CN102086468B - Compound for preventing and treating human papillomavirus infectious diseases and screening method thereof - Google Patents
Compound for preventing and treating human papillomavirus infectious diseases and screening method thereof Download PDFInfo
- Publication number
- CN102086468B CN102086468B CN2010101754205A CN201010175420A CN102086468B CN 102086468 B CN102086468 B CN 102086468B CN 2010101754205 A CN2010101754205 A CN 2010101754205A CN 201010175420 A CN201010175420 A CN 201010175420A CN 102086468 B CN102086468 B CN 102086468B
- Authority
- CN
- China
- Prior art keywords
- helicase
- compound
- hpv
- human papillomavirus
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a method for screening a compound for preventing and treating human papillomavirus (HPV) infectious diseases. The method adopts structural computer-aided drug design to screen on the basis of the structure of human papillomavirus E1 helicase to obtain a candidate compound capable of inhibiting E1. The screening method has the characteristics of convenience, time conservation and high efficiency. The invention also discloses the compound obtained by the method such as trovafloxacin and derivatives thereof, gatifloxacin and derivatives thereof and the like. Inhibitors for the human papillomavirus E1 helicase have the characteristics of high specificity and strong pertinency, helps to prevent and treat HPV infection and diseases related with the HPV infection such as cervical cancer, genital warts and the like.
Description
Technical field
The present invention relates to treat the field relevant with cervical cancer, especially at the E1 of design and use helicase suppressor factor, with prevention or relevant cervical cancer of treatment HPV and other diseases with prevention of human papillomavirus infection.
Background technology
Cervical cancer (Cervical Cancer) is No. second killer (WHO's data) who is only second to the threat women life and health of mammary cancer in the world wide, causes every year to surpass 300,000 adult females approximately because of suffering from cervical cancer death.The cause of disease that has confirmed at present to cause cervical cancer is due to the infecting of DNA oncovirus of human papillomavirus (Human Papillomavirus is called for short HPV).Mainly through two sexual transmissions, obligate infects particularly reproductive organ of human body epithelial cell to this virus, and part virus carrier shows the various clinical symptom after repeated infection.After the women receives high-risk type (HPV16, HPV18 etc.) virus infection; The small portion patient is unusual by initial cervical cytology; The uterine neck endotheliocyte knurl appearance that develops into I-III becomes (CINI-III) and wellability cervical carcinogenesis (ICC), finally develops into fatal cervical cancer.
HPV virus has formed hundreds of variation type in evolution of long period of time, 13 kinds of high-risk types such as HPV16, HPV18 wherein have been identified and can cause cervical cancer.Low dangerous type (HPV6, the HPV11 etc.) virus infection of part can cause the pointed condyloma at men and women's gamogenesis organ position.HPV is except directly causing cervical cancer, and new research material also provides evidence, and the infection of HPV has this to concern closely with cancers such as lung bronchogenic carcinoma, the rectum cancer, oral cancer and skin carcinomas probably.According to the pertinent data of the WHO of WHO, except causing cervical cancer, HPV infect also maybe with 60% skin carcinoma, 60% the esophageal carcinoma, the morbidity of 50% lung cancer, 50% mammary cancer, 25% human great cancers such as oral cancer is relevant.
The compound that also has no at present both at home and abroad effective prevention and treatment human papillomavirus mainly is because the means (like the big flux screening of generally casting net etc.) through routine of being difficult to find and have a high inhibitor compound of specificity to this virus.And because we infect the molecular structure of the necessary helicase of poison breeding and the grasp and the understanding of molecule mechanism to human papilloma virus; We can be through carrying out the simulation and the analysis of computingmachine to molecular structure; And through with the structure be the basis molecular docking with computingmachine the macromole storehouse is effectively screened; Thereby can be from hundreds of thousands of to library of molecules up to a million very fast select can the proteic minority of combining target compound, thereby verify very soon and confirm to have the compound that target protein is had the inhibit feature of high specific through experiment sieving.
Summary of the invention
The objective of the invention is to above-mentioned defective of the prior art; A kind of convenience is proposed, save time, prevent efficiently and treats the screening method of the compound of human papilloma virus infection class disease; And the compound of high, with strong points prevention of the specificity that screens through above-mentioned screening method and treatment human papilloma virus infection class disease is provided, pointed out its application on diseases such as prevention and treatment HPV infection, cervical cancer and pointed condyloma by it.
The technical scheme that realizes above-mentioned purpose is following:
The screening method of the compound of a kind of prevention and treatment human papilloma virus infection class disease adopts architecture computer ancillary drug method of design, is that screen on the basis with human papillomavirus E1 helicase structure, obtains suppressing the candidate compound of E1.
Further, described is that the basis comprises with human papillomavirus E1 helicase structure:
(a) structure of E1 protein molecular structure of deciding by atomic coordinate and six aggressiveness that form by E1;
(b) complex structure that the E1 protein molecular of being decided by atomic coordinate combines with ATP or ADP;
(c) E1 albumen separate structures or with a compound or polypeptide bonded complex structure.
Further, above-mentioned screening method also comprises E1 helicase Function detection, and said E1 helicase function detecting method adopts the electrophoretic mobility test.
The present invention also provides and has utilized the prevention that above-mentioned screening method obtains and the compound of treatment human papilloma virus infection class disease, and said compound is trovafloxacin and verivate, Gatifloxacin and verivate thereof.
Further, human papilloma virus infection class disease of the present invention comprises cervical cancer or pointed condyloma.
Be the three-dimensional molecular structure that the present invention mainly is to use papilloma virus E1 helicase, design and screen special, be used to treat and prevent HPV to infect and relevant cervical cancer and pointed condyloma medicine the E1 suppressor factor.According to the inventionly illustrated one and design, and the method for experiment sieving finds the effective inhibition compound to the E1 molecular target through structure and computational analysis.These compounds are combined in the different point of E1 spatial minor structure, are used to destroy the function of E1 self, blocking-up E1 and DNA, with Triphosaden, and with the interaction of E2, all these is that E1 duplicates requisite function to viral genome.The invention provides design to the anti-HPV viruses molecule medicine that suppresses the E1 function; Screening; Identification and the method that detects also provide the application of this type inhibitor compound in prevention and treatment virus infection and cancer (including but not limited on HPV and cervical cancer and pointed condyloma, use these compounds) simultaneously.
The present invention mainly is based on following principle and carries out related compound screening:
HPV is a dna virus, and the gene of virus is DNA.After virus got into the human body epithelial cell, its DNA gene must be in time multiplexed cell system, could accomplish viral breeding and infect, and duplicating of viral DNA gene must the viral helicase of HPV, and E1 albumen is opened the viral DNA two strands.Simultaneously, HPV E1 and the proteic combination of HPV E2 and interaction also have crucial effect to the starting of duplicating of viral DNA, thereby HPV E1 and HPV E2 also claim the dna replication dna promotor.The proteic function of above-mentioned HPV E1 is: ATP enzyme and dna helicase; Discern and be combined in the viral origin point of dna replication dna with the form of six times of complex bodys; It is viral dna replication must.The proteic function of HPV E2 is: the main regulatory factors that virogene is transcribed; Form with dipolymer combines with the virus transcription primer; Participate in the viral dna replication process; Interact with E1 and make E1 add to the virus replication originating point.
Duplicating of human papillomavirus needs several different biological activity links, comprises that viral DNA opened the dna double chain by the dna helicase E1 of virus, and starts the dna replication dna primer with this as duplicating the enzymatic polymerization enzyme of template by cell.The inhibition compound of the sudden change of E1 helicase or E1 enzyme can cause the viral dna replication failure, and duplicating of blocking virus prevents and viral the infecting of inhibition HPV to reach, thus the effect of prevention and treatment cervical cancer.
The helicase of human papillomavirus E1 helicase and human body cell (claiming MCM) does not almost have the conservative property of aminoacid sequence, and the MCM helicase is the enzyme that duplicates for people's somatic chromosome.HPV E1 has basic different (Brewster et al, PNAS, 2008) with MCM on three-dimensional arrangement.Because the helicase of E1 is absolutely necessary to duplicating of HPV virus, and the sequence of E1 and MCM helicase is all different with structure, like this, the E1 helicase provides the drug target of the very high anti-virus of fabulous specificity.Because E1 is the high specific molecule target to virus, can help to reduce toxicity to human body cell to the medicine of E1.
Owing to parsed the crystalline structure of HPV E1 protein molecular, the analysis that we can be through molecular structure and set up molecular structure model and design and develop the small-molecule drug of the effective inhibitors of E1 enzyme as antiviral and anti-uterus carcinoma.The effective micromolecular inhibitor of these E1 enzymes also can be used as molecular tool simultaneously, is used for further studying the function and the regulatory mechanism of helicase.
Up to the present, still do not have any effective medicine and suppress duplicating of people's palilate knurl HPV virus, infect and breed.To the small-molecule drug of the helicase of human papillomavirus E1, be a kind of active drug of brand-new inhibition HPV virus replication.According at the E1 of this demonstration and the atomic structure model of Nucleotide (ATP and ADP) complex body; We can be through the detail calculation and analysis to structural models; Help our design to the micromolecular inhibitor of E1 helicase so that reach active inhibition to E1 itself, to E1 and DNA or with the inhibition that mutually combines of E2 or other dna replication protein; Thereby can suppress duplicating of HPV virus effectively, can be used for treating HPV infection and diseases such as cervical cancer of being correlated with and pointed condyloma.
Architecture basics-human papillomavirus E1 helicase the structure that designs in the face of the architecture computer ancillary drug that relates among the present invention is down done further to introduce:
The human papillomavirus of indication of the present invention (HPV) E1 albumen is meant and comprises 50 or the E1 peptide sequence of amino acids more, or longer E1, comprises total length E1 albumen, E1 itself, or as the E1 fusion rotein.
The protein of a homologous protein comprises the protein that is not natural appearance, and one or several amino acid is arranged; But be not limited to one or several amino acid whose difference or deleted (for example, the fragment that protein blocks), or be inserted into down; Replace and/or derive (like glycosylation, phosphorylation, acetylize; Myristoylation, isoprenylation etc.).Preferably aminoacid sequence with specific homologous protein at least with have an appointment 30% similarity of a kind of natural protein.
A purified proteins matter according to the present invention, is one and can comprises purifying or partially purified protein from its natural surroundings (promptly having received artificial behaviour to do process), the protein that genetically engineered produces, or synthesize the protein that produces.Therefore, " purifying " do not reflect which kind of degree of protein purification.Preferably a purified proteins matter, especially its fragment are used the protein of genetically engineered generation, or synthesize the protein (if a less protein peptide) that produces.Term " segment " is meant a proteinic part.As the result that the structured data of human papillomavirus E1 is analyzed, the 26S Proteasome Structure and Function characteristic of this proteinic various piece has significant values to the area of computer aided drug design method.The method that the pulsating 26S Proteasome Structure and Function of human papillomavirus E1 polypeptide protein part that uses designs with screening of medicaments is a part of the present invention.
The invention provides the atomic coordinate of the three-dimensional structure of HPV E1 helicase and nucleotide complex.The present invention also provides the medicine combining site of confirming to suppress this E1 helicase according to this three-dimensional structure information, comprises the formation that stops six aggressiveness, and the combination of Nucleotide reaches the interaction with HPV E2.The present invention has also comprised the screening experiment of the helicase inhibitor medicaments of the special E1 of being directed against.
An embodiment of the present invention, relating to the structure is that inhibitor compound is identified on the basis, is used for regulating and suppresses the effect of papillomavirus E1 helicase at virus replication.This inhibition compound can be regulated the ability of E1 protein binding Nucleotide or DNA, or with the proteic binding ability of another papillomavirus E2.This method is that an architecture computer ancillary drug method of design is the basis, comprises the steps: that (1) provides the atomic coordinate that can confirm the E1 three-dimensional structure, comprises the atomic coordinate of E1 three-dimensional structure described herein; And (2) filter out the inhibitor compound that is combined in some ad hoc structures zone through the anacom of three-dimensional structure is simulated.
Here having disclosed suitable structure and mode configuration can be in order to do the medicinal design to E1.In structure is the object construction of first-selection of the drug design method on basis, comprises any structure model that produces with any modeling method, as replacing through structural molecule and the modelling of homologous sequence.
According to the present invention, first-selected medicinal design step is screened through computingmachine from the DB of one or more compounds, and DB next according to the E1 three-dimensional structure and compound matees and docks.If after confirming suitable compound by method of the present invention screening, can directly synthesize and test this compound this adjusting and restraining effect to one or more human papilloma E1 helicases, and and the concrete mode of bonded of E1.
An embodiment in the medicinal design that is the basis with the E1 structure of the present invention is to comprise confirming binding compounds with it according to the structure of E1 monomer or six aggressiveness, and this compound one of can bonded condition is with combining site the complementary shape to be arranged.This method is referred to herein as " method of geometry ".In a method of geometry; Internal degree of freedom (with corresponding molecular conformation spatial local minimum) is through only considering two; Interact and to be reduced for how much of rigid body (hard sphere); The site that one of them rigid body contains one " pocket " or " ditch " is used to combine second rigid body (and complementary molecule in shape with it is like part, or compound).This method of geometry is at Kuntz et al., J.Mol.Biol., and p.269 vol.161, also has description in 1982.Compound molecule with this method of geometry is confirmed can and be revised through design, comes that to possess chemistry at the binding site of this pocket or ditch complementary to satisfy these compounds, forms like hydrogen bond ionic linkage, or interaction such as Van der Waals key.
According to the present invention, use the suitable selected compound of method test of the present invention can comprise protein, polypeptide or other organic molecules and inorganic molecule.Suitable organic molecule comprises organic molecule.Peptide is meant that the compound of small molecular weight produces two or more amino acid through hydrolysis.Polypeptide is meant two or more peptides.The design of first-selected treatment compound comprises the peptide that " L " and/or " D " amino acid is formed, and organic molecule, or homogeneity or heteropolymerization thing comprise straight chain or branched chain polymer is arranged.
One can combine E1 and can modulate the active candidate compound of (regulate, revise, raise, reduce) E1 helicase can be discussed above through the present invention be that basic screening method is confirmed with the structure.As for candidate's compound the actual binding ability of E1 albumen target spot being can be used on some known technology discussed in more detail below confirms.One " compound of inferring " be one unofficial whether have regulate to suppress active compound, at least for such compound concerning the binding ability of E1 and/or regulate the biological activity.Therefore, it is the process for screening and identifying on basis with the structure that generally acknowledged compound library can use what discuss here, filters out and can combine and regulate, even imitate target protein or one or more candidate compounds in site wherein.In addition, target protein candidate compound that can combine E1 also can use structure discussed above from the beginning to design as the medicinal design on basis.
The present invention can comprise detection and non-detection based on cell based on cell in order to the actual effect of testing these compounds that filter out.The detection that preferred especially acellular is the basis is electrophoretic mobility test (EMSA).More particularly, electrophoretic mobility test (EMSA) can be used for monitoring whether untwisting by the E1 success when ATP is arranged of double-stranded DNA.Can utilize existence that this technology the is evaluated at candidate compound external changes of function of E1 helicase with absent the time.This method is very useful to the helicase molecule inhibitor of screening E1.
The method of the proteinic ability of candidate compound bonded is weighed in other suitable detections, and/or the method for weighing these compounds and can influence other albumen of protein bound or part comprises immunoblotting, enzyme-linked immunosorbent assay (ELISA); Radioimmunology (RIA), immunoprecipitation, surface plasma body resonant vibration; Chemoluminescence, fluorescence polarization, phosphorescence; Immunohistochemical analysis, substance assistant laser desorpted/ionization time flight (MALDI-TOF) mass spectrum, microcytometry; Gene chip, microscope, fluorescence-activated cell sorting (flow cytometer) and flow cytometer.
An integral part of the present invention is the compound that is identified by aforesaid method, through the restraining effect to the E1 helicase, can be used to prevention or treatment HPV infection and cervical cancer.These compounds both can be through traditional solid phase synthesis and preparation known in the art.
This scope of invention comprises that not only various isomer possibly exist, but the various mixture of isomers that also possibly form.
Compound among the present invention forms salt with acid when having alkalescence amino, or when acidic-group (like the carboxylic acid phosphonic acids) is arranged with alkali formation salt.The salt of all these product innovations helps separating and/or purifying.The pharmaceutically acceptable in this way words of the salt of this type bronsted lowry acids and bases bronsted lowry have special value.Pharmaceutically acceptable acids salt comprises hydrochloric acid, oxalic acid, sulfuric acid, nitric acid, Phenylsulfonic acid, tosic acid, acetic acid, toxilic acid, tartrate etc.The basic salt of drug use comprises sodium, potassium, calcium, the salt of magnesium.
Except the medicinal design based on structure with the rational faculty, itself and E1 bonded suppressor factor can be found through above-mentioned helicase Function detection, just to measure the inhibition ability of certain compound to helicase.In this way, we have confirmed that some can combine the compound of E1 six aggressiveness, and E1 six aggressiveness helicase functions are had inhibiting compound, comprise trovafloxacin (trovafloxacin) and Gatifloxacin (gatifloxacin).Therefore, one aspect of the present invention is a kind of through for need to accept to use travafloxacin or gatifloxacin and verivate thereof to prevent on this treatment Mammals or treat that HPV infects and the method for cervical cancer.
Compound of the present invention can be used for directly using for patient.Patient is a kind of animal preferably, is more preferably Mammals, is preferably human.This compound can use through various forms and route, for example, and outside the oral or intestines.The outer use of intestines includes but not limited to by following use route: intravenous injection, intramuscular injection, subcutaneous injection, ophthalmology, oral cavity and hypogloeeis; The part comprises ophthalmology, skin, and eye, nose and rectum suck through inflation and aerosol; Abdominal cavity and rectum systematicness, reproductive system.
The doctor will determine the only dosage of this medicine to be used for prevention or therapeutic purpose, and it can be decided with particular patient.The doctor can begin to increase progressively from low dose earlier usually, up to the dosage that reaches optimum therapeuticing effect.Therapeutic dose generally can be from about 0.1 to about 1000 mg/day; Preferably from about 10 to 100 mg/day; Or about 0.1 to 50 milligram/kg body weight amount, preferably every day about 0.1 health to about 20 milligrams/kg body weight, can be in the use of several different dosages units.High dosage can be used for orally using at about about 2 times to 4 times dosage.
The compound that also has no effective prevention and treatment human papillomavirus at present both at home and abroad.Technology of the present invention and achievement can be used for finding and develop has the infection and its disease of causing of the high inhibitor compound of specificity as prevention and treatment human papilloma to this virus.Compared with prior art (like the big flux screening of high labour's intensity of generally casting net); Tool of the present invention has adopted modern protein molecular crystallography; Computingmachine is to the simulation of molecular structure and analysis with based on the molecular docking of structure; And the effectively foundation of test system; Thereby can be from hundreds of thousands of to library of molecules up to a million very fast select can the proteic minority of combining target compound, and through experiment sieving verify very soon and the compound of inhibit feature confirming target protein is had high specific as the active drug of anti-human papilloma.
Description of drawings
Fig. 1 is the gel electrophoresis figure of the elution peak different piece of HPV 35E1 Protein S uperdex-200;
Fig. 2 is the proteic Superdex-200 column chromatography of HPV35 E1 figure;
Fig. 3 is the double-stranded DNA active testing figure as a result that untwists of E1 helicase;
Fig. 4 is the detected result figure of E1 helicase to the ATP hydrolytic activity;
Fig. 5 is the molecular structure of E1: wherein A is the side-looking structural representation of E1 six aggressiveness; B is the plan structure synoptic diagram of E1 six aggressiveness; C is the monomeric N-end structure of E1 territory; D is the monomeric C-end structure of E1 territory;
Fig. 6 is for to carry out the resulting figure as a result of computingmachine molecular docking according to structure: wherein A is the joint portion bitmap that trovafloxacin (trovafloxacin) is docked at E1 six aggressiveness structures, and B is the joint portion bitmap that Gatifloxacin (gatifloxacin) is docked at E1 six aggressiveness structures;
Fig. 7 is the structure iron of candidate compound trovafloxacin;
Fig. 8 is the structure iron of candidate compound Gatifloxacin;
Fig. 9 is candidate compound trovafloxacin and the Gatifloxacin suppressor factor action diagram to the E1 helicase.
Embodiment
Below in conjunction with accompanying drawing the preferred embodiments of the present invention are described, should be appreciated that preferred embodiment described herein only is used for explanation and explains the present invention, and be not used in qualification the present invention.All per-cents are to be by volume with all solvent ratios by weight, except as otherwise noted.
Embodiment 1: the mensuration of proteic preparation of human papillomavirus (HPV) E1 and enzymic activity
(1) the proteic preparation of human papillomavirus (HPV) E1
The proteic preparation of human papillomavirus (HPV) E1 will be example with the E1 helicase of HPV35 type.HPV35 E1 helicase expression and purification be to use escherichia expression system.The plasmid that uses is that pGEX-2T is carrier.The condition of inducing the E1 protein expression is the IPTG of 0.4mM, 16 degree, 16 hours.Cytoclasis is at 50mM Tris-HCl, pH 8.0 (4 degree are down), and 0.25M NaCl, 5mM EDTA, 5mM DTT, 5% glycerine is in the solution of 0.2%NP-40, with French crusher or ultrasonic drilling machine.The centrifugal 40000xG of cytoclasis thing, the GST-E1 in the supernatant proposes with the method for gsh (glutathione) with affinity chromatography.The GST-E1 fusion rotein uses zymoplasm to cut, and the E1 albumen of wash-out is purified with the Superdex-200 column chromatography.As shown in Figure 1, the E1 albumen after Superdex-200 purifies has very high purity.The E1 albumen of purifying is at 100mM HEPES, pH7.5, and 250mM NaCl is after concentrating in the solution of 5mM DTT and 5% glycerine, in the preservation down of-80 degree.
The detection of (two) six aggressiveness polymerizing powers
The polymerization of six aggressiveness is essential conditions that E1 embodies the helicase function.It is to use the Superdex-200 GFC that E1 monomer molecule formation six gathers.Protein (2 mg/ml, 1mg total protein) and 1mMATP inject on the Superdex-200 pillar.As shown in Figure 2, HPV35 E1 albumen forms six aggressiveness and small portion monomer in Superdex-200 column chromatography analytical method, flows out pillar with six aggressiveness and small amounts of monomer.And the restraining effect that compound forms six aggressiveness can use this method to detect.
(3) helicase activity detects
The substrate that the detection of helicase activity is used forms from two complementary strand annealing.Article two, the sequence of complementary strand is: (dT)
44GCTCGTGCAGACGTCGAGGTGAGGACGAGCTCCTCGTGACCACGand CGTGGTCACGAGGAGCTCGTCCTCACCTCGACGTCTGCACGAGC (dT)
44((dT)
44Be meant 44 dT).This substrate comprises two the single stranded DNA bifurcated tails of 44 nucleic acids and the double-stranded DNA of 44 Nucleotide, and 5 ' end has the radio-labeled of 32P.It is at 65 ℃ that the E1 helicase activity detects, and 60 minutes, 20 microlitres contained 0.5nM double-stranded DNA substrate, 75nM E1 protein monomer; 30nM Tris (pH8), 75mM NaCl, 50nM Potassium ethanoate; 10mM MgAcetate, 5mM ATP, 1mMDTT and 0.1 mg/ml bovine serum albumin.Reaction terminating is to contain 100mM EDTA with 5ul, 0.5%SDS, 0.1% xylene blue AS, 0.1% tetrabromophenol sulfonphthalein and 50% glycerine.Reactant detects and quantizes the degree of untwisting of substrate DNA with radioautography behind 12% polyacrylamide gel electrophoresis, thus the level of activity that goes out helicase.Be illustrated in figure 3 as the double-stranded DNA active testing result of untwisting of E1 helicase; Double-stranded DNA (dsDNA) substrate is separated by the E1 helicase and is split into single stranded DNA (ssDNA) product; 1-5 road E1 protein concentration successively decreases, and the 6th road has only the dsDAN substrate, and the 7th road dsDNA substrate is heated to 100 degree.
(4) atpase activity is measured
The E1 helicase carries out with two kinds of methods the hydrolysis of ATP.Method is (referring to Greenleaf et al. in first; 2008); There are not E1 six glycoprotein polyprotein precursors of ATP (3000Ci/mmol) and 1uM of γ-32P mark of isotope-labeled ATP 10-500uM and 10uM to mix the back in the reaction 30 minutes down of 25 degree, then with a thin version chromatography detection ATP hydrolysis degree (as shown in Figure 4).Second method is that the detection kit (Invitrogen company) of use Enzchek detects hydrolysis and the phosphorus release of E1 helicase to ATP.All reactions are carried out helicase and are carried out at 65 degree, use the E1 monomeric protein of 1nM, the ATP of 50-2500 μ M.Solutions employed is that the solution of helicase activity mensuration is identical.Data Michaelis (Michaelis-Menten) equation comes analytical data.Be illustrated in figure 4 as the detection of E1 helicase to the ATP hydrolytic activity, along with the increase of E1 helicase concentration, the amount that ATP is hydrolyzed into ADP is also big more.
Embodiment 2: papilloma virus E1 helicase proteic crystallization, molecular structure model and drug screening
(1) the proteic crystallization of papilloma virus E1 helicase is an example with bovine papilloma virus E1.This E1 protein expression with separate available instance 1 described the carrying out of purifying.The crystallization of papilloma virus E1 albumen is the protein concentration with 20mg/ml, is containing 100mM MES (pH 7.5), 300mM KPO4 (pH 7.5), and 190mM NaCl in the solution of 8%PEG6K, with hanging drop gas phase diffusion method, carries out under the condition of 18 degree.The brilliant bag of crystalline constant is: P2 (1) 2 (1) 2 (1), a=133.211, b=179.192, and c=185.350, α=β=g=90.The crystalline diffraction resolution is 3.1 to suffer.
(2) crystalline structure molecular model
The overall structure of six aggressiveness of E1:
Shown in Fig. 5 (A, B), the E1 subunit is assembled into homology six poly structures of a centre gangway.See that from the side six aggressiveness rings are shown as the ring of two different diameters, little ring and bottom are encircled greatly at the top.The thickness of ring six aggressiveness of these two levels approximately is 80 dusts.See from the top, go out from bigger bottom part ring center radiation from six points at six aggressiveness rings.
The overall conformation of six aggressiveness has asymmetric outward appearance, and the different spaces distance is arranged between the different subunits.Exist the combining site that bigger bottom is ATP between these each subunits, ATP combines to be used for opening the dna double chain with hydrolysis driving E1 six aggressiveness conformational change or to untwist between subunit.The concrete binding site of ATP is located at the place, Walker-A territory of the AAA+ of big bottom.A subunit contributes Walker-A (GPPNTGKS) and Walker-B (AALVDD) and transmitter 1 (VTSNI) to be used for combining the phosphoric acid part of ATP; And contiguous subunit provides a l-arginine " finger " (Arg538) most important to the ATP hydrolysis, and the amino acid of transmitter 2 (Lys425) and some other periphery also participates in combining and hydrolysising ATP.
The monomer structure of E1:
In the monomer structure of E1, comprise two separate structures territories, the AAA+ territory of less N-end structure territory and big C end.The structural domain of N-end is alpha-helix entirely, but the structural domain of C-end have that 5 β-Jie Gous form to β-version, shown in Fig. 5 (C, D).One-piece construction resembles structure (Li el al., Nature, 2003 of SV40 large T antigen very much; Gai et al., Cell, 2004), the territory is held to C-in the N-end territory that has a long alpha-helix to connect.In C-end territory, it has comprised β-hairpin structure, is to be positioned in the six aggressiveness centre gangwaies, and DNA is combined and the very important effect of having untwisted.
(3) computer model drug screening
Crystalline structure according to bovine papilloma virus E1; Set up the structural models of human papilloma virus 16 and 18 type E1 helicases through computer simulation; And, the small molecules chemline is carried out the computingmachine butt joint, to filter out the compound that can combine E1 with this structural models.In this way; We filter out some can be combined in the compound on the human papilloma 16 type E1; Wherein structure such as Fig. 7,8 of two kinds of candidate compound trovafloxacins and Gatifloxacin (trovafloxacin and gatifloxacin); Shown in they are combined in site on the E1 albumen respectively shown in Fig. 6 A, B, the free energy of two molecular dockings is respectively-7.69kcal/mol and-6.95kcal/mol.
(4) to the detection of E1 activity inhibitor
Effect detects with full pattern to E1 helicase suppressor factor with calculating candidate compound trovafloxacin that simulation filters out and Gatifloxacin (trovafloxacin and gatifloxacin) based on structure, whether can suppress the activity that E1 unties the double-stranded DNA substrate to test these compounds.As shown in Figure 9, trovafloxacin is added in the HPV16E1 helicase reaction mixture, lets reaction carry out 60 minutes, uses the gel electrophoresis analysis reaction result then.Trovafloxacin (trovafloxacin) concentration is used for 20uM, 40uM, 80uM, 160uM.Can find out that by Fig. 9 trovafloxacin (trovafloxacin) concentration suppresses the function that the E1 double-stranded DNA untwists into strand with linear mode.Equally, the increase of Gatifloxacin (gatifloxacin) concentration (40uM, 80uM, 120uM, and 240uM) also demonstrates similar linear inhibition activity to the helicase of E1, but its restraining effect does not have trovafloxacin strong.The 4-7 road demonstrates trovafloxacin concentration increases the enhancing that E1 helicase function is suppressed.The 8-11 road demonstrates gatifloxacin concentration increases the enhancing that E1 helicase function is suppressed.
What should explain at last is: the above is merely the preferred embodiments of the present invention; Be not limited to the present invention; Although the present invention has been carried out detailed explanation with reference to previous embodiment; For a person skilled in the art, it still can be made amendment to the technical scheme that aforementioned each embodiment put down in writing, and perhaps part technical characterictic wherein is equal to replacement.All within spirit of the present invention and principle, any modification of being done, be equal to replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (3)
1. the application of trovafloxacin in the medicine of preparation prevention or treatment human papilloma virus infection class disease.
2. the application of Gatifloxacin in the medicine of preparation prevention or treatment human papilloma virus infection class disease.
3. application according to claim 1 and 2 is characterized in that, said human papilloma virus infection class disease is meant cervical cancer or pointed condyloma.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101754205A CN102086468B (en) | 2010-05-18 | 2010-05-18 | Compound for preventing and treating human papillomavirus infectious diseases and screening method thereof |
| CN201210282752.2A CN102902895B (en) | 2010-05-18 | 2010-05-18 | The screening technique of the compound of prevention and treatment human papillomavirus infectious diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101754205A CN102086468B (en) | 2010-05-18 | 2010-05-18 | Compound for preventing and treating human papillomavirus infectious diseases and screening method thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210282752.2A Division CN102902895B (en) | 2010-05-18 | 2010-05-18 | The screening technique of the compound of prevention and treatment human papillomavirus infectious diseases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102086468A CN102086468A (en) | 2011-06-08 |
| CN102086468B true CN102086468B (en) | 2012-08-01 |
Family
ID=44098473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101754205A Active CN102086468B (en) | 2010-05-18 | 2010-05-18 | Compound for preventing and treating human papillomavirus infectious diseases and screening method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102086468B (en) |
-
2010
- 2010-05-18 CN CN2010101754205A patent/CN102086468B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| 郭洪寅.氟喹诺酮类药物的研究进展.《河北医药》.2003,第25卷(第4期),第311-312页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102086468A (en) | 2011-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mariano et al. | Structural characterization of SARS-CoV-2: where we are, and where we need to be | |
| Zhu et al. | Molecular biology of the SARs‐CoV‐2 spike protein: A review of current knowledge | |
| Kaur et al. | Genetic comparison among various coronavirus strains for the identification of potential vaccine targets of SARS-CoV2 | |
| Brisse et al. | Comparative structure and function analysis of the RIG-I-like receptors: RIG-I and MDA5 | |
| Hoffman et al. | Structure-based identification of an inducer of the low-pH conformational change in the influenza virus hemagglutinin: irreversible inhibition of infectivity | |
| De Breyne et al. | Translational control of coronaviruses | |
| US7894996B2 (en) | Structure of the hepatitis C NS5A protein | |
| Follis et al. | Furin cleavage of the SARS coronavirus spike glycoprotein enhances cell–cell fusion but does not affect virion entry | |
| Buchmeier | Arenaviruses: protein structure and function | |
| JP2002531113A (en) | Protein transduction system and methods of use | |
| Jiang et al. | Virus-specific CTL responses induced by an H-2Kd-restricted, motif-negative 15-mer peptide from the fusion protein of respiratory syncytial virus | |
| Manhas et al. | Covid-19 pandemic and current medical interventions | |
| Pal et al. | Compilation of potential protein targets for SARS-CoV-2: Preparation of homology model and active site determination for future rational antiviral design | |
| CN102086468B (en) | Compound for preventing and treating human papillomavirus infectious diseases and screening method thereof | |
| Seyoum Tola | The Role of Ubiquitin‐Proteasome System in the Pathogenesis of Severe Acute Respiratory Syndrome Coronavirus‐2 Disease | |
| CN102902895A (en) | Compound for preventing and treating human papillomavirus infection disease and screening method of compound | |
| US11561217B2 (en) | Compounds inhibiting Nef-calnexin interaction | |
| Niu et al. | Bioinformatic analysis of the S protein of human respiratory coronavirus | |
| WO2022056547A1 (en) | Protease biosensors and methods of virus detection | |
| JP2005524392A (en) | Virus capsid assembly intermediate | |
| Roy et al. | Exploring the COVID-19 potential targets: Big challenges to quest specific treatment | |
| Javorsky et al. | Viral manipulation of cell polarity signalling | |
| US20070087330A1 (en) | Viral deconstruction through capsid assembly in vitro | |
| US20220372082A1 (en) | Compositions and methods for treating sars-cov-2 infections | |
| Sharma et al. | Protein structure and function prediction of SARS-CoV 2: prospective antivirus active drug binding sites |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |