CN101892226A - Small interfering RNA (siRNA) for restraining ACC gene expression of human adipocyte and expression vector and application thereof - Google Patents
Small interfering RNA (siRNA) for restraining ACC gene expression of human adipocyte and expression vector and application thereof Download PDFInfo
- Publication number
- CN101892226A CN101892226A CN 201010122228 CN201010122228A CN101892226A CN 101892226 A CN101892226 A CN 101892226A CN 201010122228 CN201010122228 CN 201010122228 CN 201010122228 A CN201010122228 A CN 201010122228A CN 101892226 A CN101892226 A CN 101892226A
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- sirna
- adipocyte
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a small interfering RNA (siRNA) for restraining ACC gene expression of a human adipocyte and an expression vector and application thereof, discloses five siRNAs for ACC gene expression with specific silence human adipocyte, provides a vector which can express an adipocyte-containing specific promoter for producing the siRNA and a method for constructing the vector and discloses the application of the siRNA in the preparation of a weight-reducing medicament and the application of the vector serving as the weight-reducing medicament. The vector can specifically express the siRNA in the human adipocyte so as to restrain the ACC gene expression of the human adipocyte and has certain apoptosis effect on an adipocyte so as to act certain weight-reducing effect. The weight-reducing medicament prepared from the siRNA has the characteristics of high efficiency, quick response, high specificity and the like.
Description
Technical field
The present invention relates to the siRNA of a kind of people's of inhibition adipocyte ACC genetic expression, also relate to a kind of carrier and construction process thereof that can produce the siRNA that suppresses people's adipocyte ACC genetic expression, also relate to simultaneously described siRNA in the preparation slimming medicine application and described carrier as the application of slimming medicine.
Background technology
Obesity not only influences pretty figure, makes troubles to life, and can cause a series of disease, and fat-reducing is current social obesity patient's tight demand.Current slimming medicine mainly is the material of some chemosynthesis, the crude substance that perhaps from plant, extracts, and effect is not very good.
RNA (RNA interference) technology of interfering is one of the strongest instrument of a kind of inhibition of gene expression of growing up in recent years.This technology adopts the double-stranded RNA of 19-23 base or hair clip shape different lengths can make the target gene of dissimilar cells express obviously reduction, and therefore, the RNAi technology can make gene knockout (knock-down) or make gene silencing (gene silencing).This is a kind of typical posttranscriptional gene regulate and control method, claims PTGS (PTGS, post-transcriptional gene silencing) again.This emerging biotechnology provides new technology and method for the treatment of disease molecular level, in mammalian cell, set up the RNA interference technique, can be used to study the function of some specific gene, thereby can solve the pathogenesis of some disease, simultaneously disease is especially also had certain application value to tumor treatment, and the employed dosage of RNA interference technique only be ten thousand of antisense oligonucleotide dosage/about.On the other hand; if change 1 Nucleotide in the little double-stranded RNA; the reticent effect of this RNAi target gene is disappeared; like this; just this technology might be used to suppress some overexpression expression of gene; and do not influence the expression of normal gene, therefore, utilizing the RNA perturbation technique to prepare genomic medicine will be a kind of valid approach.
Summary of the invention
The object of the present invention is to provide the siRNA of a kind of people's of inhibition adipocyte ACC genetic expression.
The present invention also aims to provide a kind of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression, and described construction of carrier.
The present invention also aims to provide the application of siRNA in the preparation slimming medicine of a kind of people's of inhibition adipocyte ACC genetic expression.
The present invention also aims to provide a kind of application that can produce the carrier of the siRNA that suppresses people's adipocyte ACC genetic expression as slimming medicine.
Technical scheme of the present invention is as follows:
A kind of siRNA that suppresses people's adipocyte ACC genetic expression, described siRNA is little double-stranded RNA, its positive-sense strand sequence is any one pairing sequence among SEQ NO.1 in the sequence table, SEQ NO.2, SEQ NO.3, SEQ NO.4 and the SEQ NO.5.
A kind of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression, described carrier can be expressed and be produced double-stranded siRNA, and has introduced adipocyte specific promoter sequence in carrier; Described siRNA is little double-stranded RNA, and its positive-sense strand sequence is any one pairing sequence among SEQ NO.1 in the sequence table, SEQ NO.2, SEQ NO.3, SEQ NO.4 and the SEQ NO.5; Described adipocyte specific promoter is peroxisome proliferation-activated receptors γ 2 gene promoters.
A kind of construction of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression may further comprise the steps
(1) clone of adipocyte specific promoter sequence
According to a pair of primer PP1 of adipocyte specific promoter sequences Design and PP2, the genomic dna that extracts with people's adipocyte is that template is carried out pcr amplification, amplified production is after the gel electrophoresis preliminary evaluation, be cloned into the pMD18-T carrier, and transformed competence colibacillus cell, screening is obtained positive bacterium colony extract plasmid, use the universal primer of special primer and/or pMD18-T carrier to carry out the PCR evaluation, PCR is accredited as the further sequence verification of male recombinant plasmid, and the recombinant plasmid that empirical tests is correct promptly comprises the adipocyte specific promoter; Described primer sequence is
PP1:5ˊ-AGGAATTCAGCGCTGCATGCTGATACCAACGT-3ˊ;
PP2:5ˊ-CGGGATCCAACAGCATGGA?ATA?GGGGTTTGC-3ˊ;
(2) structure of pSilencer 4.1-PPAR γ 2P-neo carrier
The pcr amplification product double digestion of the adipocyte specific promoter that checking is correct, and with same enzyme double digestion pSilencer 4.1-CMV-neo carrier, reclaim the purpose fragment, then the promoter sequence that reclaims is connected with carrier, and transformed competence colibacillus cell, screening is obtained positive bacterium colony extract plasmid, carry out the double digestion checking, enzyme is cut and is verified as the further sequence verification of male recombinant plasmid, the recombinant plasmid called after pSilencer 4.1-PPAR γ 2P-neo carrier that empirical tests is correct;
(3) the siRNA corresponding DNA sequences is synthetic
Positive-sense strand sequence according to any one siRNA in the sequence table, design its corresponding DNA sequences, restriction enzyme site is introduced at the sequence two ends, described dna sequence dna is two strands, and two strand is a pair of complementary sequence, the sequence that designs forms double-stranded DNA by annealing after synthesizing, annealing reaction adopts ordinary method to get final product;
(4) structure of pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier
PSilencer 4.1-PPAR γ 2P-neo carrier is carried out double digestion, the enzyme of selecting for use when employed two enzymes design restriction enzyme site with step (3) double center chain DNA is identical, reclaim the purpose fragment, then the carrier that reclaims is connected with the double chain DNA sequence of formation in the step (3), and transformed competence colibacillus cell, screening is obtained positive bacterium colony extract plasmid, carry out the double digestion checking, enzyme is cut and is verified as the further sequence verification of male recombinant plasmid, the recombinant plasmid called after pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier that empirical tests is correct.
Described siRNA corresponding DNA sequences is as follows
1. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.1
The forward sequence is the sequence of SEQ NO.6 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.7 correspondence in the sequence table;
2. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.2
The forward sequence is the sequence of SEQ NO.8 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.9 correspondence in the sequence table;
3. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.3
The forward sequence is the sequence of SEQ NO.10 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.11 correspondence in the sequence table;
4. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.4
The forward sequence is the sequence of SEQ NO.12 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.13 correspondence in the sequence table;
5. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.5
The forward sequence is the sequence of SEQ NO.14 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.15 correspondence in the sequence table.
Technical program of the present invention also lies in adopting the application of siRNA in the preparation slimming medicine of a kind of people's of inhibition adipocyte ACC genetic expression, and a kind of application that can produce the carrier of the siRNA that suppresses people's adipocyte ACC genetic expression as slimming medicine.
Advantage of the present invention is: siRNA provided by the invention can suppress people's adipocyte ACC expression of gene, and finally causes the apoptosis of adipocyte, and adipocyte is had certain apoptosis effect, can play good antiobesity action; Carrier of the present invention contains the adipocyte specific promoter, can only in adipocyte, play a role to specificity, and siRNA also has its specificity in gene silencing, therefore adopt the special preparing carriers slimming medicine of in adipocyte, expressing siRNA, have efficient fast, characteristics such as high specificity.
Description of drawings
Fig. 1 is the physical map of carrier pSilencer 4.1-CMV-neo;
Fig. 2 is the physical map of carrier pSilencer 4.1-PPAR γ 2P-neo;
Fig. 3 is the physical map of carrier pSilencer 4.1-PPAR γ 2P-neo-DsiRNA;
Fig. 4 is the siRNA expression vector influences situation to the obese rat body weight a broken line graph.
Embodiment
Related siRNA is applicable to 5 pairs of a pair of arbitrarily among the designed siRNA of ACC among the following embodiment.Give an actual example just in order to help to understand the present invention in the specification sheets of the present invention; they do not have any restriction; be that the present invention is except that specification sheets gives an actual example; other embodiment can also be arranged; therefore, every employing is equal to any technical scheme of replacement or the formation of equivalent transformation form all in the protection domain that the present invention requires.
Plasmid vector pMD18-T used in the present invention is available from precious biological (Dalian) engineering corporation, carrier pSilencer 4.1-CMV-neo Vector(carrier collection of illustrative plates is as shown in Figure 1) available from the Ambion(U.S.) company, employed bacterial strain E.coli DH5 α is available from TIANGEN Biotech (Beijing) Co., Ltd., adipocyte (HPA-v) is available from ScienCell Research Laboratories before the people, human skin epidermic cell (HaCat) is available from the refined centralab in Central South University Hunan, the SD rat is provided by Xinxiang College of Medical Science's animal center, and employed reagent is the commercial goods.
The method that present embodiment makes up pSilencer 4.1-PPAR γ 2P-neo-DsiRNA-4 carrier may further comprise the steps:
(1) clone of adipocyte specific promoter sequence
(see Zhu Ji for details according to peroxisome proliferation-activated receptors γ 2 gene promoter sequences (NT_022517.18), Marvin's is beautiful, Mao Xiangming etc. the application [J] of green fluorescence protein gene in adipocyte differentiation research. No.1 Military Medical Univ.'s journal, 2005,25 (9): 1119-1123.) a pair of primer PP1 of design and PP2, wherein upstream primer PP1 introduces
EcoThe RI restriction enzyme site, downstream primer PP2 introduces
BamThe HI restriction enzyme site, primer sequence is as follows:
PP1:5ˊ-AGGAATTCAGCGCTGCATGCTGATACCAACGT-3ˊ;
PP2:5ˊ-CGGGATCCAACAGCATGGA?ATA?GGGGTTTGC-3ˊ;
The genomic dna that extracts with people's adipocyte is that template is carried out conventional pcr amplification, and amplified production length is 611bp, after the gel electrophoresis preliminary evaluation, by the enzyme of routine cut, method of attachment is cloned into the pMD18-T carrier, and transforms
E.coliThe competent cell of DH5 α bacterial strain, the positive bacterium colony that screening is obtained extracts plasmid, use the universal primer (SO100 and SO101) of special primer (PP1 and PP2) and pMD18-T carrier to carry out the PCR evaluation, PCR is accredited as the further sequence verification of male recombinant plasmid, and the recombinant plasmid that empirical tests is correct promptly comprises peroxisome proliferation-activated receptors γ 2 gene promoter PPAR γ 2P;
(2) structure of pSilencer 4.1-PPAR γ 2P-neo carrier
The pcr amplification product of the promotor PPAR γ 2P that checking is correct uses
EcoRI and
BamHI carries out double digestion, uses simultaneously
EcoRI and
BamHI double digestion pSilencer 4.1-CMV-neo carrier reclaims the purpose fragment, uses conventional linked system to be connected with reaction conditions with carrier the promoter sequence that reclaims then, and transforms
E.coliThe competent cell of DH5 α bacterial strain, the positive bacterium colony that the penbritin screening is obtained extracts plasmid, carry out the double digestion checking, enzyme is cut and is verified as the further sequence verification of male recombinant plasmid, the recombinant plasmid called after pSilencer 4.1-PPAR γ 2P-neo carrier (plasmid map as shown in Figure 2) that empirical tests is correct;
(3) the siRNA corresponding DNA sequences is synthetic
Sequence according to the described siRNA positive-sense strand of SEQ NO.4 in the sequence table, it is as follows to design this siRNA corresponding DNA sequences: the forward sequence is the sequence of SEQ NO.12 correspondence in the sequence table, reverse sequence is the sequence of SEQ NO.13 correspondence in the sequence table, and above-mentioned sequence is synthetic by Sangon Biotech (Shanghai) Co., Ltd.; Described dna sequence dna has following characteristics: forward and reverse sequence is a pair of complementary sequence, and the two ends of the formed double-stranded DNA of this a pair of complementary sequence are respectively
BamThe H I and
HinBut the combining form of the restriction enzyme site of d III, can with warp
BamThe H I and
HinFragment after d III enzyme is cut directly connects; Tip designs in the forward sequence has the protectiveness base, and there is the catenation sequence of 9 bases the centre of every section sequence;
Must adopt by annealing after sequence is synthetic and form double-stranded DNA, concrete grammar is as follows:
At first the synthetic single stranded DNA is made into the solution of 50 μ Μ, carry out according to the reaction system of 20 μ l then, be that each single stranded DNA is got 2 μ l, and add the annealing buffer (annealing Buffer) of 16 μ l, on the PCR instrument, carry out annealing reaction then, response procedures is 95 ℃ of insulations 4 minutes, and 70 ℃ are incubated 10 minutes; The shutdown postcooling to room temperature, 4 ℃ deposit or-20 ℃ of preservations standby;
(4) structure of pSilencer 4.1-PPAR γ 2P-neo-DsiRNA-4 carrier
PSilencer 4.1-PPAR γ 2P-neo carrier is used
BamHI and
HinThe d III is carried out double digestion, reclaims the purpose fragment, then the carrier that reclaims is connected with the double-stranded DNA of formation in the step (3), uses conventional linked system to be connected with reaction conditions, and transforms
E.coliThe competent cell of DH5 α bacterial strain, the positive bacterium colony that resistance screening is obtained extracts plasmid, carry out the double digestion checking, enzyme is cut and is verified as the further sequence verification of male recombinant plasmid, the recombinant plasmid called after pSilencer 4.1-PPAR γ 2P-neo-DsiRNA-4 carrier that empirical tests is correct.
This embodiment is to be the vector construction that example is carried out with SEQ NO.4 sequence, and the vector construction of other four sequences and negative control is that with the difference of above-mentioned construction process the synthetic sequence is different in the step (3), and simple the replacement gets final product.All siRNA expression vectors are unified called after pSilencer 4.1-PPAR γ 2P-neo-DsiRNA(plasmid map as shown in Figure 3), if can add the sequence numbering of siRNA when referring to some specific siRNA expression vectors on the basis of pSilencer 4.1-PPAR γ 2P-neo-DsiRNA, the corresponding relation of siRNA and corresponding DNA sequences thereof and expression vector is as shown in table 1:
Table 1 siRNA with and the corresponding relation of its corresponding DNA sequences and constructed carrier
Embodiment 2
Present embodiment siRNA expression vector is to the situation analysis that influences of ACC gene mRNA expression amount in people's adipocyte
Adipocyte before the people (HPA-v) cultivated induce, wait to be divided into sophisticated adipocyte, can carry out interference test; The interference test of each siRNA expression vector includes four groups, experimental group that situation is set is as shown in table 2, transfection process is as follows: sophisticated people's adipocyte and HaCat cell inoculation were cultivated 24 hours in 6 well culture plates, use Lipofectamine 2000 transfection reagents to carry out the transfection test then according to the situation that is provided with of test kit operational guidance and each experimental group, be about to pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier and negative control carrier pSilencer 4.1-PPAR γ 2P-neo-NosiRNA transfection to adipocyte, the HaCat cell is arrived in the transfection of pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier, lineup's adipocyte does not carry out the transfection test in addition, and wherein said pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier can refer to any one in 5 siRNA expression vectors.
Table 2 experimental group is provided with situation
PSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier in the table can refer to any one in 5 siRNA expression vectors.
Continue to cultivate 24 hours adipocyte after collecting transfection, carry out the extracting of total RNA, and measure content and the purity of RNA, according to the synthetic cDNA of test kit specification sheets according to the Trizol method; According to the cDNA sequence of people ACC gene (the GenBank accession number is: NM_198834.1) design primer, primer sequence is as follows:
Upstream primer: 5 ˊ-CACATAAGGTCCAGCAT-3 ˊ,
Downstream primer: 5 ˊ-TTCATAAGACCACCTACGG-3 ˊ;
With β-Actin as confidential reference items, according to β-Actin cDNA sequence (the GenBank accession number is: NM_001101.3) design primer, primer sequence is as follows:
Upstream primer: 5 ˊ-CGTACCACTGGCATCGTGAT-3 ˊ,
Downstream primer: 5 ˊ-GTGTTGGCGTACAGGTCTTTG-3 ˊ;
Use above-mentioned two pairs of primers respectively, with the synthetic cDNA of institute is that template is carried out the PCR reaction, after reaction finishes, get 5 μ l PCR products and carry out electrophoresis in the sepharose of 12 g/L, use Alpha Imager3400 type gel imaging analysis system that the gel electrophoresis result is scanned, record the gray-scale value of every gene band on the electrophoretogram with carrying analysis software, calculate the intensity of ACC and the ratio of β-Actin confidential reference items intensity, The data SPSS13.0 statistical analysis software is handled; The data of 4 test group of each siRNA are as shown in table 3.
The relative expression quantity of each experimental group ACC gene mRNA of table 3
The result show the siRNA expression vector to the inhibiting rate of adipocyte ACC gene mRNA more than 75%, and no significant difference between each control group, the result shows that the siRNA expression vector is obvious to the restraining effect of adipocyte ACC gene mRNA, and has the specificity of tissue.
Embodiment 3
Present embodiment siRNA expression vector is to the situation analysis that influences of adipocyte apoptosis
Adipocyte before the people (HPA-v) cultivated induce, wait to be divided into sophisticated adipocyte, can carry out the apoptosis test; The interference test of each siRNA expression vector includes four groups, experimental group that situation is set is as shown in table 2, transfection method is with transfection method among the embodiment 2, after cell after the transfection continues to cultivate 48h, collecting cell, according to the operation of apoptosis detection kit specification sheets, detect the apoptosis situation with flow cytometer, the data statistics of 4 test group of each siRNA is as shown in table 4.
The apoptosis rate of each experimental group of table 4
The result shows that experimental group 2 is that positive siRNA interference group apoptosis obviously increases, apoptosis no significant difference between negative control group, noiseless control group and the HaCat cell interference group, show that the siRNA expression vector has certain apoptosis effect to adipocyte, and have the specificity of tissue.
Embodiment 4
Present embodiment siRNA expression vector is to the impact analysis of rat body weight
(1) foundation of obese rat colony
Choose 280 of healthy male SD rats, require body weight 180 ± 10g, cleaning level, selected rat through adapt to raised for 1 week after, give the rat high lipid food, freely drink water and ingest; After two weeks, transfer middle 30 rats of body weight gain to the normal control group, give basal feed; All the other rats continue to feed raises high lipid food, weighs in weekly 1 time; In the 10th when week, according to body weight gain minor sort again, forward 70 rats of body weight gain are as fat susceptible rat.
(2) the siRNA expression vector is to the impact analysis of rat body weight
The above-mentioned obese rat that filters out is divided into A, B, C, D, E, F, seven groups of G, every group 10, (consumption is 2.5mg/kg to the siRNA expression vector plasmid solution of A-E group employing purifying, plasmid purification is diluted to 10ml with phosphate buffered saline buffer PBS, the siRNA carrier of corresponding pSilencer 4.1-PPAR γ 2P-neo-DsiRNA-1 to the pSilencer 4.1-PPAR γ 2P-neo-DsiRNA-5 of A-E group difference) tail vein injection is gone in the rat body, the F group adopts the PBS tail vein injection to go in the rat body, be controlled in the 20s each individual inject time, and the G group is not carried out any processing; Weekly A-G group rat weight is measured respectively, in 6 weeks of METHOD FOR CONTINUOUS DETERMINATION, the result as shown in Figure 4.
The result shows that when the 1st week and the 2nd week, it is little that each organizes the mouse weight differential; During the 3rd week, A-E group rat weight begins to descend, and F group and G group rat weight do not have noticeable change; In the 4th when week, A-E group rat weight descends more obvious, and F group and G group rat weight still do not have noticeable change, and the 5th week and the 6th is when all, and each organizes the weight of the rat weight when all with the 4th, and to compare difference not obvious; Illustrate that the siRNA expression vector has reached the peak when the 4th week to the interference effect of body weight, each treatment stage, F group and G organize rat body weight does not have significant difference, illustrates that PBS does not have too much influence to body weight.
Embodiment 5
Present embodiment siRNA expression vector is as the application of slimming medicine
The pure product of getting the siRNA expression vector of structure are mixed with injection or oral capsule, are used for the treatment of obesity.Reduce the expression of fat, or impel the apoptosis of adipocyte.The expression vector of siRNA of the present invention and fatty organizing specific promotor thereof can play special inhibition effect to fatty tissue, is used for the treatment of the obesity that a variety of causes causes, does not have toxic side effect.
The nucleotides sequence tabulation
<110〉Xinxiang College of Medical Science
<120〉a kind of siRNA and application thereof that suppresses people's adipocyte ACC genetic expression
<160>?5
<210>?1
<211>?19
<212>?RNA
<213〉people (Homo sapiens)
<400>
auugaggcugagggaacug 19
<210>?2
<211>?19
<212>?RNA
<213〉people (Homo sapiens)
<400>
guggauaucuacucagaca 19
<210>?3
<211>?19
<212>?RNA
<213〉people (Homo sapiens)
<400>
ccuggugaaguuggaccua 19
<210>?4
<211>?19
<212>?RNA
<213〉people (Homo sapiens)
<400>
auaaagugauugagaaggu 19
<210>?5
<211>?19
<212>?RNA
<213〉people (Homo sapiens)
<400>
caauggcauugcagcagug 19
<210>?6
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
gatccattgaggctgagggaactgttcaagagacagttccctcagcctcaattttaca 58
<210>?7
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
agcttgtaaaattgaggctgagggaactgtctcttgaacagttccctcagcctcaatg 58
<210>?8
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
gatccgtggatatctactcagacattcaagagatgtctgagtagatatccactttaca 58
<210>?9
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
agcttgtaaagtggatatctactcagacatctcttgaatgtctgagtagatatccacg 58
<210>?10
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
gatcccctggtgaagttggacctattcaagagataggtccaacttcaccaggtttaca 58
<210>?11
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
agcttgtaaacctggtgaagttggacctatctcttgaataggtccaacttcaccaggg 58
<210>?12
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
gatccataaagtgattgagaaggtttcaagagaaccttctcaatcactttattttaca 58
<210>?13
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
agcttgtaaaataaagtgattgagaaggttctcttgaaaccttctcaatcactttatg 58
<210>?14
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
gatcccaatggcattgcagcagtgttcaagagacactgctgcaatgccattgtttaca 58
<210>?15
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
agcttgtaaacaatggcattgcagcagtgtctcttgaacactgctgcaatgccattgg 58
<210>?16
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
gatccttctccgaacgtgtcacgtttcaagagaacgtgacacgttcggagaatttaca 58
<210>?17
<211>?58
<212>?DNA
<213〉artificial sequence
<400>
agcttgtaaattctccgaacgtgtcacgttctcttgaaacgtgacacgttcggagaag 58
Claims (8)
1. siRNA who suppresses people's adipocyte ACC genetic expression, it is characterized in that: described siRNA is little double-stranded RNA, and its positive-sense strand sequence is any one pairing sequence among SEQ NO.1 in the sequence table, SEQ NO.2, SEQ NO.3, SEQ NO.4 and the SEQ NO.5.
2. carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression, it is characterized in that: described carrier contains adipocyte specific promoter sequence, and can produce the little double-stranded RNA that specificity suppresses people's adipocyte ACC genetic expression; The positive-sense strand sequence of described little double-stranded RNA is any one pairing sequence among SEQ NO.1 in the sequence table, SEQ NO.2, SEQ NO.3, SEQ NO.4 and the SEQ NO.5.
3. a kind of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression according to claim 2, it is characterized in that: described adipocyte specific promoter is peroxisome proliferation-activated receptors γ 2 gene promoters.
4. construction of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression as claimed in claim 2, it is characterized in that: described construction process may further comprise the steps
(1) clone of adipocyte specific promoter sequence
According to a pair of primer PP1 of adipocyte specific promoter sequences Design and PP2, the genomic dna that extracts with people's adipocyte is that template is carried out pcr amplification, amplified production is after the gel electrophoresis preliminary evaluation, be cloned into the pMD18-T carrier, and transformed competence colibacillus cell, screening is obtained positive bacterium colony extract plasmid, use the universal primer of special primer and/or pMD18-T carrier to carry out the PCR evaluation, PCR is accredited as the further sequence verification of male recombinant plasmid, and the recombinant plasmid that empirical tests is correct promptly comprises the adipocyte specific promoter;
(2) structure of pSilencer 4.1-PPAR γ 2P-neo carrier
The pcr amplification product double digestion of the adipocyte specific promoter that checking is correct, and with same enzyme double digestion pSilencer 4.1-CMV-neo carrier, reclaim the purpose fragment, then the promoter sequence that reclaims is connected with carrier, and transformed competence colibacillus cell, screening is obtained positive bacterium colony extract plasmid, carry out the double digestion checking, enzyme is cut and is verified as the further sequence verification of male recombinant plasmid, the recombinant plasmid called after pSilencer 4.1-PPAR γ 2P-neo carrier that empirical tests is correct;
(3) the siRNA corresponding DNA sequences is synthetic
Positive-sense strand sequence according to any one siRNA in the sequence table, design its corresponding DNA sequences, restriction enzyme site is introduced at the sequence two ends, described dna sequence dna is two strands, and two strand is a pair of complementary sequence, the sequence that designs forms double-stranded DNA by annealing after synthesizing, annealing reaction adopts ordinary method to get final product;
(4) structure of pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier
PSilencer 4.1-PPAR γ 2P-neo carrier is carried out double digestion, the enzyme of selecting for use when employed two enzymes design restriction enzyme site with step (3) double center chain DNA is identical, reclaim the purpose fragment, then the carrier that reclaims is connected with the double chain DNA sequence of formation in the step (3), and transformed competence colibacillus cell, screening is obtained positive bacterium colony extract plasmid, carry out the double digestion checking, enzyme is cut and is verified as the further sequence verification of male recombinant plasmid, the recombinant plasmid called after pSilencer 4.1-PPAR γ 2P-neo-DsiRNA carrier that empirical tests is correct.
5. a kind of construction of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression according to claim 4, it is characterized in that: the sequence of described primer PP1 and PP2 is as follows
PP1:5ˊ-AGGAATTCAGCGCTGCATGCTGATACCAACGT-3ˊ;
PP2:5ˊ-CGGGATCCAACAGCATGGA?ATA?GGGGTTTGC-3ˊ。
6. a kind of construction of carrier that can produce the siRNA that suppresses people's adipocyte ACC genetic expression according to claim 4, it is characterized in that: described siRNA corresponding DNA sequences is as follows
1. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.1
The forward sequence is the sequence of SEQ NO.6 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.7 correspondence in the sequence table;
2. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.2
The forward sequence is the sequence of SEQ NO.8 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.9 correspondence in the sequence table;
3. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.3
The forward sequence is the sequence of SEQ NO.10 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.11 correspondence in the sequence table;
4. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.4
The forward sequence is the sequence of SEQ NO.12 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.13 correspondence in the sequence table;
5. positive-sense strand is the siRNA corresponding DNA sequences of SEQ NO.5
The forward sequence is the sequence of SEQ NO.14 correspondence in the sequence table, and reverse sequence is the sequence of SEQ NO.15 correspondence in the sequence table.
7. the application of siRNA in the preparation slimming medicine that suppresses people's adipocyte ACC genetic expression.
8. application that can produce the carrier of the siRNA that suppresses people's adipocyte ACC genetic expression as slimming medicine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010122228 CN101892226A (en) | 2010-03-11 | 2010-03-11 | Small interfering RNA (siRNA) for restraining ACC gene expression of human adipocyte and expression vector and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010122228 CN101892226A (en) | 2010-03-11 | 2010-03-11 | Small interfering RNA (siRNA) for restraining ACC gene expression of human adipocyte and expression vector and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101892226A true CN101892226A (en) | 2010-11-24 |
Family
ID=43101571
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201010122228 Pending CN101892226A (en) | 2010-03-11 | 2010-03-11 | Small interfering RNA (siRNA) for restraining ACC gene expression of human adipocyte and expression vector and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101892226A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014206219A1 (en) * | 2013-06-27 | 2014-12-31 | 昆山彭济凯丰生物科技有限公司 | Rna fragment, preparation method therefor, and use thereof |
CN105255943A (en) * | 2015-10-21 | 2016-01-20 | 浙江大学 | Construction method and use of pig PPAR Gamma small interfering RNA expression vector |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101353657A (en) * | 2008-09-02 | 2009-01-28 | 浙江大学 | Construction method and use of pig Sirtl siRNA expression vector |
US20090137513A1 (en) * | 2002-02-20 | 2009-05-28 | Sirna Therapeutics, Inc. | RNA Interference Mediated Inhibition of Acetyl-CoA-Carboxylase Gene Expression Using Short Interfering Nucleic Acid (siNA) |
US20090239830A1 (en) * | 2007-06-01 | 2009-09-24 | Josh Munger | Treatment of viral infections by modulation of host cell metabolic pathways |
-
2010
- 2010-03-11 CN CN 201010122228 patent/CN101892226A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090137513A1 (en) * | 2002-02-20 | 2009-05-28 | Sirna Therapeutics, Inc. | RNA Interference Mediated Inhibition of Acetyl-CoA-Carboxylase Gene Expression Using Short Interfering Nucleic Acid (siNA) |
US20090239830A1 (en) * | 2007-06-01 | 2009-09-24 | Josh Munger | Treatment of viral infections by modulation of host cell metabolic pathways |
CN101353657A (en) * | 2008-09-02 | 2009-01-28 | 浙江大学 | Construction method and use of pig Sirtl siRNA expression vector |
Non-Patent Citations (2)
Title |
---|
《生命的化学》 20070415 李亮 等 乙酰辅酶A羧化酶在治疗肥胖中的潜在作用 第27卷, 第2期 2 * |
《第一军医大学学报》 20050920 祝骥 等 绿色荧光蛋白基因在脂肪细胞分化研究中的应用 1119-1123 第25卷, 第9期 2 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014206219A1 (en) * | 2013-06-27 | 2014-12-31 | 昆山彭济凯丰生物科技有限公司 | Rna fragment, preparation method therefor, and use thereof |
CN105255943A (en) * | 2015-10-21 | 2016-01-20 | 浙江大学 | Construction method and use of pig PPAR Gamma small interfering RNA expression vector |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103301475B (en) | Method that pharmaceutical composition and expression vector and regulator gene are expressed and the application of nucleic acid molecules | |
CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
CN105861551B (en) | The carrier and its construction method of Combined expression microRNAs inhibition Cells Proliferation of Human Breast Cancer and application | |
CN105132424A (en) | MicroRNA inhibitor, microRNA inhibitor expression vector, building method of microRNA inhibitor expression vector and application of microRNA inhibitor expression vector | |
CN102757958A (en) | Construction of CD14 eukaryotic expression vector and method for preparing high-expression cell strain by using CD14 eukaryotic expression vector | |
CN103361346A (en) | Method for cloning and analyzing populus diversifolia micro RNAs (ribonucleic acids) precursor | |
CN107916264A (en) | The dsRNA of wing development related gene vestigial and its application in citrus fruit fly is prevented | |
CN102154293B (en) | Small-interfering RNA (siRNA) capable of inhibiting classical swine fever virus (CSFV) reproduction and infection as well as preparation method and application thereof | |
CN101892226A (en) | Small interfering RNA (siRNA) for restraining ACC gene expression of human adipocyte and expression vector and application thereof | |
CN110129318A (en) | Long-chain non-coding RNA PRALR and its expression plasmid and purposes | |
CN110129319B (en) | siRNA of PRALR and application thereof | |
CN104232643B (en) | RNAi interference fragments, interference carrier, preparation method and applications | |
CN102260672B (en) | siRNA (small interfering RNA) for inhibiting expression of porcine Somatostatin receptor 2 | |
CN104946654A (en) | shRNA sequence for restraining duck MSTN genetic expression and application thereof | |
EP3081645A1 (en) | Non-coded rna of in-vivo infected microorganisms, parasitic microorganisms, symbiotic microorganisms and identification and application thereof | |
AU2020100222A4 (en) | Method of introducing double-stranded dna into the body of kerria chinensis | |
CN107488660A (en) | The palindrome and complementary palindrome tiny RNA and its application | |
CN101348799A (en) | Construction method and pharmaceutical use of microRNA adenovirus expression plasmid for severe hepatitis related gene hfg12, hFas and hTNFR1 | |
CN108103025A (en) | A kind of candidate stem cell and its preparation method and application | |
CN110511933B (en) | Rat long-chain non-coding lncRNA-lncMSTRG10078 and application thereof in resisting cell injury | |
CN102796706B (en) | Cell model having TLR4 immune response function and method for constructing same | |
CN104857529A (en) | Application of EGR-1 (early growth response-1) gene in preparation of medicine for resisting bladder cancer | |
CN101575602B (en) | siRNA sequence for inhibiting human BFGF gene expression amplification and expression carrier and application thereof | |
CN107384925A (en) | SiRNA sequence and its application for the site of autophagy related gene Beclin1 code areas 438 458 | |
CN105002181B (en) | A kind of rat Kif11 genes interference shRNA and its recombinant adeno-associated virus and antitumor application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20101124 |