CN102094014B - BGIos1003 gene and application thereof - Google Patents

Abstract

The invention relates to a BGIos1003 gene and an application thereof. The BGIos1003 gene of the invention has a nucleotide sequence shown in the SEQ ID NO:1 or has a variant with the function of largening plant grains. The invention also relates to a transgenic plant with the transformed BGIos1003 gene or the variant thereof. The invention also relates to an application of the BGIos1003 gene or the variant thereof for largening plant grains and a method for largening plant grains.

Description

BGIos1003 gene and uses thereof

Technical field

The present invention relates to a kind of gene, particularly relate to the BGIos1003 gene, and promote plant, particularly monocotyledons seed to become large purposes and method.

Background technology

Paddy rice (Oryza sativa) is one of most important food crop in the whole world, the whole world approximately more than 30 hundred million populations take rice as staple food (Delseny M et al, 2001).Paddy rice also is the first food crop of China, and its area, per unit area yield and ultimate production all rank first, and Rice Production has very important status in Chinese national economy.Along with the raising of population growth and living standards of the people, there is larger demand in market to fine quality rice.Grain-production not only will improve the yield potential of kind, more will pay attention to the improvement of quality, and rice grain type (grain length, the wide and long-width ratio of grain) and thousand seed weight can affect rice outward appearance, output and marketable value.Therefore, the new rice variety of the large grain of seed selection high-quality has become a major objective of rice breeding, and the oligogene of excavating control rice grain type and thousand seed weight is the common focus of paying close attention to of current geneticist and breeding men.This is significant to the competitive power that improves rice yield and rice market.

Rice yield is mainly determined by thousand seed weight, number of productive ear and number of grain per ear.According to domestic and international research, in the three elements that consist of rice yield, thousand seed weight also is the hereditary more stable of grain weight, and its variation coefficient is 40%～60%.Philippines International Rice Research Institute research thinks, increases heavy rice yield (Yao Guoxin and Lu Lei, Agriculture of Anhui science, 2007,35 (27): 8468-8478) more than 30% of improving of grain.On metabolic physiology and morphology, high yield must possess two conditions, i.e. high-caliber metabolism source and enough large storage, wherein the latter show more than the number and grain large, namely photosynthate is had larger acceptance.Based on above analysis, want to realize the further leap of rice yield, improving the heavy approach of grain is significant, improve grain and heavily be the effective way that improves grain yield (Xiong Zhenmin and Kong Fanlin, Jiangsu agricultural sciences 4,1981,48:25-30).

Paddy rice thousand seed weight is determined by grain length, width and thickness three, is an Inheritance of Quantitative Characters that typically is subjected to controlled by multiple genes.The oligogene that clone control grain is heavy and in addition renovation and utilization be the effective ways that improve grain yield.The at present genome sequencing work of paddy rice is finished, and has accumulated quite detailed data on paddy rice, for the positional cloning of paddy rice important character gene is provided convenience.But clone task still arduous (Yao Guoxin and Lu Lei, Agriculture of Anhui science, 2007,35 (27): 8468-8478) about the assignment of genes gene mapping of rice grain weight.

Current, nearly 89 of grain tuple amount character sites of having located are distributed on all 12 karyomit(e)s of paddy rice (Mary lotus, the Chinese Academy of Agricultural Sciences, master thesis, 2007).(the rice in China science such as Xu Jianlong, 2002,16 (3): 6-10) the special blue or green RILs (RILs) of 292 Lemont/ of application detect and affect 11 of thousand seed weight Crop Quantitative Traits site (quantitativetraitlocus, QTL), lay respectively on the 1st, 2,3,4,5,10 and 12 karyomit(e)s, the associating contribution rate is 53.9%.Lin Lihui and Wu's behaviour (Molecular Plant Breeding, 2003 (1): 337-342) utilize the recombinant inbred lines of hybridizing foundation as the parent take two glaze rice varieties H359 and Acc8558 to detect 16 QTLs heavily relevant with grain, soluble 81.40% phenotypic variation, be distributed on 8 different karyomit(e)s, wherein have 5 to be distributed on the 3rd karyomit(e).It is recurrent parent that Cornell Univ USA selects the tropic Japonica kind, make up with the common wild-rice material formulation, 353 BCZF2:2 colonies that strain forms have been made up, detect 8 QTL at thousand grain weight properties, the gw3.1 performance that wherein is positioned at paddy rice the 3rd chromosomal nearly centriole interval is the most stable, contribution rate is also higher, and (Li et al, Genetics 2004,168:2187-2195).(Genetics 1997 for Li et al, 145:453-465), (the plant breeding 2005 such as Guo LB, 124:127-132) and Ishimaru (Plant Physiology 2003 133:1083-1090) etc. utilizes different genetic group also a heavy QTL of grain to be positioned on the 6th karyomit(e).

Although the heavy QTL of grain that has located has 89, can be with the heavy gene Fine Mapping of grain seldom.According to existing document, Fine Mapping about the heavy gene of grain only has gw3.1 (Li et al, Genetics 2004,168:2187-2195), Lk-4 (t) (ZHOU LQ et al, Acta GenetSin, 2006,33:72-79), gw8.1 (Xie et al, Theor Appl Genet, 2006,113:885-894), GS3 (FAN CC et al, Theor Appl Genel, 2006,12 (6): 1164-1171) and GW2 (XIAN-JUN S et al, Nature Genetic, 2007,39:623-630).The heavy gene of clone's grain only has GS3 grain length (FAN CC et al, Theor Appl Genel, 2006,12 (6): 1164-1171) with GW2 grain wide (XIAN-JUN S et al, Nature Genetic, 2007,39:623-630) gene.So the heavy gene of the more grain of Fine Mapping and clone becomes the important process of current raising rice yield.

Summary of the invention

The contriver is on the basis of completed paddy rice genome sequencing, 517 genes have been cloned, and carry out respectively transgenosis and verify its function, by comparing with control group, the grain that transfer-gen plant produces that discovery has transformed the BGIos1003 gene is obviously large than control group, and namely the thousand seed weight of transfer-gen plant has been improved greatly.Thus preliminary identification the BGIos1003 gene be and the relevant functional gene of quantitative character of control granular size to have finished the present invention.

Particularly, the present invention includes following several respects:

One aspect of the present invention relate to a kind of have promote plant seed to become the nucleotide sequence of large function, described nucleotide sequence contains the nucleotide sequence shown in the SEQ ID NO:1, i.e. BGIos1003 gene, the sequence of described gene is as follows:

ATGGGCCACGACGCCGCAGCTCACCGCCGTGACGGCCACGACCGGCGCCACCACCCTTACCGTGGCGCGGAGGCCGGAGCCGCACGCGCAGGCGCGGCGAGCCTCCTCGTCGGCAGCGGCGAGCAGGGCGCCGGTCAGGTCCTGAGCTTCCGTTCCGGCGGCCGGCCTTGGCTCGGGCTCGCGTTCGCGGCGCCGCACCCATGGGCGAACCGGGACGAGCATGTGGTGCAGCGCCACGACGCGCCAGAGTTTGCGCCACCGCCTCCTCCTCGTCCTTTCTCCTCCTGGGACCGCGTGCCCATGGCGGCGCTCGCCGCCGGTGAGCCGTTCTCTGGTCGAGCGACGGGAGGCGATGGTGGTGTGCGGAGCGACGTCATGGCTCCTCCTGCGATGGCGGAGGAGGCGAAGGTGTCGTGCCTGCCGCTCGCGAGGGAGGTCGGCCGCAGGGCGGCGGCGGCAGGCGGCGGCCAGGGGCGCAACTTCATCGTCTCGCCGCTGTCCTTCCACGCGGCGCTCGCGCTGGTGGCCGACGGCGCGCGGGGCGAGACGCAGCGCGAGCTCCTGGGCTTCCTCGGCTCGCCGTCGCTCGCCGAGCTTCACCGCTCGCCGACGACGCGGCTCGTCGCGAGGCTCCGCCACCTGCCGAACACGTCCTTCGCCTGCGGCGTGTGGGTGGACCGCGGCCGCGCGCTCACGCCGGAGTTCGCGGACGCCGCCGCGTCGCGCTACGCCGCCGTCGCCGAGCCCGCCGACTTCGCCACCCAGCCCGAGCAGGCGCGGGAGCGAGTCAACGCCTTCGTGTCCGACGCGACGGAGGGGCTCATCCGCGACGTCCTCCCTCCCAACTCCGTCGACTCCTCCACGGTGGTCGTCCTCGCCAACGCGGTCCACTTCAAGGGGACGTGGTCGCTGCCGTTCCACCCGTCGGCGACCTTCCACGCGCCGTTCCACCTCCTCGACGGCGGCGCCGTGCGCGCGCCGTTCATGACGACGGAGATCCCCTTCGAGCGCCACGTCGCCGCCTTCCCCGGCTTCACGGCGCTCAAGCTCCCCTACAAGAACGTCGGCGGCGGCGGCGGTGGCGACGGCGTGCCCCGAGCCGCATTCTACATGCTCCTGCTCCTCCCCGACGGCGACGGCGCGCTCAAGCTCGCCGATCTCTACGATATGGCCGTGACCACGCCGGAGTTCATCAAGAAGCACACGCCGGCGGCGGAGGCTCCGGTGAGGCGGCTCATGGTCCCCAAGTTCAAGTTCTCGTTCAAGTTCGAGGCGAAGTCCGACATGCGGAAGCTGGGCGTGACCCGAGCTTTCGCCGGCGGCGACTTCTCCGGCATGGTGACCGGCGGGGACGGTCTCTTCATCGCCGAAGTGTATCATCAGGCCACCATCGAGGTGGACGAGCTCGGCACCGTGGCCGCCGCCTCCACCGCCGTGGTTATGATGCAAAAGGGGAGCTCACTGCCGCCGGTGGACTTCGTCGCCGACCGGCCGTTCTTGTTCGCCGTCGTCGAGGAGCTCACCGGCGCCGTACTGTTTCTTGGGCATGTGGTCAATCCTCTCGCTGAATAA

(SEQ ID NO：1)

The invention still further relates to the nucleotide sequence with sequence complementation shown in the SEQ ID NO:1, or it has the plant seed of promotion and becomes the following variant of being selected from of large function:

1) under high stringent condition with the nucleotide sequence of the nucleotide sequence hybridization shown in the SEQ ID NO:1,

2) nucleotide sequence shown in the SEQ ID NO:1 is carried out the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified, and

3) has the nucleotide sequence of at least 90% sequence identity with the nucleotide sequence shown in the SEQ ID NO:1.

" stringency " degree of used condition was classified when typically, " hybridization conditions " was according to measurement hybridization.The stringency degree can be take nucleic acid for example in conjunction with the melting temperature(Tm) (Tm) of mixture or probe as foundation.For example, " maximum stringency " typically occurs in approximately Tm-5 ℃ (being lower than 5 ℃ of probe Tm); " high stringency " occurs in following approximately 5-10 ℃ of Tm; " medium stringency " occurs in following approximately 10-20 ℃ of probe Tm; " low stringency " occurs in following approximately 20-25 ℃ of Tm.As an alternative, perhaps further, hybridization conditions can take the salt of hybridization or ionic strength conditions and/or one or the washing of repeatedly stringency as foundation.For example, the extremely low stringency of 6 * SSC=; 3 * SSC=is low to moderate medium stringency; The medium stringency of 1 * SSC=; 0.5 the high stringency that waits of * SSC=.On function, can adopt maximum stringency condition to determine and the tight same or near tight same nucleotide sequence of hybridization probe; And adopt high stringency condition to determine to have an appointment 80% or the nucleotide sequence of multisequencing identity more with this probe.

For the application that requires highly selective, typically expectation adopts relatively restricted condition to form crossbred, for example, selects relatively low salt and/or high-temperature condition.Sambrook etc. (Sambrook, J. etc. (1989) molecular cloning, laboratory manual, Cold Spring Harbor Press, Plainview, N.Y.) provide the hybridization conditions that comprises medium stringency and high stringency.

For ease of explanation, comprise for detection of the suitable moderate stringent condition of polynucleotide of the present invention and other multi-nucleotide hybrid: with 5 * SSC, 0.5%SDS, the prewashing of 1.0mM EDTA (pH8.0) solution; Under 50-65 ℃, in 5 * SSC, hybridize and spend the night; Subsequently with contain 2 of 0.1%SDS *, 0.5 * and 0.2 * SSC 65 ℃ of lower each washed twice 20 minutes.It will be appreciated by those skilled in the art that easily to operate the hybridization stringency, as changing saltiness and/or the hybridization temperature of hybridization solution.For example, in another embodiment, the tight hybridization conditions of suitable height comprises above-mentioned condition, and difference is that hybridization temperature is elevated to for example 60-65 ℃ or 65-70 ℃.

In the present invention, described under high stringent condition with the nucleotide sequence of the nucleotide sequence hybridization shown in the SEQ ID NO:1, it has and the same or analogous short plant seed of the nucleotide sequence shown in the SEQ ID NO:1 becomes large active.

In the present invention, described nucleotide sequence shown in the SEQ ID NO:1 is carried out the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified, refer to hold at the 5 ' end and/or 3 ' of described nucleotide sequence respectively or simultaneously, and/or sequence inside for example is no more than 2-45, perhaps be no more than 2-30, perhaps be no more than 3-20, perhaps be no more than 4-15, perhaps be no more than 5-10, the replacement, disappearance, the interpolation that perhaps are no more than 6-8 the base that represents with continuous integral number are one by one respectively modified.

In the present invention, describedly nucleotide sequence shown in the SEQ ID NO:1 is carried out nucleotide sequence that replacement, disappearance, interpolation such as above-mentioned one or more bases modify has and the same or analogous short plant seed of the nucleotide sequence shown in the SEQ IDNO:1 becomes large active.

Describe by a kind of polynucleotide, its nucleotide sequence that has for example with the reference nucleotide sequence of SEQID NO:1 at least " identity " of tool 95% refer to: in per 100 Nucleotide of the reference nucleotide sequence of SEQ IDNO:1, the nucleotide sequence of these polynucleotide is except containing the difference that reaches 5 Nucleotide, and the nucleotide sequence of these polynucleotide is identical with reference sequences.In other words, in order to obtain the identical polynucleotide of nucleotide sequence and reference nucleotide sequence at least 95%, nearly 5% Nucleotide can be deleted or by another nucleotide substitution in the reference sequences; Maybe some Nucleotide can be inserted in reference sequences, the Nucleotide that wherein inserts can reach reference sequences total nucleotide 5%; Or in some Nucleotide, the combination of have deletion, inserting and replacing, wherein said Nucleotide reach reference sequences total nucleotide 5%.These sudden changes of reference sequences can occur in 5 ' or 3 ' terminal position of reference nucleotide sequence, or any place between these terminal positions, they or be dispersed in separately in the Nucleotide of reference sequences, or be present in the reference sequences with the group of one or more vicinities.

In the present invention, algorithm that be used for to determine sequence identity and sequence similarity percentage ratio is for example BLAST and BLAST 2.0 algorithms, and they are described in respectively (1990) J.Mol.Biol.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and Altschul.For example adopt described in the document or default parameters, BLAST and BLAST 2.0 can be used for determining nucleotide sequence homology percentage ratio of the present invention.Carrying out software that BLAST analyzes can be obtained by the public by state-run biotechnology information center.

In the present invention, the nucleotide sequence that nucleotide sequence shown in described and the SEQ ID NO:1 has at least 90% sequence identity comprises the polynucleotide sequence substantially same with the disclosed sequence of SEQ ID NO:1, for example when adopting methods described herein (for example adopting the BLAST of canonical parameter to analyze), compare with polynucleotide sequence of the present invention and to contain at least 90% sequence identity, preferred at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or those sequences of higher sequence identity.

In the present invention, the nucleotide sequence of the nucleotide sequence shown in described and the SEQ ID NO:1 with sequence identity of at least 90% has and the same or analogous short plant seed of the nucleotide sequence shown in the SEQ ID NO:1 becomes large active.

In the present invention, described BGIos1003 gene source is in common wild-rice Yuanjiang River (Oryza.rifupongon Yuanjiang).

Another aspect of the present invention relates to a kind of carrier, it is characterized in that, described carrier contains nucleotide sequence of the present invention, and described carrier can by for example above-mentioned nucleotide sequence insertion cloning vector or expression vector being obtained, perhaps can obtain by synthetic.

Another aspect of the present invention relates to a kind of recombinant vectors, it is characterized in that described recombinant vectors contains nucleotide sequence of the present invention, and described recombinant vectors can be by obtaining above-mentioned nucleotide sequence insertion cloning vector or expression vector.

The cloning vector that is suitable for making up recombinant vectors of the present invention includes but not limited to, such as: pUC18, pUC19, pUC118, pUC119, pMD19-T, pMD20-T, pMD18-T SimpleVecter, pMD19-T Simple Vecter etc.

Be suitable for making up expression vector of the present invention and include but not limited to, such as: pBI121, p13W4, pGEM etc.

In one embodiment of the invention, described recombinant vectors is the p6+BGIos1003 recombinant vectors.

Another aspect of the present invention relates to a kind of reconstitution cell that contains carrier of the present invention, and described reconstitution cell can be converted into host cell and obtains by containing carrier of the present invention.

The host cell that is suitable for making up reconstitution cell of the present invention includes but not limited to, such as: agrobacterium tumefaciens cell LBA4404, EHA105, GV3101 etc.

In one embodiment of the invention, described reconstitution cell is restructuring Agrobacterium (Agrobacterium tumefaciens) EHA105-p6+BGIos1003.

Of the present inventionly also relate in one aspect to a kind of monocotyledons callus, it is characterized in that, described Transformation of Callus has nucleotide sequence of the present invention and/or carrier and/or infection that reconstitution cell of the present invention is arranged.

Of the present inventionly also relate in one aspect to a kind of transgenic plant, it is characterized in that, described transgenic plant transform to be had nucleotide sequence of the present invention and/or carrier and/or infects reconstitution cell of the present invention.

Of the present inventionly also relate in one aspect to nucleotide sequence of the present invention and/or carrier and/or reconstitution cell is used for promoting that plant seed becomes large purposes, and for the preparation of transgenic plant or be used for the purposes of plant breeding.

Of the present inventionly also relate in one aspect to callus of the present invention for the preparation of transgenic plant or be used for the purposes of plant breeding.

Of the present inventionly also relate in one aspect to a kind of plant seed that promotes and become large method, described method comprises nucleotide sequence of the present invention and/or carrier is transformed into plant, or with reconstitution cell of the present invention infection plant.

Described method comprises the step with the callus of nucleotide sequence transforming monocots of the present invention.In one embodiment of the invention, the trans-utilization of described monocotyledons callus contain the reconstitution cell of nucleotide sequence of the present invention.In one embodiment of the invention, utilized aforesaid restructuring Agrobacterium EHA105-p6+BGIos1003 in the conversion process of described monocotyledons callus.In a specific embodiments of the present invention, described monocotyledonous callus is Rice Callus, and particularly, described paddy rice is that Japan is fine.

In the present invention, can adopt the plant gene transformation technology that goal gene is inserted in the Plant Genome, comprise agrobacterium mediation converted, virus-mediated conversion, microinjection, particle bombardment, via Particle Bombardment Transformation and electroporation etc.This area is known, and agriculture bacillus mediated gene transformation often is used to the gene transformation of monocotyledons and dicotyledons, but other transformation technology also can be used for monocotyledonous gene transformation of the present invention.Certainly, the another kind of method that is suitable for transforming monocots of the present invention is particle bombardment (micro-gold or tungsten particle attached bag are covered the DNA of conversion) embryo callus or embryo's exploitation.The method of the transforming monocots that can also adopt in addition, is protoplast transformation.After the gene transformation, adopt general method to screen and regenerate and be integrated with the plant of expressing the unit.

Of the present inventionly also relate in one aspect to a kind of method that seed becomes large transgenic plant that produces, said method comprising the steps of:

1) nucleotide sequence of the present invention and/or carrier are transformed into plant callus, or with reconstitution cell of the present invention infection plant callus;

2) utilize described callus regeneration transgenic plant.

In the present invention, described plant optimization is monocotyledons, described monocotyledons includes but not limited to paddy rice, millet, wheat, Chinese sorghum, corn, be particularly preferably paddy rice, described paddy rice includes but not limited to, in spend 9, in spend 10, in spend 11, the Taibei 309, No. 8, Danjiang River, cloud rice No. 2, Shanyou 63, Shan excellent 608, Feng You 22, Guizhou Province excellent 88, II excellent 416, II excellent 107, II excellent 128, II excellent 718, Zhunliangyou 527, No. 1, river farming, assorted 0152, Anhui rice 88, Anhui rice 90, Anhui rice 92, Anhui rice 94, Anhui rice 96, Anhui rice 185, Anhui rice 187, Anhui rice 189, Anhui rice 191, Anhui rice 193, Anhui rice 195, Anhui rice 197, Anhui rice 199, Anhui rice 201, Anhui rice 203, Anhui rice 205, Anhui rice 207, and Tianjin former 101 (above-mentioned rice varieties all can available from emblem, Anhui good fortune company limited of merchant farmers').In one embodiment of the invention, described paddy rice is that Japan is fine.

In the present invention, described seed becomes and refers to greatly in the situation that full degree is suitable, and it is large that the seed volume becomes, and thousand seed weight increases.

In one embodiment of the invention, the contriver increases from the paddy rice Yuanjiang River and obtains gene BGIos1003, this gene recombination is entered the recombinant expression vector that obtains containing this gene in the p6 carrier of new structure, transform agrobacterium tumefaciens, utilize restructuring Agrobacterium-mediated Transformation Rice Callus, the character observation of the GUS dyeing by Rice Callus, transgenic plant root, leaf GUS dyeing and transgenic paddy rice seed, and with the contrast of the tissue that does not change the BGIos1003 gene over to or plant, prove that the BGIos1003 gene can promote plant seed to become greatly.

The beneficial effect of the invention

The present invention utilizes high throughput sequencing technologies, genetic transformation by gene, excavate and promote seed to become large BGIos1003 gene, described gene can improve the thousand seed weight of transgenic plant greatly, proved that the BGIos1003 gene is the functional gene relevant with the quantitative character of control rice grain size, this will be conducive on molecular level physiological Mechanism and mechanism that this proterties of further investigated more forms, reach the Reasonable Regulation And Control effect to yield and quality, to the great meaning of genetic breeding generation of paddy rice.

Explanation about the biomaterial preservation

The present invention relates to following biomaterial:

Common wild-rice Yuanjiang River seed, it is preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on September 6th, 2010, i.e. Chinese Typical Representative culture collection center (CCTCC), deposit number is CCTCC P201011.

Description of drawings

Fig. 1 p6 carrier schematic diagram.

The GUS coloration result of the Rice Callus of Fig. 2 through transforming.Wherein, the Rice Callus (right side) that is transformed by the restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003 with BGIos1003 gene of the present invention presents blueness after GUS dyeing; Rice Callus (contrast, a left side) color after GUS dyeing without the restructuring agrobacterium tumefaciens EHA105-p6 plasmid of BGIos1003 gene of the present invention does not change.

The seed of Fig. 3 transgenic paddy rice is observed.Wherein, the rice grain of the Agrobacterium-Mediated Transformation through containing the p6+BGIos1003 recombinant vectors (Fig. 3 is right) is compared with negative control (Fig. 3 is left), and seed is larger.

Embodiment

Below in conjunction with embodiment embodiment of the present invention are described in detail, but it will be understood to those of skill in the art that the following example only is used for explanation the present invention, and should not be considered as limiting scope of the present invention.Unreceipted actual conditions person among the embodiment carries out according to the condition of normal condition or manufacturers's suggestion.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.

The pcr amplification of embodiment 1BGIos1003 gene and the structure of pMD18-T+BGIos1003 recombinant vectors

Pcr amplification

Use plant genome DNA to extract test kit (TIANGEN plant genes group DNA extraction test kit; catalog number (Cat.No.): the DP320-02) genomic dna of extraction common wild-rice Yuanjiang River (Oryza.rifupongonYuanjiang); according to the sequence of this gene in gDNA; design one couple of PCR specificity amplification primer (upstream primer F1 at head and the tail respectively; add restriction enzyme site BamHI and protection base; downstream primer R1 adds restriction enzyme site Xba I and protection base).Take the gDNA of the Yuanjiang River of said extracted as template, high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase carries out pcr amplification.As shown in table 1.

The PCR system of table 1 goal gene amplification

The pcr amplification program is: 94 ℃ of denaturation 5min, and then with 94 ℃ of sex change 45s, 55 ℃ of annealing 50s, 72 ℃ are extended 90s, carry out 35 reaction cycle, and last 72 ℃ are extended 7min.

Wherein, upstream primer F1:GC GGATCCGCTTGTTTCACTTCCATCGC (SEQ ID NO:2) contains BamH I restriction enzyme site.Downstream primer R1:GC TCTAGATTCAGCGAGAGGATTGACC (SEQ ID NO:3) contains Xba I restriction enzyme site.

Pcr amplification product separates through 1.0% agarose gel electrophoresis, obtains size and is the band about 1570bp, uses TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) carry out the purifying recovery.

The structure of pMD18-T+BGIos1003 recombinant vectors

Pcr amplification product obtained above is carried out T/A clone (pMD18-T plasmid, TaKaRa, D103A), transform intestinal bacteria, the order-checking of picking positive colony proves accurately.

Wherein, T/A clone's condition of contact is as follows:

T/A linked system: 10 μ l

pMD18-T 1μl

2×solution I 5μl

Pcr amplification product (recovery Insert Fragment) 10-20ng, fixed according to its concentration

DdH ₂O polishing to 10 μ l

(the new sesame in Ningbo SDC-6) the middle connection more than the 8h, obtains the pMD18-T+BGIos1003 recombinant vectors at the energy-conserving intelligent thermostatic bath in 16 ℃.To transform as follows intestinal bacteria through the product after the above-mentioned connection:

(Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides to take out the competent cell 100 μ l DH5 α that prepare according to Calcium Chloride Method shown in " molecular cloning experiment guide " (third edition, Science Press) from Ultralow Temperature Freezer; Perhaps can be from for example: Shanghai be given birth to the worker and is buied), after melting on ice, add the as above connection product of gained of 10 μ l, be the pMD18-T+BGIos1003 recombinant vectors, stir evenly gently, ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, the SOC substratum that adds 4 ℃ of precoolings of 600 μ l (is specifically filled a prescription and is seen " molecular cloning experiment guide ", the third edition for details, Science Press), 37 ℃ of 220rpm recovery 45min, the centrifugal 30s of 8000rpm removes supernatant, leave and take 150 μ l, with the mixture after the remaining resuspended precipitation of 150 μ l supernatants, blow gently evenly, granulated glass sphere coating LB (adds kantlex, it is Kan) dull and stereotyped that (concrete prescription sees " molecular cloning experiment guide " for details, the third edition, Science Press), be inverted for 37 ℃ and cultivate 16-24h.Acquisition contains the recombination bacillus coli of pMD18-T+BGIos1003 cloning vector, called after DH5 α-BGIos1003.Shenzhen Huada Genetic Technology Co., Ltd checks order to the BGIos1003 in the pMD18-T+BGIos1003 cloning vector, and sequencing result is consistent with SEQ ID NO:1.Show that the BGIos1003 gene order is correct in the pMD18-T+BGIos1003 cloning vector of acquisition.

The structure of embodiment 2p6 recombinant vectors

1) structure of the pcr amplification of corn Ubiquitin promoter fragment and pMD18-T+Ubi recombinant vectors

Ubi promotor pcr amplification

Use plant genome DNA to extract test kit (TIANGEN plant genes group DNA extraction test kit, catalog number (Cat.No.): the DP320-02) genomic dna (http://www.maizegdb.org/) of extraction corn variety B73 (Zea mays mays cv.B73), according to the sequence of this promotor in corn B73gDNA, design one couple of PCR specificity amplification primer (upstream primer F2:GG at head and the tail respectively CTGCAGTGCAGCGTGACCCGGTCGT (SEQ ID NO:4) adds restriction enzyme site Pst I and protection base, downstream primer R2:GG CTGCAGAAGTAACACCAAAC (SEQ ID NO:5) adds restriction enzyme site Pst I and protection base).Take the gDNA of the corn B73 of said extracted as template, high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase carries out pcr amplification.As shown in table 2.

The PCR system of table 2Ubi promotor amplification

The pcr amplification program is: 94 ℃ of denaturation 5min, and then with 94 ℃ of sex change 45s, 55 ℃ of annealing 50s, 72 ℃ are extended 90s, carry out 35 reaction cycle, and last 72 ℃ are extended 7min.

Pcr amplification product is after 1.0% agarose gel electrophoresis separates, and (catalog number (Cat.No.): DP209-03) purifying reclaims to use TIANGEN sepharose DNA to reclaim test kit.

The structure of pMD18-T+Ubi recombinant vectors

Pcr amplification product obtained above is carried out T/A clone (pMD18-T plasmid, TaKaRa, D103A), transform intestinal bacteria, the picking positive colony is checked order by Shenzhen Huada Genetic Technology Co., Ltd, proves accurately.

Wherein, T/A clone's condition of contact is as follows:

T/A linked system: 10 μ l

pMD18-T 1μl

2×solution I 5μl

Pcr amplification product 10-20ng, fixed according to its concentration

DdH ₂O polishing to 10 μ l

(the new sesame in Ningbo SDC-6) the middle connection more than the 8h, obtains the pMD18-T+Ubi recombinant vectors at the energy-conserving intelligent thermostatic bath in 16 ℃.To transform as follows intestinal bacteria through the product after the above-mentioned connection:

(Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides to take out the competent cell 100 μ l DH5 α that prepare according to Calcium Chloride Method shown in " molecular cloning experiment guide " (third edition, Science Press) from Ultralow Temperature Freezer; Perhaps can be from for example: Shanghai be given birth to the worker and is buied), after melting on ice, add the as above connection product of gained of 10 μ l, it is the pMD18-T+Ubi recombinant vectors, stir evenly gently ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, the SOC substratum (concrete prescription sees " molecular cloning experiment guide ", the third edition, Science Press for details) that adds 4 ℃ of precoolings of 600 μ l, 37 ℃ of 220rpm recovery 45min, the centrifugal 30s of 8000rpm removes supernatant, leaves and takes 150 μ l, with the mixture after the remaining resuspended precipitation of 150 μ l supernatants, blow gently evenly, granulated glass sphere coating LB (kantlex) is dull and stereotyped, and (concrete prescription sees " molecular cloning experiment guide ", the third edition for details, Science Press), be inverted cultivation 16-24h for 37 ℃.Acquisition contains the recombination bacillus coli of pMD18-T+Ubi cloning vector, called after DH5 α-Ubi.

2) structure of pCAMBIA-1301+Ubi recombinant vectors

The conversion that makes up according to the little extraction reagent kit of the common plasmid of TIANGEN (catalog number (Cat.No.): operational manual DP103-03), from step 1) has the cloning vector pMD18-T+Ubi that extracts bacillus coli DH 5 alpha-Ubi of promotor Ubi with corn Ubi promoter sequence; Carry out enzyme with corresponding restriction enzyme Pst I (NEB) behind the purifying and cut, then reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim corresponding promoter fragment with TIANGEN sepharose DNA.

(Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides to cut the pCAMBIA-1301 plasmid with restriction enzyme Pst I enzyme simultaneously; Perhaps can buy from for example auspicious Gene Tech. Company Limited of Shanghai state, the primary source of the pCAMBIA-1301 plasmid of the said firm is The CAMBIA Bios (biological open source) Licensee, Australia) and reclaim.

Enzyme is cut system: 50 μ l

ddH ₂O 34.9μl

10*buffer 35μl

Pst I 0.1μl(10U)

Cloning vector pMD18-T+Ubi or pCAMBIA-1301 plasmid 10 μ l (＜1000ng)

The carrier segments of the promoter fragment Ubi that reclaims and recovery according to T4 ligase enzyme (TaKaRa, D2011A) operation instructions, is connected according to following condition:

Linked system: 10 μ l

10×T4buffer 1μl

The pCAMBI A-1301 plasmid 1 μ l (20ng) that reclaims

The promotor Ubi Insert Fragment 10-20ng that reclaims, fixed according to its concentration

DdH ₂O polishing to 9.5 μ l

T4ligase(TaKaRa，D2011A) 0.5μl

In 16 ℃ of energy-conserving intelligent thermostatic baths (the new sesame in Ningbo, SDC-6) the middle connection more than the 8h.

The competent cell DH5 α that 100 μ l Calcium Chloride Method are made takes out from Ultralow Temperature Freezer, after melting, adds the connection product above the 10 μ l on ice, stir evenly gently ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min adds the SOC of 4 ℃ of precoolings of 600 μ l, 37 ℃ of lower 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, blow gently even, granulated glass sphere coating LB (Kan) is inverted for 37 ℃ and cultivates 16-24h.Obtain recombinant vectors pCAMBIA-1301+Ubi.

Detect as primer pair gained recombinant vectors pCAMBIA-1301+Ubi carries out PCR take F2 and R2 respectively, to contain required promotor Ubi among the conclusive evidence gained recombinant vectors pCAMBIA-1301+Ubi.

3) structure of the pcr amplification of NOS terminator and pMD18-T+NOS recombinant vectors

According to the sequence of NOS terminator in the pCAMBI A-1301 plasmid, design one couple of PCR specificity amplification primer (upstream primer F3:GG at head and the tail respectively GAGCTCGAATTTCCCCGATCGTTCAA (SEQ ID NO:6) adds restriction enzyme site Sac I and protection base, downstream primer R3:GG GAATTCCCGATCTAGTAACATAGAT (SEQ ID NO:7) adds restriction enzyme site EcoR I and protection base).Take the pCAMBIA-1301 plasmid of said extracted as template, high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase carries out pcr amplification.As shown in table 3.

The PCR system of table 3NOS terminator amplification

Pcr amplification product obtained above is carried out T/A clone (pMD18-T plasmid, TaKaRa, D103A), transform intestinal bacteria, obtain to contain the recombination bacillus coli of pMD18-T+NOS cloning vector, called after DH5 α-NOS.The picking positive colony is checked order by Shenzhen Huada Genetic Technology Co., Ltd, proves accurately.

4) pCAMBIA-1301+Ubi+NOS is the structure of p6 recombinant vectors

Cloning vector pMD1g-T+NOS according to the little extraction reagent kit of the common plasmid of TIANGEN (catalog number (Cat.No.): operational manual DP103-03), extraction step 3) structure; Carry out enzyme with corresponding restriction enzyme Sac I (NEB) and EcoRI (NEB) behind the purifying and cut, then reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim corresponding NOS terminator fragment with TIANGEN sepharose DNA.Cut pCAMBI A-1301+Ubi plasmid and recovery with restriction enzyme Sac I and EcoR I enzyme simultaneously.

Enzyme is cut system: 50 μ l

ddH ₂O 34.9μl

10*buffer 15μl

Sac I 0.1μl(10U)

EcoR I 0.1μl(10U)

Carrier pMD18-T+NOS or pCAMBIA-1301+Ubi plasmid 10 μ l (＜1000ng)

The terminator fragment NOS that reclaims is connected with the T4 ligase enzyme with the carrier segments of recovery, and transformed competence colibacillus cell DH5 obtains recombinant vectors pCAMBIA-1301+Ubi+NOS, i.e. p6 (referring to Fig. 1).

The structure of embodiment 3p6+BGIos1003 recombinant vectors

Extract the pMD18-T+BGIos1003 plasmid, and cut rear recovery BGIos1003 gene fragment with restriction enzyme BamHI/Xba I enzyme, extract simultaneously the p6 plasmid, and cut rear recovery large fragment with corresponding restriction enzyme BamHI/XbaI enzyme, to reclaim product and connect, transformed competence colibacillus cell DH5 α obtains recombinant vectors p6+BGIos1003 subsequently.Screening positive clone carries out checking order after PCR detects and determines.

The preparation of embodiment 4 restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003 cells

The p6+BGIos1003 transfer vector plasmid that method is as described in Example 3 made up, conversion is according to " molecular cloning the experiment guide " (third edition, agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 of the method for calcium chloride Science Press) preparation (has been 200910238992.0 on September 22nd, 2010 at application number, denomination of invention is open in the patent documentation of a kind of promotor BgIosP587, Preparation Method And The Use, deposit number is CCTCC M 209315) competent cell, concrete grammar is as follows:

Agrobacterium tumefaciens competent cell EHA105 is taken out in Ultralow Temperature Freezer, as for thawing on ice.After the thawing, add the p6+BGIos1003 recombinant vectors of 5 μ l, gently mixing, ice bath 10min puts into the freezing 5min of liquid nitrogen, 37 ℃ of 5min that thaw, the LB liquid nutrient medium that adds 800 μ l normal temperature, 28 ℃ of 160rpm recovery 3h, the centrifugal 30s of 8000rpm sucks supernatant, staying 200 μ l blows even, coat and be added with (50mg/l Kan, 10mg/l Rif specifically fill a prescription referring to table 4) on the two anti-YM culture medium flat plates of kan-rif (kantlex-Rifampin).Be inverted for 28 ℃ and cultivated 2-3 days.

Carry out PCR detects and cuts the screening transformant by the BamHI/XbaI enzyme take F1 and R1 as primer.What pcr amplification went out that approximately 1570bp left and right sides band and enzyme cut out about 1570bp left and right sides band is the restructuring agrobacterium tumefaciens of recombinant vectors p6+BGIos1003.

Among the present invention, according to the restructuring Agrobacterium with recombinant vectors p6+BGIos1003 that obtains such as above-mentioned method, called after restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003; Set up simultaneously the restructuring agrobacterium tumefaciens with empty carrier p6, namely EHA105-p6 is used for subsequent experimental as negative control of the present invention.

The inducing and transforming of embodiment 5 Rice Callus

Inducing paddy rice callus in accordance with the following steps, and transform described callus with restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003 respectively.

1) (be 200910238992.0 on September 22nd, 2010 at application number with the fine seed of paddy rice Japan, denomination of invention is open in the patent documentation of a kind of promotor BgIosP587, Preparation Method And The Use, deposit number is CCTCC P200910) shell, 70% ethanol surface sterilization 30s, then use the clorox sterilization 30min of available chlorine 1.5%, acutely shake during this time, clean 5 times with aqua sterilisa after the sterilization; Seed after the sterilization is placed on the N6D substratum (specifically filling a prescription referring to table 4), seal with sealed membrane; 29.5 ℃ illumination cultivation 3-4 week;

2) choose the callus (yellow-white, drying, diameter 1-3mm) of active growth, 29.5 ℃ of illumination cultivation are 3 days on new N6D substratum;

3) the constructed single bacterium colony of restructuring agrobacterium tumefaciens (restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003) of picking such as embodiment 4 respectively, in adding microbiotic (50mg/l Kan, 10mg/l Rif) upper streak culture 3 days of YM substratum (specifically filling a prescription referring to table 5, table 6), 28 ℃ of culture temperature; The above-mentioned restructuring agrobacterium tumefaciens of scraping places the AS (Acetosyringone that has added 30 μ l 100mM respectively, Syringylethanone) in the 30ml AAM substratum (specifically filling a prescription referring to table 7), gentle resuspended described restructuring agrobacterium tumefaciens cell (restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003);

4) callus with succeeding transfer culture places the sterilization culture dish; Will be such as step 3) the restructuring agrobacterium tumefaciens suspension of preparation pours in the culture dish, and callus is immersed 15min;

5) outwell restructuring agrobacterium tumefaciens suspension, callus is sopped up unnecessary liquid with sterilization thieving paper; On N6-AS substratum (prescription is referring to table 8), put a sterilization filter paper, add the AAM substratum of 1ml such as the above-mentioned AS of containing, callus is transferred on the filter paper; The sealing culture dish, 28 ℃ of dark 48-60h that cultivate;

6) infected callus is placed the 50ml sterile tube, shake cleaning with aqua sterilisa, until supernatant liquor becomes clarification; Callus is soaked in the sterilized water that contains 500mg/l Pyocianil (Carb) to kill the restructuring agrobacterium tumefaciens; Remove moisture unnecessary on the callus with sterilization thieving paper, then transfer them on the N6-AS substratum that contains 1mg/l hygromycin B (HmB) and 50mg/l Carb; Seal culture dish with sealed membrane, 29.5 ℃ of illumination cultivation 3-4 weeks.

The expression of GUS in embodiment 6 Rice Callus

For detecting the expression through goal gene GUS in the Rice Callus of embodiment 5 described conversions, according to Chen S Y etc. at Journal of Integrative Plant Biology, 2008,50 (6): the described method of 742-751, dye to the Rice Callus that transforms with restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003 respectively.

The prescription of GUS staining fluid (1ml): 610 μ l 0.2M Na ₂HPO ₄Solution (pH=7.0); 390 μ l 0.2M NaH ₂PO ₄Solution and 10 μ l 0.1M X-gluc.

To be immersed in the GUS staining fluid with the Rice Callus that restructuring agrobacterium tumefaciens EHA105-p6+BGIos1003 transforms, 37 ℃ of insulations are blue to occurring, Taking Pictures recording, the result as shown in Figure 2, contain the Rice Callus (Fig. 2 right) of the Agrobacterium-Mediated Transformation of p6+BGIos1003 recombinant vectors and present blueness after dyed, negative control (Fig. 2 is left) color after GUS dyeing does not change.Result's demonstration, p6+BGIos1003 of the present invention changes Rice Callus over to.

Embodiment 7: the expression of GUS in the transgenic paddy rice seedling

The callus that obtains among the embodiment 5 is transferred to MS-R division culture medium (concrete prescription sees Table 9) the differentiation seedling that contains 50mg/l hygromycin B (HmB); Seal culture dish with sealed membrane, 29.5 ℃ of illumination cultivation 3-4 weeks; Treat to transfer to when seedling grows to 3-4cm 1/2MS root media (specifically filling a prescription referring to the table 10) screening of taking root that contains 50mg/l hygromycin B (HmB).

The GUS dyeing course of transgenic paddy rice seedling is with the dyeing course of callus among the embodiment 6.The result shows, presents blueness after the root of the rice seedlings of the Agrobacterium-Mediated Transformation through containing the p6+BGIos1003 recombinant vectors and leaf are dyed, and the root of negative control and leaf color after GUS dyeing does not change.Result's demonstration, p6+BGIos1003 of the present invention changes in the rice seedlings.

Embodiment 8: the character observation of transgenic paddy rice seed

After the transgenic paddy rice seedling of example 7 to be performed and contrast seedling grew 20 days in substratum, parallel condition was transplanted into the land for growing field crops, and parallel condition is cultured to the results seed.63 strains have been observed respectively in transgenic paddy rice and contrast, the full seed of 59 strain transgenic paddy rices wherein, and all than contrast large (referring to Fig. 3, wherein the right side is the transgenic paddy rice seed that contains the BGIos1003 gene, the negative contrast in left side).

Employed relevant culture medium prescription is described as follows in the embodiment of the invention:

Below in the relevant substratum alleged " conventional sterilization " refer to the sterilization of following condition: 121 times vapor sterilization 20min.

Table 4N6D substratum

Regulate pH value to 5.8 with 1N potassium hydroxide, according to a conventional method sterilization after the sealing.

N ₆Macro mother liquor (20X): saltpetre 56.60g, potassium primary phosphate 8.00g, ammonium sulfate 9.26g, sal epsom 3.70g, calcium chloride 3.32g, distilled water is settled to 1L, and 4 ℃ save backup.

N ₆Micro mother liquor (1000X): potassiumiodide 0.80g, boric acid 1.60g, manganous sulfate 3.33g, zinc sulfate 1.50g, distilled water is settled to 1L, and 4 ℃ save backup.

Molysite (Fe ₂EDTA) stock solution (100X): with 3.73g b diammonium disodium edta (Na ₂EDTA2H ₂O) and 2.78g FeSO ₄.7H ₂O dissolves respectively, mixes and usefulness.Be settled to 1000ml with distilled water, 70 ℃ of temperature are bathed 2h, cool off rear 4 ℃ of preservations and are no more than 1 month.

N ₆VITAMIN stock solution (1000X): vitamins B ₁0.10g, vitamins B ₆0.05g, nicotinic acid 0.05g, glycine 0.20g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations were no more than for 1 week.

Table 5YM liquid nutrient medium (containing 50mg/L Kan, 10mg/L Rif)

Table 6YM solid medium (containing 50mg/L Kan, 10mg/L Rif)

Table 7AAM substratum

Add 1N potassium hydroxide and regulate pH value to 5.2, conventional sterilization.

AAM macro (10X): 2.5g magnesium sulfate heptahydrate (MgSO ₄7H ₂O), 1.5g Calcium dichloride dihydrate (CaCl ₂2H ₂O), 1.33g sodium dihydrogen phosphate dihydrate (NaH ₂PO ₄.2H ₂O), distilled water is settled to 1L, and 4 ℃ save backup.

The single water manganous sulfate of AAM micro (100X): 0.7g (MnSO ₄H ₂O), 0.2g Zinc Sulphate Heptahydrate (ZnSO ₄7H ₂O), 0.075g potassiumiodide (KI), 0.3g boric acid (H ₃BO ₃), 25mg Sodium Molybdate Dihydrate (Na ₂MoO ₄.2H ₂O), 2.5mg cupric sulfate pentahydrate (CuSO ₄.5H ₂O), 2.5mg CoCL2 6H2O (CoCl ₂.6H ₂O), distilled water is settled to 1L, and 4 ℃ save backup.

AAM organic (1000X): 0.75g glycine (Glycine), 0.1g nicotinic acid (Nicotinic acid), 0.1g VB ₆(Pyridoxine), 1g VB ₁(Thiamine), distilled water is settled to 100ml, and 4 ℃ save backup.

Molysite (Fe ₂EDTA) stock solution (100X): see Table 2.

Table 8N6-AS is substratum altogether

Transfer pH to 5.2.

N ₆Macro mother liquor (20X), N ₆Micro mother liquor (1000X), molysite (Fe ₂EDTA) stock solution (100X), N ₆VITAMIN stock solution (1000X): all see Table 2.

Table 9MS-R division culture medium

Transfer pH value to 5.8, the usual manner sterilization.

MS macro (20X): ammonium nitrate 33.0g, saltpetre 38.0g, potassium primary phosphate 3.4g, sal epsom 7.4g, calcium chloride 8.8g dissolves one by one, then is settled to 1L with distilled water under the room temperature, 4 ℃ of preservations.

MS micro (1000X): manganous sulfate 16.90g, zinc sulfate 8.60g, boric acid 6.20g, potassiumiodide 0.83g, Sodium orthomolybdate 0.25g, copper sulfate 0.025g, cobalt chloride 0.025g, mentioned reagent is at room temperature dissolved and is settled to 1L with distilled water, 4 ℃ of preservations.

MS VITAMIN stock solution (1000X): vitamins B ₁0.010g, vitamins B ₆0.050g, nicotinic acid 0.050g, glycine 0.200g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations were no more than for 1 week.

Molysite (Fe ₂EDTA) stock solution (100X): see Table 2.

Table 101/2MS root media

Transfer pH value to 5.8.

MS macro (20X) sees Table 9.

MS micro (1000X) MS VITAMIN stock solution (1000X) sees Table 9.

Molysite (Fe ₂EDTA) stock solution (100X): see Table 4.

Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various modifications and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.

Claims (20)

1. the nucleotide sequence of gene BGIos1003 and/or the reconstitution cell that contains the carrier of described nucleotide sequence and/or contain described carrier be used for to promote plant seed to become large purposes; Described plant is paddy rice, and the sequence of described gene BGIos1003 is sequence shown in the SEQ ID NO:1.

2. the purposes of claim 1, wherein said paddy rice are that Japan is fine.

3. the purposes of claim 1, wherein said carrier is expression vector.

4. the purposes of claim 1, wherein said reconstitution cell are restructuring agrobacterium tumefaciens cells.

5. the nucleotide sequence of gene BGIos1003 and/or the reconstitution cell that contains the carrier of described nucleotide sequence and/or contain described carrier are for the preparation of transgenic plant or be used for the purposes of plant breeding; Described plant is paddy rice, and the sequence of described gene BGIos1003 is sequence shown in the SEQ ID NO:1.

6. the purposes of claim 5, wherein said paddy rice are that Japan is fine.

7. the purposes of claim 5, wherein said carrier is expression vector.

8. the purposes of claim 5, wherein said reconstitution cell are restructuring agrobacterium tumefaciens cells.

9. callus is for the preparation of transgenic plant or be used for the purposes of plant breeding; Described plant is paddy rice, the sequence of described gene BGIos1003 is sequence shown in the SEQ ID NO:1, described Transformation of Callus gene BGIos1003 nucleotide sequence and/or contain the carrier of described nucleotide sequence and/or infected the reconstitution cell that contains described carrier.

10. the purposes of claim 9, wherein said paddy rice are that Japan is fine.

11. the purposes of claim 9, wherein said carrier is expression vector.

12. the purposes of claim 9, wherein said reconstitution cell are restructuring agrobacterium tumefaciens cells.

13. one kind promotes plant seed to become large method, described method comprises the nucleotide sequence of gene BGIos1003 and/or the carrier that contains described nucleotide sequence is transformed into plant, or with contain described nucleotide sequence and/or contain the carrier of described nucleotide sequence and/or contain described carrier reconstitution cell infection plant; Described plant is paddy rice, and the sequence of described gene BGIos1003 is sequence shown in the SEQ ID NO:1.

14. the method for claim 13, wherein said paddy rice are that Japan is fine.

15. the method for claim 13, wherein said carrier is expression vector.

16. the method for claim 13, wherein said reconstitution cell are restructuring agrobacterium tumefaciens cells.

17. a method that produces the large transgenic plant of seed change said method comprising the steps of:

1) nucleotide sequence of gene BGIos1003 and/or the carrier that contains described nucleotide sequence are transformed into plant callus, or with the reconstitution cell infection plant callus that contains described carrier;

2) utilize described callus regeneration transgenic plant;

Described plant is paddy rice, and the sequence of described gene BGIos1003 is sequence shown in the SEQ ID NO:1.

18. the method for claim 17, wherein said paddy rice are that Japan is fine.

19. the method for claim 17, wherein said carrier is expression vector.

20. the method for claim 17, wherein said reconstitution cell are restructuring agrobacterium tumefaciens cells.

Images