor gene derived from Brassica napus | |
| CN102094005B (en) | Antifreeze transcription factor derived from common wheat AP2/ERF family and preparation method and application thereof | |
| CN104818284A (en) | Application of stress-resistant gene AtGST of Arabidopis thaliana to improvement of stress resistance of plants | |
| CN114606245A (en) | Tea tree CsVAAT3 gene and application thereof | |
| CN101338315B (en) | Gene for enhancing draught-resistance of plant and its uses | |
| CN106749577B (en) | Stress tolerance associated transcription factor protein NAC and application thereof | |
| CN113403325A (en) | Tea tree orphan gene CsOG3 and application thereof in improving cold resistance of tea trees | |
| CN110592100B (en) | Cassava CAMTA gene and construction and disease-resistant application of suppression expression vector thereof | |
| CN102094025B (en) | Brassica napus AP2/ERF family transcription factor gene and preparation method thereof and application thereof | |
| CN104046639A (en) | Wheat methionine sulfoxide reductase gene TaMsrB3.1 and application thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN102630512A (en) | Method for improving abiotic stress resistance of plants to disease sources, drought and high salinity | |
| CN103243108B (en) | Calcium ion binding protein derived from stem nodule as well as encoding gene and application thereof | |
| CN103667315A (en) | Salt-tolerant and drought-resistant gene TaDHN1 of wheat, recombinant plasmid and application | |
| CN104450734B (en) | Cucumber CsMADS03 gene overexpressions carrier and its application | |
| CN102586269A (en) | Ammopiptanthus mongolicus cold resistant gene AmGS | |
| CN104450749A (en) | Flower-specific expression vector of cucumber CsLOX1 gene and application of flower-specific expression vector | |
| TWI624544B (en) | A process for increasing growth of hydroponic grown plants under salt stress | |
| CN101736010A (en) | Stress resistance NAC transcription factor gene derived from loosehead Chinese cabbage | |
| CN104450736A (en) | Cucumber AG-like gene CsMADS24 overexpression carrier and application thereof | |
| CN104480116B (en) | Cucumber CsMADS23 gene overexpressions carrier and its application | |
| CN105566466B (en) | Spartina alterniflora salt-tolerant protein HKT and coding gene and application thereof | |
| CN101851634B (en) | Method for improving plant drought resisting cold resisting capability by utilizing poncirus trifoliata argininedecarboxylase gene PtADC |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120829 Termination date: 20141211 |
|
| EXPY | Termination of patent right or utility model |