CN102094020B - RNA (Ribose Nucleic Acid) interference sequence and recombined interference plasmid for inhibiting fucosyltransferase I synthesized by LeY carbohydrate antigens - Google Patents

Abstract

The invention relates to an RNA (Ribose Nucleic Acid) interference sequence and a recombined interference plasmid for inhibiting a fucosyltransferase I synthesized by LeY carbohydrate antigens. The invention manly has the technical scheme that DNA sequences of respective 7 FUT1/FUT4 SiRNA templates of a fucosyltransferase I and a fucosyltransferase IV are designed and screened; recombined interference plasmids of the 7 FUT1 and the 7 FUT4 are constructed respectively on the basis of polyclone specific enzyme cutting sites of RNA interference vectors (pSilencer-4.1-CMVneo); and the recombined interference plasmids are used as anti-tumor drugs. The recombined interference plasmids have obvious tumor growth inhibiting effect; and in addition, the invention is an efficient, safe and economic tumor gene therapy mode.

Description

Be used to suppress the RNA interference sequence and the reorganization interfere plasmid of LeY CA synthetic fucosyl transferase I

The application is < the RNA interference sequence and the reorganization interfere plasmid that are used to suppress LeY CA synthetic fucosyl transferase I and IV>application number 200710010099.3,2007 the 01 month applying date, 15 days divide an application.

Technical field

The present invention relates to a kind of special dna sequence dna and according to the reorganization interfere plasmid of this sequence construct.

Background technology

Malignant tumour is a kind of disease of comparatively refractory, does not still have the ideal treat-ment.At present, mainly be to take comprehensive means such as surgical operation, radiotherapy and chemotherapy to the tumor treatment strategy, but each method still have limitation and can produce toxic side effect to a certain degree.

Summary of the invention

The object of the present invention is to provide a kind of according to the tomour specific CA synthetic and tumor growth, infiltration, transfer equimolecular mechanism constructed, the RNA that is used to suppress LeY tumour oligosaccharides antigen synthetic fucosyl transferase I and IV interferes sequence and the interfere plasmid of recombinating.The present invention mainly is: using the technological special CA with tumour of RNAi (RNAi, RNA interference) is target site, and it is antigenic synthetic to suppress cell surface Lewis Y (LeY) tumour oligosaccharides.The LeY molecular structure is Fuc α 1 → 2Ga1 β → 4 (Fuc α 1 → 3) GlcNAc); Promptly through designing and synthesizing antigenic key enzyme fucosyl transferase I (the Fucosyltransferase I of LeY tumour oligosaccharides; Be called for short FUT1) and fucosyl transferase I V (FucosyltransferaseIV; Abbreviation FUT4) the interference sequence of gene; And adopt the molecular cloning recombinant technology to make up reorganization FUT1 interfere plasmid (pSilencer-4.1-FUT1SiRNA) and reorganization FUT4 interfere plasmid (pSilencer-4.1-FUT4SiRNA), be used for antitumor drug and use.

Technical scheme of the present invention is following:

1. design and synthesize the interference sequence of FUT1 and FUT4 gene

Application of DNA STAR software analysis the homologous sequence of whole people's FUT1/FUT4 gene among the GenBank; The total length of the encoding sequence of FUT1/FUT4 gene is respectively 1098bp and 1218bp; The dna profiling sequence of the interfere plasmid of the reorganization FUT1/FUT4 that is used for neoplasm growth that obtains from the SiRNA design software is respectively chosen 7 as forming the template DNA sequences of interfering sequences, and length is 19bp.The interference sequence of the FUT1 gene that wherein, is designed is: FUT1-1:TGGCCGGTTTGGTAATCAG; FUT1-2:AGACTTTGCCCTGCTCACA; FUT1-3:GAGGAGTACGCGGACTTGA; FUT1-4:CAGATCCGCAGAGAGTTCA; FUT1-5:CGGCATGGAGTGGTGTAAA; FUT1-6:TGGCCTTCCTGCTAGTCTG; FUT1-7:TTCGCCTTTCCTCCCCTGC.The position of these sequences in the FUT1 gene is as shown in Figure 1.The interference sequence of the FUT4 gene that is designed is: FUT4-1:GCCTGGCAAGTAACCTCTT; FUT4-2:GTAACCTCTTCAACTGGAC; FUT4-3:CGGACGTCTTTGTGCCTTA; FUT4-4:CATGTGACCGTGGACGTGT; FUT4-5:GTTCTACCTGGCTTTCGAG; FUT4-6:CTCGTACCTGCTTTTCCTC; FUT4-7:GCGGAGGCAGCGCTGCCTG.The position of these sequences in the FUT4 gene is as shown in Figure 2.

2. make up reorganization FUT1 interfere plasmid and make up reorganization FUT4 interfere plasmid

1. obtain to be used for the dna profiling sequence of interfere plasmid of the reorganization FUT1/FUT4 of neoplasm growth according to the SiRNA design software, it is the structure that carries out interfere plasmid with the sequence of the control region of above-mentioned FUT1/FUT4 gene and coding region.

2. according to pSilencer-4.1-CMV-neo (Ambion; Inc) the dna profiling sequence of the FUT1/FUT4 interfere plasmid of carrier is inserted in the design of carrier structure information; Promptly the polyclone restriction enzyme site (HindIII, BamHI) with interference vector is the basis; Design the dna sequence dna that the FUT1/FUT4SiRNA template of identical sticky end is arranged with interference vector, make up 7 FUT1 interfere plasmids respectively: pSilencer-4.1-FUT1-1/FUT1-2/FUT1-3/FUT1-4/FUT1-5/FUT1-6/ FUT1-7; The interfere plasmid of 7 FUT4: pSilencer-4.1-FUT4-1/FUT4-2/FUT4-3/FUT4-4/FUT4-5/FUT4-6/ FUT4-7.The 5` end of every chain contains the restriction enzyme site (underscore marks) of HindIII or BamHI.Concrete sequence is following:

FUT1-1(5’-3’)

GATCCTGGCCGGTTTGGTAATCAGTTCAAGAGACTGATTACCAAACCGGCCAGGA

AGCTTCCTGGCCGGTTTGGTAATCAGTCTCTTGAACTGATTACCAAACCGGCCAG

FUT1-2(5’-3’)

GATCCAGACTTTGCCCTGCTCACATTCAAGAGATGTGAGCAGGGCAAAGTCTGGA

AGCTTCCAGACTTTGCCCTGCTCACATCTCTTGAATGTGAGCAGGGCAAAGTCTG

FUT1-3(5’-3’)

GATCCGAGGAGTACGCGGACTTGATTCAAGAGATCAAGTCCGCGTACTCCTCGGA

AGCTTCCGAGGAGTACGCGGACTTGATCTCTTGAATCAAGTCCGCGTACTCCTCG

FUT1-4(5’-3’)

GATCCCAGATCCGCAGAGAGTTCATTCAAGAGATGAACTCTCTGCGGATCTGGGA

AGCTTCCCAGATCCGCAGAGAGTTCATCTCTTGAATGAACTCTCTGCGGATCTGG

FUT1-5(5’-3’)

GATCCCGGCATGGAGTGGTGTAAATTCAAGAGATTTACACCACTCCATGCCGGGA

AGCTTCCCGGCATGGAGTGGTGTAAATCTCTTGAATTTACACCACTCCATGCCGG

FUT1-6(5’-3’)

GATCCTGGCCTTCCTGCTAGTCTGTTCAAGAGACAGACTAGCAGGAAGGCCAGGA

AGCTTCCTGGCCTTCCTGCTAGTCTGTCTCTTGAACAGACTAGCAGGAAGGCCAG

FUT1-7(5’-3’)

GATCCTTCGCCTTTCCTCCCCTGCTTCAAGAGAGCAGGGGAGGAAAGGCGAAGGA

AGCTTCCTTCGCCTTTCCTCCCCTGCTCTCTTGAAGCAGGGGAGGAAAGGCGAAG

FUT4-1(5’-3’)

GATCCGCCTGGCAAGTAACCTCTTCTCAAGAGAAAGAGGTTACTTGCCAGGCGGA

AGCTTCCAGCCTGGCAAGTAACCTCTTTCTCTTGAGAAGAGGTTACTTGCCAGGCG

FUT4-2(5`-3`)

GATCCGTAACCTCTTCAACTGGACTTCAAGAGAGTCCAGTTGAAGAGGTTACGGA

AGCTTCCGTAACCTCTTCAACTGGACTCTCTTGAAGTCCAGTTGAAGAGGTTACG

FUT4-3(5’-3’)

GATCCCGGACGTCTTTGTGCCTTATTCAAGAGATAAGGCACAAAGACGTCCGGGA

AGCTTCCCGGACGTCTTTGTGCCTTATCTCTTGAATAAGGCACAAAGACGTCCGG

FUT4-4(5’-3’)

GATCCCATGTGACCGTGGACGTGTTTCAAGAGAACACGTCCACGGTCACATGGGA

AGCTTCCCATGTGACCGTGGACGTGTTCTCTTGAAACACGTCCACGGTCACATGG

FUT4-5(5’-3’)

GATCCGTTCTACCTGGCTTTCGAGTTCAAGAGACTCGAAAGCCAGGTAGAACGGA

AGCTTCCGTTCTACCTGGCTTTCGAGTCTCTTGAACTCGAAAGCCAGGTAGAACG

FUT4-6(5’-3’)

GATCCCTCGTACCTGCTTTTCCTCTTCAAGAGAGAGGAAAAGCAGGTACGAGGGA

AGCTTCCCTCGTACCTGCTTTTCCTCTCTCTTGAAGAGGAAAAGCAGGTACGAGG

FUT4-7(5’-3’)

GATCCGCGGAGGCAGCGCTGCCTGTTCAAGAGACAGGCAGCGCTGCCTCCGCGGA

AGCTTCCGCGGAGGCAGCGCTGCCTGTCTCTTGAACAGGCAGCGCTGCCTCCGCG

3. after the special sequence synthetic (Takara company), form the double chain DNA sequence of the SiRNA template of 55bp (containing sticky end HindIII, BamHI) through sex change, annealing.Concrete grammar is: two chains of template DNA sequence that synthetic are used to disturb the SiRNA of FUT1/FUT4 gene; Use the dissolving of 10-100 μ l deionized water or TE (Tris-HCl EDTA) damping fluid respectively; And the light absorption value of mensuration 260nm, calculate its DNA concentration.With deionized water or TE dilution (10-500ng/ μ l).The strand sample of drawing dilution adds the DNA annealing buffer, and (contain 10mM Tris (pH7.4), 50mM NaCl 1mMEDTA) in 90-98 ℃ of sex change 3-10 minute, is cooled to 37 ℃ and kept 1 hour, preserves this annealing product in-20 ℃ of temperature, and is subsequent use.

4. pSilencer-4.1-FUT1/FUT4SiRNA construction of recombinant plasmid

Get pSilencer-4.1-CMV-neo (10-500ng) and carried out HindIII and BamHI double digestion 1-3 hour in 37 ℃, enzyme is cut the back purified product and is connected with the product of annealing.Ligation is following: get 1-20 μ l annealing product, 1-20 μ l carrier enzyme and cut back purified product, 1-20 μ l ligase enzyme, 1-20 μ l and connect damping fluid, add at last deionized water to 10-200 μ l in 16 ℃ of connections of spending the night.Connect product and transform DH5 α intestinal bacteria, utilize amicillin resistance label screening positive colony, enzyme was cut evaluation after a small amount of was extracted plasmid, like Fig. 3 and Fig. 4.With identifying that correct clone's carries out large quantity extracting plasmid.

Research shows: the unusual synthetic major cause that is malignant tumour propagation, soaks into, shifts of tumour CA, and be one of important symbol of its vicious transformation.Special tumour CA synthetic is by the specificity decision of glycosyltransferase, and the synthetic level of CA is relevant with the expression regulation of glycosyltransferase gene.FUT1/FUT4 is the key enzyme of synthetic LeY tumour oligosaccharides.FUT1 is α 1, and the fucosylated glycosyltransferase of 2-(α 1,2-FUT), and synthetic relevant with terminal α 1,2 fucosido of LeY tumour oligosaccharides antigen, catalyzed synthesizing alpha 1,2-Fucose glycosidic bond; And FUT4 is α 1, and the fucosylated glycosyltransferase of 3-(α 1,3-FUT), and catalyzed synthesizing alpha 1,3-Fucose glycosidic bond.LeY tumour oligosaccharides antigen is the sugar chain composition in the cell surface saccharide complex (gp, glycolipid and proteoglycan); Have been found that its resulting anomaly in kinds of tumors increases, closely related with tumor proliferation, infiltration, transfer, clinical stages (classification) and prognosis.Therefore, will be effective target spot to reduce the antigenic resultant quantity of LeY tumour oligosaccharides through downward modulation FUT1 and FUT4 expression level, the research of this aspect does not appear in the newspapers at present both at home and abroad as yet.The present invention utilizes the RNA interference technique, makes up reorganization FUT1 and FUT4 interfere plasmid, and through suppressing the synthetic and expression of the special fucosyltransferase of tumour cell, it is antigenic synthetic to reduce LeY tumour oligosaccharides, and then suppresses growth of tumor, infiltration and transfer.

The present invention compares prior art and has following advantage: adopt the present invention to make up the FUT1 of reorganization and target gene therapy that the FUT interfere plasmid is clinical tumor provides new thinking and means; Not only effect is obvious but also toxic side effect is little for it, safety; Patient treatment cycle weak point is a kind of efficient, safe, economic antitumor pattern simultaneously.

Description of drawings

Fig. 1 is the site plan of dna profiling sequence on gene of the interfere plasmid of FUT1 gene of the present invention.

Fig. 2 is the site plan of dna profiling sequence on gene of the interfere plasmid of FUT4 gene of the present invention.

Fig. 3 is that the interfere plasmid enzyme of FUT1 gene of the present invention is cut identification and analysis figure.

Fig. 4 is that the interfere plasmid enzyme of FUT4 gene of the present invention is cut identification and analysis figure.

Fig. 5 is a FUT1 Gene RT-PCR analysis behind the interfere plasmid transfection A431 tumour cell of the present invention.

Fig. 6 is a FUT4 Gene RT-PCR analysis behind the interfere plasmid transfection A431 tumour cell of the present invention.

Fig. 7 is that LeY resultant quantity fluidic cell detects figure behind FUT1 interfere plasmid of the present invention (FUT1-1 and FUT1-2) the transfection A431 tumour cell.

Fig. 8 is that LeY resultant quantity fluidic cell detects figure behind FUT4 interfere plasmid of the present invention (FUT4-1 and FUT4-2) the transfection A431 tumour cell.

Fig. 9 is the inhibiting figure of FUT1 interfere plasmid of the present invention (FUT1-1 and FUT1-2) transfection A431 growth of tumour cell.

Figure 10 is the inhibiting figure of FUT4 interfere plasmid of the present invention (FUT4-1 and FUT4-2) transfection A431 growth of tumour cell.

Figure 11 is the figures of the different interfere plasmids of FUT1 of the present invention to the effect of PCNA (PCNA) expression inhibiting.

Figure 12 is the inhibiting figure that the different interfere plasmids of FUT4 of the present invention are expressed PCNA (PCNA).

Figure 13 is that the present invention influences the analysis that the mouse tumor volume is respectively organized in experimentation on animals.

Figure 14 is that the present invention influences the analysis that mouse tumor weight is respectively organized in experimentation on animals.

Embodiment

Example 1 makes up reorganization FUT1 interfere plasmid

1. obtain to be used for the dna profiling sequence of the reorganization FUT1 interfere plasmid of neoplasm growth according to the SiRNA design software, it is the structure that carries out interfere plasmid with the sequence of the control region of above-mentioned FUT1 gene and coding region.The 5` end of every chain contains the restriction enzyme site (underscore marks) of HindIII or BamHI.Specific as follows:

FUT1-1(5’-3’)

GATCCTGGCCGGTTTGGTAATCAGTTCAAGAGACTGATTACCAAACCGGCCAGGA

AGCTTCCTGGCCGGTTTGGTAATCAGTCTCTTGAACTGATTACCAAACCGGCCAG

FUT1-2(5’-3’)

GATCCAGACTTTGCCCTGCTCACATTCAAGAGATGTGAGCAGGGCAAAGTCTGGA

AGCTTCCAGACTTTGCCCTGCTCACATCTCTTGAATGTGAGCAGGGCAAAGTCTG

2. insert the dna profiling sequence of the FUT1 interfere plasmid of carrier according to the design of pSilencer-4.1-CMV-neo carrier structure information; Promptly the polyclone restriction enzyme site (HindIII, BamH I) with interference vector is the basis; Design the dna sequence dna that the FUT1SiRNA template of identical sticky end is arranged with interference vector, make up the interfere plasmid of pSilencer-4.1-FUT1-1 and pSilencer-4.1-FUT1-2 respectively.

3. after the special sequence synthetic (Takara company), form the double chain DNA sequence of the SiRNA template of 55bp (containing sticky end HindIII, BamH I) through sex change, annealing.Synthetic is used to disturb two chains of template DNA sequence of the SiRNA of FUT1 gene, uses 100 μ l deionized water dissolvings respectively, get 1 μ l deionized water by 1: 10 volume ratio dilution; Measure the light absorption value of 260nm, calculate its DNA concentration (about 33 μ g/ml), be diluted to 80ng/ μ l with deionized water; Drawing every chain 10 μ l adds 100 μ l, 1 * DNA annealing buffer and (contains 10mM Tris (pH7.4); 50mM NaCl, 1mM EDTA), is cooled to 37 ℃ and kept 1 hour in 98 ℃ of sex change 3 minutes; Preserve this annealing product in-20 ℃ of temperature, subsequent use.

4. pSilencer-4.1-FUT1 reorganization interfere plasmid makes up

PSilencer-4.1-CMV-neo (90ng) was carried out HindIII and BamHI double digestion 2 hours in 37 ℃; Enzyme is cut back recovery product and is connected with the annealing product; Ligation is following: get 2 μ l annealing product, 2 μ l carrier enzymes and cut back purifying and recovering product, 2 μ l ligase enzymes, 2 μ l and connect damping fluid, add 2 μ l deionized water to 10 μ l at last in 16 ℃ of connections of spending the night.Connect product and transform DH5 α intestinal bacteria, utilize penbritin (Amp) resistance screening positive colony, enzyme was cut evaluation after a small amount of was extracted plasmid.With identifying the correct sub-large quantity extracting plasmid of clone.

Example 2 makes up reorganization FUT4 interfere plasmid

1. obtain to be used for the dna profiling sequence of the reorganization FUT4 interfere plasmid of neoplasm growth according to the SiRNA design software, it is the structure that carries out interfere plasmid with the sequence of the control region of above-mentioned FUT4 gene and coding region.The 5` end of every chain contains the restriction enzyme site (underscore marks) of HindIII or BamH I.Specific as follows:

FUT4-1(5’-3’)

GATCCGCCTGGCAAGTAACCTCTTCTCAAGAGAAAGAGGTTACTTGCCAGGCGGA

AGCTTCCAGCCTGGCAAGTAACCTCTTTCTCTTGAGAAGAGGTTACTTGCCAGGCG

FUT4-2(5`-3`)

GATCCGTAACCTCTTCAACTGGACTTCAAGAGAGTCCAGTTGAAGAGGTTACGGA

AGCTTCCGTAACCTCTTCAACTGGACTCTCTTGAAGTCCAGTTGAAGAGGTTACG

2. insert the dna profiling sequence of the FUT4 interfere plasmid of carrier according to the design of pSilencer-4.1-CMV-neo carrier structure information; Promptly the polyclone restriction enzyme site (HindIII, BamHI) with interference vector is the basis; Design the dna sequence dna that the FUT4SiRNA template of identical sticky end is arranged with interference vector, make up the interfere plasmid of pSilencer-4.1-FUT4-1 and pSilencer-4.1-FUT4-2 respectively.

3. after the special sequence synthetic (Takara company), form the double chain DNA sequence of the SiRNA template of 55bp (containing sticky end HindIII, BamH I) through sex change, annealing.Synthetic is used to disturb two chains of template DNA sequence of the SiRNA of FUT4 gene, uses 50 μ l deionized water dissolvings respectively, get 0.5 μ l deionized water by 1: 10 volume ratio dilution; Measure the light absorption value of 260nm, calculate its DNA concentration, be diluted to 100ng/ μ l with deionized water; Drawing every chain 10 μ l adds 46 μ l, 1 * DNA annealing buffer and (contains 10mM Tris (pH7.4); 50mM NaCl, 1mM EDTA), is cooled to 37 ℃ and kept 1 hour in 90 ℃ of sex change 10 minutes; Preserve this annealing product in-20 ℃ of temperature, subsequent use.

4. pSilencer-4.1-FUT4SiRNA reorganization interfere plasmid makes up

PSilencer-4.1-CMV-neo (300ng) was carried out HindIII and BamHI double digestion 3 hours in 37 ℃; Enzyme is cut back recovery product and is connected with the annealing product; Ligation is following: get 5 μ l annealing product, 5 μ l carrier enzymes and cut the back and reclaim product, 5 μ l ligase enzymes, 5 μ l and connect damping fluid, add de-ionized to 50 μ l at last in 16 ℃ of connections of spending the night.Connect product and transform DH5 α intestinal bacteria, utilize penbritin (Amp) resistance marker screening positive clone, enzyme was cut evaluation after a small amount of was extracted plasmid.With identifying the correct sub-large quantity extracting plasmid of clone.

Below be detected result of the present invention:

1.pSilencer-4.1-FUT1/FUT4SiRNA recombinant plasmid transfection A431 tumour cell, the cell FUT1/FUT4 that adopts RT-PCR to detect discovery transfection recombinant plasmid expresses obviously and descends, like Fig. 5 and shown in Figure 6.

2.pSilencer-4.1-FUT1/FUT4SiRNA behind the recombinant plasmid transfection A431 tumour cell, adopt Flow Cytometry to detect and find that the synthetic of LeY significantly reduces, like Fig. 7 and shown in Figure 8.

3.pSilencer-4.1-FUT1/FUT4SiRNA recombinant plasmid transfection A431 tumour cell detects the cell growth that shows the transfection recombinant plasmid through tetrazolium bromide (MTT) colourimetry and significantly reduces, like Fig. 9 and shown in Figure 10.

4.pSilencer-4.1-FUT1/FUT4SiRNA recombinant plasmid transfection A431 tumour cell adopts the expression amount of Western blot scientific discovery PCNA obviously to reduce, like Figure 11 and shown in Figure 12.

5.pSilencer-4.1-FUT1-1/FUT4-1 recombinant plasmid suppresses tumor growth effect in the animal model

(1) with trysinization A431 tumour cell, centrifugal collecting cell prepares cell suspension with saline water, and counts with trypan blue method pair cell, makes that to contain the A431 number of cells in every 0.1ml saline water be 2 * 10 ⁶Get the 4-6 nude mice (n=6～8) in age in week, every the right armpit skin of mouse injected 0.1ml tumour cell suspension.Control group equivalent injecting normal saline.

(2) experiment is divided into four groups: blank control group, empty carrier group, FUT1-1 interfere plasmid group and FUT4-1 interfere plasmid group.Injection A431 tumour cell suspension next day, whenever injected interfere plasmid (g/ time/mouse of 150 μ), totally 10 times at a distance from 1 day.(3) every day observation experiment group and control group mouse growth conditions, plantation tumour size variation, and weigh.Therapy lasted was put to death nude mice after 22 days, and measured knurl volume (table 1) and measure tumor weight (table 2).

The analysis of knurl volume is respectively organized in table 1 experiment

Annotate: * * representes P＜0.01, and difference is extremely remarkable.

Figure 13 is seen in the comparative analysis of the knurl volume of experimental group and control group.

The analysis of tumor weight is respectively organized in table 2 experiment

Annotate: * * representes (P＜0.01), and difference is extremely remarkable.

Figure 14 is seen in the comparative analysis of the tumor weight of experimental group and control group.

Tumour inhibiting rate=(the average knurl of the average knurl weight-experimental group of control group is heavy)/average knurl of control group heavy * 100%

Obtaining FUT1-1 plasmid group tumour inhibiting rate thus is 52.8%, with the poor heteropole of control group remarkable (P＜0.01); FUT4-1 plasmid group tumour inhibiting rate is 45.0%, with the poor heteropole of control group remarkable (P＜0.01).

SEQUENCE?LISTING

< 110>swallow, the autumn

< 120>be used to suppress the RNA interference sequence of LeY CA synthetic fucosyl transferase I and recombinate and interfere

<130>201010108936.8

<140>201010108936.8

<141>2010-01-27

<160>28

<170>PatentIn?version?3.3

<210>1

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>1

tggccggttt?ggtaatcag 19

<210>2

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>2

agactttgcc?ctgctcaca 19

<210>3

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>3

gaggagtacg?cggacttga 19

<210>4

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>4

cagatccgca?gagagttca 19

<210>5

<21>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>5

cggcatggag?tggtgtaaa 19

<210>6

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>6

tggccttcct?gctagtctg 19

<210>7

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>7

ttcgcctttc?ctcccctgc 19

<210>8

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>8

gcctggcaag?taacctctt 19

<210>9

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>9

gtaacctctt?caactggac 19

<210>10

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>10

cggacgtctt?tgtgcctta 19

<210>11

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>11

catgtgaccg?tggacgtgt 19

<210>12

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>12

gttctacctg?gctttcgag 19

<210>13

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>13

ctcgtacctg?cttttcctc 19

<210>14

<211>19

<212>DNA

<213>human

<220>

<221>iDNA

<222>(1)..(19)

<400>14

gcggaggcag?cgctgcctg 19

<210>15

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>15

gatcctggcc?ggtttggtaa?tcagttcaag?agactgatta?ccaaaccggc?caggaagctt 60

cctggccggt?ttggtaatca?gtctcttgaa?ctgattacca?aaccggccag 110

<210>16

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>16

gatccagact?ttgccctgct?cacattcaag?agatgtgagc?agggcaaagt?ctggaagctt 60

ccagactttg?ccctgctcac?atctcttgaa?tgtgagcagg?gcaaagtctg 110

<210>17

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>17

gatccgagga?gtacgcggac?ttgattcaag?agatcaagtc?cgcgtactcc?tcggaagctt 60

ccgaggagta?cgcggacttg?atctcttgaa?tcaagtccgc?gtactcctcg 110

<210>18

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>18

gatcccagat?ccgcagagag?ttcattcaag?agatgaactc?tctgcggatc?tgggaagctt 60

cccagatccg?cagagagttc?atctcttgaa?tgaactctct?gcggatctgg 110

<210>19

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>19

gatcccggca?tggagtggtg?taaattcaag?agatttacac?cactccatgc?cgggaagctt 60

cccggcatgg?agtggtgtaa?atctcttgaa?tttacaccac?tccatgccgg 110

<210>20

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>20

gatcctggcc?ttcctgctag?tctgttcaag?agacagacta?gcaggaaggc?caggaagctt 60

cctggccttc?ctgctagtct?gtctcttgaa?cagactagca?ggaaggccag 110

<210>21

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>21

gatccttcgc?ctttcctccc?ctgcttcaag?agagcagggg?aggaaaggcg?aaggaagctt 60

ccttcgcctt?tcctcccctg?ctctcttgaa?gcaggggagg?aaaggcgaag 110

<210>22

<211>111

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>22

gatccgcctg?gcaagtaacc?tcttctcaag?agaaagaggt?tacttgccag?gcggaagctt 60

ccagcctggc?aagtaacctc?tttctcttga?gaagaggtta?cttgccaggc?g 111

<210>23

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>23

gatccgtaac?ctcttcaact?ggacttcaag?agagtccagt?tgaagaggtt?acggaagctt 60

ccgtaacctc?ttcaactgga?ctctcttgaa?gtccagttga?agaggttacg 110

<210>24

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>24

gatcccggac?gtctttgtgc?cttattcaag?agataaggca?caaagacgtc?cgggaagctt 60

cccggacgtc?tttgtgcctt?atctcttgaa?taaggcacaa?agacgtccgg 110

<210>25

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>25

gatcccatgt?gaccgtggac?gtgtttcaag?agaacacgtc?cacggtcaca?tgggaagctt 60

cccatgtgac?cgtggacgtg?ttctcttgaa?acacgtccac?ggtcacatgg 110

<210>26

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>26

gatccgttct?acctggcttt?cgagttcaag?agactcgaaa?gccaggtaga?acggaagctt 60

ccgttctacc?tggctttcga?gtctcttgaa?ctcgaaagcc?aggtagaacg 110

<210>27

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>27

gatccctcgt?acctgctttt?cctcttcaag?agagaggaaa?agcaggtacg?agggaagctt 60

ccctcgtacc?tgcttttcct?ctctcttgaa?gaggaaaagc?aggtacgagg 110

<210>28

<211>110

<212>DNA

<213>human

<220>

<221>iDNA

<222>(6)..(23)

<220>

<221>iDNA

<222>(63)..(81)

<400>28

gatccgcgga?ggcagcgctg?cctgttcaag?agacaggcag?cgctgcctcc?gcggaagctt 60

ccgcggaggc?agcgctgcct?gtctcttgaa?caggcagcgc?tgcctccgcg 110

Claims (4)

1. a fucosyl transferase I that is used to suppress the constructed reorganization of LeY tumour oligosaccharides antigen synthetic fucosyl transferase I is interfered sequence FUT1-1, and it is characterized in that: its sequence is following: TGGCCGGTTTGGTAATCAG.

2. a kind of fucosyl transferase I interfere plasmid that is used to suppress the constructed reorganization of LeY tumour oligosaccharides antigen synthetic fucosyl transferase I of claim 1; It is characterized in that: it is that the special restriction enzyme site of polyclone with RNA interference vector pSilencer-4.1-CMV-neo is the basis; Design the dna sequence dna that the FUT1 SiRNA template of identical sticky end is arranged with interference vector, make up the interfere plasmid that contains FUT1-1 interference sequence of 1 FUT1: pSilencer-4.1-FUT1-1.

3. claim 1 a kind of is used to suppress the preparation method of the fucosyl transferase I interfere plasmid of the constructed reorganization of LeY tumour oligosaccharides antigen synthetic fucosyl transferase I; It is characterized in that: 1. be used to interfere the FUT1-1 of FUT1 gene to interfere the template DNA of sequence synthetic,, measure the light absorption value of 260nm with deionized water or the dissolving of TE damping fluid; And calculating DNA concentration; 2. the sample of getting after the dissolving adds in the DNA annealing buffer, and in 90-98 ℃ of sex change 3-10 minute, cooling back cryopreservation was subsequent use; 3. RNA interference vector pSilencer-4.1-CMV-neo is carried out special digestion with restriction enzyme in 37 ℃; Produce and the sticky end of interfering sequences match, 4. enzyme cut behind the product purification with 2. in the product preserved of preparation be connected, 5. with above-mentioned connection product transformed competence colibacillus bacterium and utilize the resistance marker screening positive clone of carrier; 6. extract and carry out enzyme behind the plasmid and cut evaluation, 7. cut and identify correct clone's preparation plasmid with enzyme.

4. a kind of fucosyl transferase I interfere plasmid that is used for suppressing the constructed reorganization of LeY tumour oligosaccharides antigen synthetic fucosyl transferase I of claim 2 is in the application for preparing antitumor drug.

Images