CN102041266A

CN102041266A - Construction of carriers for prokaryotic expression and eukaryotic expression of candidate gene of porcine rota virus vaccines

Info

Publication number: CN102041266A
Application number: CN2009101971581A
Authority: CN
Inventors: 易建中; 肖长峰
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2009-10-14
Filing date: 2009-10-14
Publication date: 2011-05-04

Abstract

The invention discloses a construction method for carriers for prokaryotic expression and eukaryotic expression of candidate gene of porcine rotavirus vaccines VP4 and VP7, comprising: cloning and prokaryotic expression of genes of porcine rotavirus VP4, construction and transfection of the recombinant vector of genes of rotavirus VP4 and VP7 and the expression carriers of insect cell sf9, and the construction of a recombinant vector of genes of rotavirus VP4 and VP7 and the expression vector of yeast cells GS115.

Description

The prokaryotic expression of Porcine rotavirus vaccine candidate gene and Construction of eukaryotic thereof

Technical field

The present invention relates to field of biological genes, be specifically related to porcine rotavirus VP4, VP7 vaccine candidate Prokaryotic Expression and Construction of eukaryotic thereof.

Background technology

(Porcine Rotavirus PRV) belongs to the lonely Viraceae rotavirus of arc intestines member to porcine rotavirus, is one of main pathogen that causes the baby pig disease virus diarrhea.

PRV mainly is present in the disease pig and with the digestive tube of malicious pig, be discharged to external environment with ight soil after, pollute feed, water purification, pad grass and soil etc., through the digestive tube approach susceptible pig is infected.The toxin expelling time can last for days, serious environment pollution, in addition virus to external world environment indomitable resistibility is arranged, (Rotavirus RV) becoming between pig, middle pig, the piglet infection cycle repeatedly, takes root in the pig farm for a long time to make rotavirus.Therefore, diagnosis fast and accurately and effective immunoprophylaxis are the anti-keys of making of this disease.Virus outer capsid albumen VP4 and VP7 are the main immune protective antigens of RV, the virus that neutralizes, elimination are infected playing a major role by its antibody that stimulates body to produce; And the clone of these two genes and expression, significant for preparation new generation vaccine and specific diagnosis antigen.

In recent years, lot of domestic and foreign scholar has carried out the research work of novel Rotavirus Vaccine in a deep going way, and has obtained new progress, but the development of rotavirus nano vaccine is not also reported at present.

Summary of the invention

Technical problem to be solved by this invention provides the method for a kind of porcine rotavirus VP4, VP7 vaccine candidate Prokaryotic Expression and construction of eukaryotic expression vector thereof, to overcome the shortcoming and defect of prior art.

For achieving the above object, the present invention realizes by the following technical solutions:

Described porcine rotavirus VP4, VP7 vaccine candidate Prokaryotic Expression and Construction of eukaryotic method thereof, comprise the clone of porcine rotavirus VP4 gene and the structure and the transfection of prokaryotic expression, rotavirus vp 4, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors, and the structure of rotavirus vp 4, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors.

The clone of described porcine rotavirus VP4 gene and the method for prokaryotic expression, specific as follows:

Extract total RNA from the pig lung, go up the porcine rotavirus virus PRV nucleocapsid protein VP4 gene nucleic acid sequences Design primer of announcing according to GeneBank, increasing through RT-PCR obtains the coding region of pig VP4 gene, inserts in the pMD18-T carrier; Through restriction enzyme BamHI and XhoI double digestion, the fragment that reclaims is inserted among the prokaryotic expression carrier pGEX-4T-1 called after pGEX-4T-1-VP4 again; Recombinant plasmid pGEX-4T-1-VP4 transformed into escherichia coli BL21 (DE3) competent cell, through IPTG induce, the SDS-PAGE electrophoretic analysis, obtain the recombination fusion protein that molecular weight is 58KDa; After ultrasonication, it is inclusion body for the SDS-PAGE electrophoretic analysis.

The structure and the transfection method of described rotavirus vp 4, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors, specific as follows:

Go up porcine rotavirus virus PRV nucleocapsid protein VP4, the VP7 gene nucleic acid sequences Design primer of announcing according to GeneBank, amplify nucleocapsid protein VP4, the VP7 gene of PRV with the RT-PCR method; The pig VP4 that obtains, the coding region of VP7 gene are inserted in the pMD 18-T carrier; Again through restriction enzyme EcoRI and XhoI double digestion, with the VP4 that reclaims, VP7 gene fragment clone to insect expression vector PFastbacl, with recombinant plasmid called after PFastbacl-2-VP4, PFastbacl-2-VP7 respectively; PFastbacl-2-VP4, PFastbacl-2-VP7 plasmid are transformed into respectively in the DH10Bacl competent cell, itself and helper plasmid generation swivel base are recombinated; The positive recombinant that shows the baculovirus that has obtained to contain rotavirus gene by the screening of blue hickie, PCR qualification result; This linearized baculovirus recon of purifying makes its transfection insect cell, gathers in the crops recombinant virus behind the 3d, shows according to cellular form variation and PCR evaluation: the success of recombinant virus transfection sf9 cell; Collect viral supernatant, it is contained VP4, VP7 virus supernatant called after A1, B1 respectively; Respectively with A1, B1 for virus inoculation in sf9, treat to receive collecting cell after a large amount of pathologies of cell, PCR is accredited as positive-virus, its supernatant respectively called after A2, B2 for virus.

The construction process of described rotavirus vp 4, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors, specific as follows:

Go up porcine rotavirus virus PRV nucleocapsid protein VP4, the VP7 gene nucleic acid sequences Design primer of announcing according to GeneBank, amplify nucleocapsid protein VP4, the VP7 gene fragment of PRV with the RT-PCR method; The pig VP4 that obtains, the coding region of VP7 gene are inserted in the pMD18-T carrier; Again through restriction enzyme EcoRI and NotI double digestion, with the VP4 that reclaims, VP7 gene fragment clone to yeast cell to express carrier PPIC9K, with its called after PPIC9K-3-VP4, PPIC9K-3-VP7.

The application of method in proteic large-scale purification of the clone of described porcine rotavirus VP4 gene and prokaryotic expression.

The Development Application of the structure of described rotavirus vp 4, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors and transfection method protein expression and vaccine in insect cell sf9.

Construction process application in the expressing protein in the pichia spp cell of described rotavirus vp 4, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors.

The present invention chooses the gene fragment of coding VP4, adopts the pGEX-4T-1 prokaryotic expression carrier that has the GST sequence label, has obtained expression.GST promotes Expression of Fusion Protein, makes GST and VP4 jointly by abduction delivering.Have the zymoplasm restriction enzyme site between GST and VP4 albumen, GST can be excised from fusion rotein, thereby be further purified target protein, this lays the foundation for next step Porcine rotavirus vaccine research.

The expressed target protein of the present invention is that formal representation with inclusion body is in tenuigenin.This mode can obtain a large amount of target proteins, but because of the target protein that exists with the inclusion body form can not correctly fold in translation process, and can not pass through glycosylation after translating, so biologically active seldom.Inclusion body only could recover normal biological activity after the abundant sex change of external process, renaturation refolding.Albumen can be made antigen and use after simple sex change, washing and renaturation.

The present invention is to the clone and the baculovirus transfection success of PRVVP4, VP7 gene, for VP4, the expression of VP7 gene in insect cell sf9 later on laid a good foundation.The gene that obtains can also be used to prepare probe in detecting PRV and carry out the RV somatotype except being used for the research of gene difference between PRV gene structure and different serotypes.The eukaryotic expression product of this gene possesses natural protein characteristic, can be used as the indispensable composition of the inspection specific diagnostic antigen of side PRV and many serotype recombinant vaccine, has avoided doing with live virus the limitation and the danger of antigen and vaccine.Simultaneously, the cloning and expression of VP4, VP7 gene is for the molecular biological characteristic of further studying PRV is laid a good foundation.

The present invention is successful the clone of PPIC9K plasmid to PRV VP4, VP7 gene, for the expression in later VP4, the VP7 pichia spp GS15 cell is laid a good foundation.Goal gene is expressed in pichia spp GS115 and can be overcome the defective that influences its function in the protein modified deficiency of expression in escherichia coli, protein expression is relatively low with respect to the expense of other eukaryotic cell expressions such as insect cell expression in pichia spp GS115 simultaneously, be fit to large-scale fermentation culture and express, produce target protein, for approach is opened up in the production of vaccine later on.But its expressed proteins has or not gap to await further to study in function and between the albumen of mammalian cell and insect cell expression.The gene that obtains can also be used to prepare probe in detecting PRV and carry out the RV somatotype except being used for the research of gene difference between PRV gene structure and different serotypes.Simultaneously, the cloning and expression of VP4, VP7 gene is for the molecular biological characteristic of further studying PRV is laid a good foundation.

Description of drawings

Fig. 1 is PRV VP4 gene PCR amplification, wherein M:DNA marker DGL 2000,1: negative control, 2:VP4 gene PCR product.

Fig. 2 is a PMD18-T-VP4 bacterium colony PCR The selection result, and wherein M:DGL 2000,1-4: bacterium colony PCR product.

Fig. 3 is the PMD18--T-VP4 sequencing result.

Fig. 4 is a PGEX-4T-1-VP4 bacterium colony PCR The selection result, and wherein M:DGL 2000,1-4: bacterium colony PCR product.

Fig. 5 is recombinant vectors and rotavirus vp 4 gene test results, M:1kb DNAladder Marker wherein, and 1:PGEX-4T-1BamH I and XhoI enzyme is cut, and 2:PGEX-4T-1-VP4BamH I and XhoI enzyme is cut the 3:VP4PCR product.

Fig. 6 is IPTG inducible protein detected result, wherein M: the lower molecular weight standard protein; 1:GST, 2-3:PGEX-4T-1-VP4 induces the result; 4 do not induce bacterium.

Fig. 7 is IPTG inducible protein detected result, wherein M: the lower molecular weight standard protein; 1-3 is respectively 3h, 4h, 5h induces the result; 4-5: ultrasonic centrifuged deposit and supernatant.

Fig. 8 is a PMD18-2-VP4 bacterium colony PCR The selection result, and wherein M:DL 2000; 1-2: bacterium colony PCR product.

Fig. 9 cuts detected result for PMD 18-2-VP7 enzyme, and wherein M:DL 2000; 1-2:PMD18-2-VP7EcoRI and XhoI enzyme are cut.

Figure 10 is a PFastbacl-2-VP4 bacterium colony PCR The selection result, and wherein M:DL 2000; 1-4: bacterium colony PCR product.

Figure 11 is a PFastbacl-2-VP7 bacterium colony PCR The selection result, and wherein M:DL 2000; 1-4: bacterium colony PCR product.

Figure 12 is reorganization plasmid enzyme restriction detected result, M:1KB Ladder DNA Marker wherein, and 1:PFastBacl-2-VP7EcoRI and XhoI enzyme are cut; 2:PFastbacl-2-VP4EcoRI and XhoI enzyme are cut.

Figure 13 is PFastBacl-2-VP4, and the PFastBacl-2-VP7 enzyme is cut detected result.

Figure 14 VP7 detected result that checks order.

Figure 15 is a sf9 individual layer control cells.

Figure 16 is a sf9 individual layer transfectional cell.

Figure 17 is a VP4 virus liquid PCR detected result.

Figure 18 is a VP7 virus liquid PCR detected result.

Figure 19 is a PPIC9K-VP4 gene PCR amplification.

Figure 20 is a PPIC9K-VP7 gene PCR amplification.

Figure 21 is PPIC9K-3-VP4 and PPIC9K-3-VP7 bacterium colony PCR The selection result.

Figure 22 is reorganization plasmid enzyme restriction detected result.

Embodiment

Below in conjunction with specific embodiment technical scheme of the present invention is described in further detail.

The clone and the prokaryotic expression of embodiment 1 porcine rotavirus VP4 gene

1. material

1.1 pathological material of disease, bacterial strain and plasmid

Pathological material of disease: the PRV lung tissue, preserve in this laboratory.

Bacterial strain: competent cell TOP10, BL21 (DE3) (geneplow Ltd).

Plasmid: plasmid vector pMD 18-T Vector is available from precious biotechnology (Dalian) company limited, and prokaryotic expression carrier pGEX-4T-1 plasmid is so kind as to give by Shandong Agricultural University animal genetic experiment chamber.

1.2 enzyme and main agents

Enzyme: AMV ThermoScript II, rTaq archaeal dna polymerase are available from precious biotechnology (Dalian) company limited; Restriction enzyme BamHI, Xhol etc. are available from NEB company.

Main agents: TRNZOL-A+ is available from sky root company; RNA enzyme inhibitors RNase, DNAMarker DL2000, DNA Marker DL10000, a small amount of glue reclaim test kit (Agarose GelDNA Purification Kit Ver.2.0), all available from precious biotechnology (Dalian) company limited; Peptone, yeast extract are available from OXXID LTD.Tris alkali is available from ancient cooking vessel state; The Goldview dyestuff is available from the match Parkson.

1.3 microbiotic

Penbritin ddH ₂O is mixed with 100mg/ml, and with 0.22 μ m membrane filtration degerming ,-20 ℃ of preservations are standby; Kantlex (Kan) is used ddH ₂O is mixed with 100mg/ml, and with 0.22 μ m membrane filtration degerming ,-20 ℃ of preservations are standby; Gentamicin (Gen) is used ddH ₂O is mixed with 7mg/ml, and with 0.22 μ m membrane filtration degerming ,-20 ℃ of preservations are standby; Tsiklomitsin (Tet) is used ddH ₂O is mixed with 10mg/ml, and with 0.22 μ m membrane filtration degerming ,-20 ℃ of preservations are standby.

1.4X-gal

Use N, the N-dimethylformamide is mixed with 100mg/ml, and with 0.22 μ m membrane filtration degerming ,-20 ℃ keep in Dark Place standby.

1.5IPTG

Use ddH ₂O makes 100mol/L, and with 0.22 μ m membrane filtration degerming ,-20 ℃ keep in Dark Place standby.

1.6 key instrument equipment

The Sigma refrigerated centrifuge, BIO-RAD pcr amplification instrument, DYY-III voltage stabilization and current stabilization electrophoresis apparatus (Liuyi Instruments Plant, Beijing), the HZS-H water bath chader, 37 ℃ of constant incubators, ultraviolet gel imaging analysis system (UVP company, Britain), ultraviolet spectrophotometer (Pharmacia BiotechINC), the quick vortex mixer of SK-1 vortex etc.

2. method

2.1PRV the extraction of RNA in the lung tissue

The RNA extraction is extracted total RNA specification sheets by TRNZOL-A+ and is carried out.

2.2PRV-VP4 gene RT-RCR amplification

2.2.1 primer design is with synthetic

Go up the PRV-VP4 gene order of announcing according to Genebank and design a pair of primer, and introduce BamHI, the Xhol site is labeled as VP4-F, VP4-R, and its sequence is as follows, and italic is a restriction enzyme site.Expection amplification VP4 gene product length is 881bp, and primer is synthetic by Shanghai biotechnology company limited.

The VP4-F/R sequence:

VP4-F-AGCAGGATCCATGGCTTCGCTCATTTATAGACA

VP4-R-TAACCTCGAGTAACCTCGAGGACCATTTATAACCCAATCC

2.2.2 reverse transcription

20 μ l reaction systems are as follows:

PRV viral RNA 5.0 μ l

5×Reverse?transcriptase?Buffer 4.0μl

dNTP?Mixture(10mmol/L) 1.0μl

VP4-R(10μmol/L) 1.0μl

RNase inhibitor 1.0 μ l

AMV?Reverse?Tanscriptase(5U/μL) 1.0μl

DEPC treating water 7.0 μ l

After mixing on ice, room temperature 10min, cooled on ice 2-3min behind 42 ℃ of 1h;-20 ℃ of preservations are standby.

2.2.3PCR reaction

PCR reaction system (50 μ l):

Template (cDNA) 2.0 μ l

10×Buffer(Mg ²⁺free) 5.0μl

MgSO ₄ 4.0μl

dNTP(10mM) 1.0μl

VP4-F(10μM) 2.0μl

VP4-R(10μM) 2.0μl

RTaq enzyme 0.5 μ l

ddH ₂O 33.5μl

Mixing on ice.

The PCR reaction conditions: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 90s, circulate 35 times, and last 72 ℃ are extended 10min.

Get 5 μ L amplified productions 100V voltage electrophoresis 30-40min in 1.0% sepharose, observe the amplification situation with the ultraviolet lamp gel imaging system.

2.3 the segmental recovery of purpose

Reclaim the test kit specification sheets by a small amount of glue and carry out the segmental recovery of purpose.

2.4 the preparation of competent cell

Prepare competent cell with the CCMB80 chemical method, bacterial classification is intestinal bacteria E.Coli TOP10 and BL21 (DE3).

2.5PMD18-T with the segmental clone of purpose

2.5.1 connect the T carrier

Under 10 μ l systems, connect test kit by pMD 18-T carrier and be described as follows:

PMD18-T 1μl

VP4 4μl

SlutionI 5μl

After mixing on ice, 16 ℃ of connections are spent the night.

2.5.2 transform

(1) the TOP10 competent cell is taken out in-70 ℃ of refrigerators, melt ice bath 15min fast.

(2) 5 μ l connect product and add in the 100 μ l TOP10 competence ice bath 30min.

(3) 42 ℃ of heat shock 90sec, ice bath 1～2min.

(4) add the LB liquid nutrient medium of 800 μ l antibiotic-frees, cultivated 1 hour on 37 ℃ of shaking tables.

(5) the centrifugal 4min of 4500r/min reserves 200 μ l left and right sides supernatants suspension precipitations, gets 100 μ l and evenly coats on the LB agar plate that contains IPTG, X-gal and Amp.

(6) 37 ℃ of elder generations are just putting cultivation 30min and are being inverted cultivation 14～16h again.

2.5.3 positive plasmid colony screening

The ddH that in the PCR pipe, respectively adds 17.2 μ l ₂O receives the ddH that contains 17.2 μ l with transfering loop picking white colony ₂In the PCR pipe of O, boiling water boils 5min, and ice bath behind the low-speed centrifugal is done masterplate with this.

(25 μ l) is as follows for the PCR reaction system:

Template 17.2 μ l

10×Buffer(Mg ²⁺free) 2.5μl

MgCl2(25mM) 2.0μl

dNTP(10mM) 1.0μl

RTaq (5U/l) enzyme 0.3 μ l

VP4-F(10μM) 1.0μl

VP4-R(10μM) 1.0μl

The PCR reaction conditions: 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 60s, circulate 35 times, and last 72 ℃ are extended 10min.

Get 5 μ L amplified productions 100V voltage electrophoresis 30-40min in 1.0% sepharose, observe the amplification situation with the ultraviolet lamp gel imaging system, and the preservation of taking pictures, positive colony called after PMD18-T-VP4.

2.5.4 the sequencing of positive colony

Positive bacterium colony of picking is inoculated in 3ml and contains in the LB liquid nutrient medium of Amp, serves the order-checking of marine life Engineering Co., Ltd behind 37 ℃ of shaking culture 12-14h.

2.6 the structure and the evaluation of the protokaryon recombinant expression vector of goal gene

2.6.1 prokaryotic expression carrier pGEX-4T-1

The promotor of carrier pGEX-4T-1 is the tac promotor, has the Amp resistance, and the albumen of abduction delivering is with the GST formal representation.

2.6.2 extracting plasmid PMD18-T-VP4, pGEX-4T-1

Reclaim test kit with a small amount of plasmid and extract plasmid.2.6.3 enzyme is cut

1) PMD18-T-VP4 plasmid enzyme restriction system is as follows:

Plasmid 20.0 μ l

10×buffer 3.0μl

10×BSA 3.0μl

BamHI 2.0μl

XhoI 2.0μl

Add water to 40 μ l, 37 ℃ water-bath 3-4 hour.

2) pGEX-4T-1 plasmid enzyme restriction system is as follows:

Plasmid 15.0 μ l

10×buffer 3.0μl

10×BSA 3.0μl

BamHI 2.0μl

XhoI 2.0μl

Add water to 40 μ l, 37 ℃ water-bath 3-4 hour.

Reclaim test kit with glue and reclaim the purpose fragment respectively, method is with 2.3.

2.6.4 connect

Enzyme is cut the pGEX-4T-13 μ l after purifying reclaims, VP4 gene product 5 μ l, and Buffer for T41ul, T4 ligase enzyme 1 μ l, 16 ℃ of connections are spent the night.

2.6.5 transform

Connector transformed into escherichia coli BL21 (DE3) competent cell, the same 2.5.2 of step Zou.

2.6.6 positive recombinant plasmid Screening and Identification

1) bacterium colony PCR screening

(25 μ l) is as follows for the PCR reaction system:

Template 17.2 μ l

10×Buffer(Mg ²⁺free) 2.5μl

MgCl ₂(25mM) 2.0μl

dNTP(10mM) 1.0μl

RTaq (5U/ μ l) enzyme 0.3 μ l

VP4-F(10μM) 1.0μl

VP4-R(10μM) 1.0μl

Get 5 μ L amplified productions 100V voltage electrophoresis 30-40min in 1.0% sepharose, observe the amplification situation, will contain the segmental plasmid called after of this purpose pGEX-4T-1-VP4 with the ultraviolet lamp gel imaging system.

2) positive recombinant plasmid enzyme is cut evaluation

Plasmid pGEX-4T-1-VP4 5.0 μ l

10×buffer 1.0μl

10×BSA 1.0μl

BamHI 0.5μl

XhoI 0.5μl

ddH ₂O 2μl

The reaction cumulative volume is 10 μ l, 37 ℃, and water-bath 3 hours.Get 5 μ L amplified productions 100V voltage electrophoresis 30-40min in 1.0% sepharose, observe the amplification situation with the ultraviolet lamp gel imaging system.

3) the positive recombinant plasmid order-checking of pGEX-4T-1-VP4

2.7 reorganization bacterium pGEX-4T-1-VP4 abduction delivering

(1) single bacterium colony of the positive reorganization of picking bacterium pGEX-4T-1-VP4 is inoculated in 3mL and contains in the LB liquid nutrient medium of Amp (50 μ g/ μ l) 200rpm incubated overnight in 37 ℃ of shaking tables.

(2) be diluted in the LB liquid nutrient medium that contains Amp by 1: 100,37 ℃ of 200rpm joltings are cultured to the about 0.5-0.8 of logarithmic phase OD600, and adding final concentration is the IPTG of 1.0mM, wherein have a pipe not add IPTG in contrast.

Collect bacterium liquid respectively behind (3) 37 ℃ of 200r/min jolting inducing

culture

3,4, the 5h.

2.8 the SDS-PAGE electrophoresis of expressing protein

(1) respectively takes out the centrifugal 4min of 200 μ l bacterium liquid 4500rpm, abandon supernatant.

(2) bacterial sediment is with 200 μ lddH ₂O washes once, and the centrifugal 4min of 4500rpm abandons supernatant.

(3) each ddH of precipitation with 20 μ l ₂The O dissolving adds 20 μ l, 2 * protein loading buffer (reduced form), and boiling water boils 5min, gets and goes up sample about 20ul.

Strengthen voltage to 120 behind (4) 80 volts of voltage electrophoresis 20-30min and lie prostrate the electrophoresis end.

(5) soak gel with the Xylene Brilliant Cyanine G dye liquor, dyeing is about 1 hour on decolorization swinging table.

(6) staining fluid reclaims, and after the flushing of gel water, adds destainer, and shaking gently on shaking table decolours to band manifests.

2.9 recombinant protein soluble analysis

Single bacterium colony of the positive reorganization of picking bacterium, being inoculated in 3mL contains in the LB liquid nutrient medium of Amp, after 37 ℃ of activation are spent the night, be diluted at 1: 100 in the LB liquid nutrient medium that 100ml contains Amp, 37 ℃ of 200r/min joltings are cultured to the about 0.5-0.8 of logarithmic phase OD600, adding final concentration is the IPTG of 1.0mM, and 37 ℃ of 200r jolting inducing culture 4-5h collect thalline.

Thalline is washed 2 times with 20ml PBS, then with the PBS bacterium that suspends, through ultrasonic treatment, the centrifugal 15min of 12000r, precipitation is also with 20ml PBS dissolving, get an amount of ultrasonic back cleer and peaceful precipitation respectively and add 2 times of sample-loading buffers, boiling lysis 5min, the polyacrylamide gel with 10% carry out SDS-PAGE and detect.

3. interpretation of result

3.1PRV-VP4 the RT-RCR of protein gene amplification

The RNA that porcine rotavirus (PRV) lung tissue is extracted through the RT-PCR amplification, obtains the fragment of one section about 890bp, and is consistent with expected results, sees Fig. 1.

3.2PMD18-VP4 bacterium colony PCR detected result

Choose 4 white colony PCR detected results, have two bacterium colonies positive, obtain the fragment of one section about 890bp, consistent with expected results, see Fig. 2.

3.3 the sequencing result of positive colony

VP4 gene PCR product is connected conversion with PMD 18-T after, the positive colony sequencing result of screening is as follows, and therefrom this gene has successfully been introduced BamHI (GGATCC) as can be seen, XhoI (CTCGAG) restriction enzyme site, and the result is as shown in Figure 3.

3.4 the bacterium colony PCR of recombinant prokaryotic expression vector screening is cut evaluation with enzyme

PMD18-T-VP4 plasmid and prokaryotic expression carrier pGEX-4T-1, identify by bacterium colony PCR with after the XhoI enzyme is cut, reclaims, is connected through BamHI, as a result 4 bacterium colonies have 3 positive, PCR product size is 890bp, as shown in Figure 4.

The recombinant plasmid pGEX-4T-1-VP4 of gained cuts evaluation through BamHI and XhoI enzyme, and the band of about 5000bp and 890bp appears in the result, positive plasmid, as shown in Figure 5.

3.5pGEX-4T-1 the sequencing result of positive colony

VP4 gene PCR product is connected conversion with pGEX-4T-1 after, the positive colony sequencing result of screening is identical with 3.3, and therefrom this gene has successfully been introduced BamHI (GGATCC) as can be seen, XhoI (CTCGAG) restriction enzyme site.

3.6 reorganization bacterium abduction delivering

Recombinate bacterium pGEX-4T-1-VP4 after IPTG induces 4h, the SDS-PAGE electrophoretic analysis of 10%PAGE, the about 58KDa of the molecular weight of gained recombination fusion protein, wherein the GST size is 26KDa, the target protein size is about 32KDa, and is identical with expected results, sees shown in Figure 6.

3.7 recombinant protein soluble analysis

Reorganization bacterium pGEX-4T-1-VP4 through IPTG induce 3,4 respectively, 5h, collect bacterium liquid respectively in 3,4, during 5h, 10% SDS-PAGE electrophoretic analysis induces 3,4, the 5h expressing quantity is more or less the same.Behind the reorganization thalline ultrasonic degradation, through 10% SDS-PAGE electrophoretic analysis, target protein does not have in the supernatant liquor in ultrasonic postprecipitation, illustrates that recombinant protein is an inclusion body, sees shown in Fig. 7.

The structure and the transfection of embodiment 2 rotavirus genes and insect cell sf9 expression vector PFastbacl recombinant vectors

1. material

1.1 pathological material of disease, bacterial strain and plasmid

Pathological material of disease: pig lung tissue (PRV)

Bacterial strain: with embodiment 1

Cell: insect cell sf9 preserves (Invitrogen) by this laboratory.

Plasmid: insect expression vector PFastbacl is preserved by this laboratory, and all the other are with embodiment 1.

1.2 enzyme and main agents

Enzyme: the KOD-Plus enzyme is available from large alliance biology, and all the other are with embodiment 1.

Main agents: with embodiment 1.

1.3 substratum and reagent preparation

The SFX-insect substratum is available from the precious biotech firm in Dalian.All the other are with embodiment 1.

1.4 key instrument equipment

With embodiment 1.

2. method

2.1PRV the extraction of RNA in the lung tissue

With embodiment 1.

2.2 primer design is with synthetic

Go up porcine rotavirus VP4, the VP7 gene order announced according to Genebank and design a pair of primer, and introduce EcoRI, the XHOI site, upstream sequence is introduced the GCCACCATGG sequence.Downstream sequence is introduced 6 Histidine sequences, is labeled as 2-VP4-F, 2-VP4-R; 2-VP7-F, 2-VP7-R sequence are as follows, and italic is a restriction enzyme site.It is M13-F, M13-R that primer mark is detected in recombinant vectors swivel base reorganization back.Primer is synthetic by Shanghai biotechnology company limited.

Insect cell sf9 fibrocyte expression vector amplimer:

2-VP4-F：CGCAGAATTCGCCACCATGGCTTCGCTCATTTATAGACA

2-VP4-R：ATCTCTCGAGTTAGTGATGGTGATGGTGATGTGACCATTTATAACCCAATCC

2-VP7-F：CGCAGAATTCGCCACCATGGATGGTATTGAATATACCACAG

2-VP7-R：ATCTCTCGAGCTAGTGATGGTGATGGTGATGTACTCTGTAATAAAATGCAGC

M13-F：GTTTTCCCAGTCACGAC

M13-R：CAGGAAACAGCTATGAC

2.3 reverse transcription

PRV viral RNA 5.0 μ l

5×Reverse?transcriptase?Buffer 4.0μl

dNTP?Mixture(10mmol/L) 1.0μl

2-VP4/VP7-R(10μmol/L) 1.0μl

RNase inhibitor 1.0 μ l

AMV?Reverse?Tanscriptase(5U/μL) 2.0μl

DEPC treating water 5.0 μ l

Reaction system after mixing on ice, room temperature 10min, cooled on ice 2-3min behind 42 ℃ of 1h;-20 ℃ of preservations are standby.

2.4PCR reaction

PCR reaction system (50 μ l):

Template (cDNA) 2.0 μ l

10×Buffer(Mg ²⁺free) 5.0μl

MgSO ₄ 4.0μl

dNTP(2mM) 5.0μl

2-VP4/VP7-F(10μM) 2.0μl

2-VP4/VP7-R(10μM) 2.0μl

KOD-Plus enzyme (1U/ μ L) 2.0 μ l

ddH ₂O 28.0μl

Mixing on ice.

The PCR reaction conditions: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 68 ℃ are extended 90s, circulate 35 times, and last 68 ℃ are extended 10min.

2.5PMD18-T-2-VP4/VP7 make up

2.5.1PCR product precipitation:

The sodium acetate that the PCR product of KOD-Plus enzymatic amplification adds 1/10th volumes adds 2.5 times dehydrated alcohol again, places 1-2 hour for-20 ℃, and the centrifugal 10min of 12000rpm abandons supernatant, and 70% ethanol is washed once, oven dry, the ddH of 30 μ l ₂The O dissolution precipitation.

2.5.2 add the A end reaction:

Reaction system (25 μ l):

Template 5.0 μ l

10×Buffer(Mg ²⁺free) 2.5μl

MgCl ₂(25mM) 1.5μl

dATP(100mM) 0.5μl

BSA(0.1％) 5.0μl

RTaq enzyme 0.3 μ l

ddH ₂O 10.2μl

The PCR product is with after reaction system is mixed on ice, and 72 ℃ of 1h add A reaction after product and reclaim test kit with glue and reclaim, and method is with embodiment 1.

2.5.3PMD18-T be connected with the PCR product

Method is with embodiment 1.

2.5.4 transform

Connector transformed into escherichia coli TOP10 competent cell, the step, Zou was with embodiment 1.

2.5.5 the positive colony plasmid is chosen the bacterium Screening and Identification

Method is with embodiment 1, and the positive reorganization bacterium that filters out is with its called after PMD18-2-VP4 and PMD18-2-VP7.

2.5.6 plasmid extraction

Method is with embodiment 1.

2.5.7 enzyme is cut evaluation

It is as follows that plasmid PMD18-2-VP4 and PMD18-2-VP7 enzyme are cut system:

Plasmid 5.0 μ l

10×buffer 1.0μl

10×BSA 1.0μl

EcoRI 0.5μl

Xhol 0.5μl

ddH ₂O 2μl

The reaction cumulative volume is 10 μ l, and 37 ℃, 5 μ L amplified productions 100V voltage electrophoresis 30-40min in 1.0% sepharose is got in water-bath 3 hours, observes the amplification situation with the ultraviolet lamp gel imaging system.

2.6PFastbacl-2-VP4, the PFastbacl-2-VP7 vector construction

2.6.1 enzyme is cut

It is as follows that plasmid PMD18-T-2-VP4 and PMD18-T-2-VP7 enzyme are cut system:

Plasmid 20.0 μ l

10×buffer 4.0μl

10×BSA 4.0μl

EcoRI 2.0μl

XhoI 2.0μl

Add water to 40 μ l, 37 ℃ water-bath 3-4 hour.

PFastbacl plasmid enzyme restriction system is as follows:

Plasmid 15.0 μ l

10×buffer 3.0μl

10×BSA 3.0μl

EcoRI 2.0μl

XhoI 2.0μl

Add water to 30 μ l, 37 ℃ water-bath 3-4 hour, reclaim test kit with glue and reclaim purpose fragment enzyme respectively and cut 4 μ g positive plasmids, method is with embodiment 1.

2.6.2 enzyme is cut product and is reclaimed

Reclaim test kit with a small amount of glue, with embodiment 1.

2.6.3PFastbacl carrier is connected with goal gene

The PFastbacl enzyme cuts back to close product 3 μ l, and the PCR enzyme cuts back to close product 5 μ l, T4buffer 1 μ l, and T4 ligase enzyme 1 μ l (cumulative volume 10ul), 16 ℃ of connections are spent the night.

2.6.4 transform

Get 5 μ l connection product and be added in the 100ulTOP10 competent cell, with embodiment 1.

2.6.5 positive plasmid screening

With embodiment 1, the positive reorganization bacterium that filters out is with its called after PFastbacl-2-VP4, PFastbacl-2-VP7.

2.6.6 positive reorganization bacterium sequencing

The positive bacterium colony of PFastbacl-2-VP4, PFastbacl-2-VP7 is served the order-checking of extra large Sani Science and Technology Ltd. and is identified after the LB liquid nutrient medium is cultivated 14-16h.

2.7PFastbacl-2-VP4, PFastbacl-2-VP7 swivel base construction of recombinant vector

After recombinant vectors changes the DH10Bacl competent cell over to, with wherein helper plasmid generation swivel base reorganization in the cell.

2.7.1DH10Bac the making of competent cell

Method is with embodiment 1.

2.7.2 recombinant plasmid transformed and swivel base

Method is with embodiment 1.

2.7.3 reorganization bacterium colony PCR evaluation and screening

After getting the centrifugal 3min of 20 μ L bacterium liquid 3000rpm, add ddH ₂O, 100 ℃ of water-bath 5min, last low-speed centrifugal make liquid concentrate the centrifuge tube bottom.Do template with the intrinsic primer M13-F of swivel base reorganization back carrier, M13-R with this and carry out the PCR reaction.

(25 μ L) is as follows for system:

Template 17.2 μ l

10×Buffer(Mg2+free) 2.5μl

MgSO ₄ 4.0μl

dNTP(10mM) 1.0μl

RTaq (5U/ μ L) enzyme 0.3 μ l

M13-F(10μM) 1.0μl

M13-R(10μM) 1.0μl

The PCR reaction conditions: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 45s, 55 ℃ of annealing 45s, 72 ℃ are extended 5min, circulate 35 times, and last 72 ℃ are extended 10min.

2.7.4 recombinant plasmid extracting

Method is with embodiment 1.

2.7.5 recombinant plasmid PCR evaluation and screening

Get 1 μ L after 10 times of PFastbac-VP4 and the VP7 swivel base recombinant plasmid dilutions and do template, primer M13-F, 2-VP4-F respectively with M13-R combine detection VP4 swivel base recombinant plasmid; M13-F, 2-VP7-F detect VP7 swivel base recombinant plasmid with M13-R combination PCR respectively.

Template 1.0 μ l

10×Buffer(Mg ²⁺free) 2.5μl

MgCl ₂ 2.5μl

dNTP(10mM) 1.0μl

RTaq (5U/ μ L) enzyme 0.3 μ l

2-VP4/2-VP7/M13-F(10μM) 1.0μl

M13-R(10μM) 1.0μl

2.8 insect cell transfection

2.8.1 insect cell sf9 recovery

(1) shows 10mlSFX-insect insect cell media transfer to 25cm ²In the culturing bottle, add 10% serum then, preheating is stand-by in 27 ℃ of incubators.

(2) from liquid nitrogen, take out the cell pipe, put to stir gently in 37 ℃ of water-baths and make its quick thawing.

(3) after the pipe inner cell melts, use 75% cotton ball soaked in alcohol wiped clean tube wall rapidly, drying is placed in the ice bath.

(4) directly cell suspending liquid is transferred to ready 25cm ²In the culturing bottle, in 27 ℃ of no CO ²Hatch 2h in the incubator, make cell attachment.

(5) supernatant is abandoned in suction, adds fresh SFX-insect insect cell serum free medium and cultivates 3-4 days, after cellular-restoring is good, is used for passage and cultivates.

2.8.2 insect cell sf9 cultivates

The Sf9 cell changes the SFX-insect serum free medium twice, when cell grows to 90% confluent culture bottle wall after 3-4 days in the 24h of beginning is cultivated in recovery, in the super clean bench, old substratum is abandoned in suction, adds the 1ml substratum and blows and beats attached cell with aseptic straw, makes into the cell suspension state.0.7ml suspension is abandoned in suction, stays 0.3ml in bottle, adds the fresh substratum of 10ml simultaneously, in 27 ℃ of CO ²Incubator in cultivate, after 3-4 days, continue to go down to posterity with method.

2.8.3 insect cell sf9 is frozen

(1) observe at inverted microscopically, observation of cell is in logarithmic phase, cuts adherent rate and reaches more than 90%.

(2) with 1mlSFX-insect substratum piping and druming attached cell, make cell suspension %; Transfer to the centrifugal 4min of 1000rpm in the centrifuge tube then, inhale and abandon supernatant, add the SFX-insect substratum that 1ml contains 30%FBS and 10%DMSO, cell is suspended again.

(3) now with cell precooling 15-30min in 4 ℃ of refrigerators, be transferred to rapidly in-20 ℃ of refrigerators, 30min-1h is transferred to liquid nitrogen container upper strata (-80 ℃ approximately) again and spends the night, and makes the medium-term and long-term preservation of its liquid nitrogen that submerges at last.

2.8.4 recombinant plasmid transfection sf9 insect cell line

(1) observation of cell well-grown under the inverted microscope, each visual field at least 90% cell attachment rate, inoculation about 9 * 10 in six orifice plates ⁵Individual cell makes cell attachment 1h in 27 ℃ of incubators in the 2mlSFX-insect serum free medium.

(2) dosing in sterile tube:

Solution A: each transfection, dilute the about 1 μ l of 1 μ g plasmid in not containing of 99 μ l antibiotic SFX-insect substratum.

Solution B: dilute 6 μ l cellfectin transfection reagents in not containing of 94 μ l antibiotic SFX-insect substratum.

(3) mix two kinds of solution, mixing gently, incubated at room 15-45min.

(4) do not contain antibiotic substratum hole flushing once with 2ml.

(5) in A, B mixture, add 0.8mlSFX-insect substratum mixing gently, after six orifice plate sucking-off washing lotions, cover above-mentioned 1ml mixture, 27 ℃, no CO ₂Culturing cell 5h.

(6) remove transfection mixture also with substratum hole flushing 2 times, add the 2mlSFX-insect substratum, continue to cultivate 24-72h.

(7),, and compare with the normal cell that does not have transfection every 24h observation of cell form under inverted microscope from cultivating 24h.The success or not of preliminary judgement cell transfecting.Treating that cell becomes comes off greatly and when begin fragmentation.Collect supernatant, and low-speed centrifugal is removed cell and fragment thereof in the solution.Supernatant liquor can keep in Dark Place stand-by in 4 ℃, also can be stand-by in-70 medium-term and long-term preservations.Contain VP4 virus supernatant and be designated as A1; Contain VP7 virus supernatant and be designated as B1.

2.8.5PCR evaluation recombinant virus

The viral supernatant of collecting A1, B1 is taken out about 100 μ l boils 5min, ice bath still but after, the centrifugal 10min of 7000rpm gets supernatant and carries out PCR as template and detect, 25 μ lPCR reaction systems are as follows:

Template 2.0 μ l

10×Buffer(Mg2+free) 2.5μl

MgCl ₂(25mM) 4.0μl

dNTP(10mM) 1.0μl

RTaq (5U/ μ L) enzyme 0.3 μ l

2-VP4/VP7-F(10μM) 1.0μl

2-VP4/VP7-R(10μM) 1.0μl

Add water to 25 μ l, mixing on ice.

2.8.6 recombinate shape virus infection normal cell

The observation of cell form treats that cell comes off in a large number and when beginning cracking, collecting cell and supernatant mixed solution are behind the centrifugal 4min of 1000rpm.Get 100 μ L, 10 μ L, 1 μ L virus liquid and add respectively in 6 orifice plates in the normal cell, the 3 holes virus supernatant that contains VP4 is very A2-1, A2-2, A2-3 respectively; The 3 holes virus supernatant that contains VP7 is designated as B2-1, B2-2, B2-3 respectively.Every 24h observation of cell form.Treat that cell occurs that distortion comes off and when begin cracking, collecting cell is also done the PCR detection with A2-3, B2-3 supernatant.The same 3.2.8.5 of system and reaction conditions.

2.8.7 viral liquid is preserved

To be accredited as male virus liquid, add 2% foetal calf serum after, with 4 ℃ keep in Dark Place; If prolonged preservation will be put in-70 ℃ of refrigerators.

3. interpretation of result

3.1PRV-VP4, the RT-RCR of VP7 gene amplification

The RNA that the PRV lung tissue is extracted through the RT-PCR amplification, obtains the VP4 gene fragment of about 910bp and the VP7 fragment of 1010bp respectively, with the expected results basically identical.

3.2 bacterium colony PCR The selection result

The PCR product is earlier with behind the ethanol sedimentation, through after adding the A tail, is connected with the PMD18-T carrier change the TOP10 intestinal bacteria over to after, PMD18-2-VP4 chooses 2 white colonies and carries out PCR, PMD18-2-VP7 chooses 4 white colony PCR detections.PMD18-2-VP42 white colony PCR obtains the fragment of one section about 910bp as a result; Complete is positive; It is positive that PMD18-2-VP74 white colony has 3 white colonies, obtains the fragment of one section about 1010bp, consistent with expected results.The results are shown in Figure 8.

3.3PMD18-2-VP4/VP7 plasmid enzyme restriction detects

Choose two positive bacterium colonies respectively, after the access LB liquid nutrient medium overnight incubation, the extracting plasmid.EcoRI and XhoI restriction endonuclease carry out double digestion and detect.PMD18-2-VP4 is after EcoRI and XhoI enzyme are cut as a result, have only one positive, produce the band of 2 treaty 2600bp and 910bp.PMD18-2-VP7 is after EcoRI and XhoI enzyme are cut, and 2 plasmids are positive entirely, produce the band of 2 treaty 2600bp and 1010bp.The result proves and has successfully introduced EcoRI and XhoI restriction enzyme site, the results are shown in Figure 9.

3.4 the PCR of positive recombinant plasmid identifies

After choosing positive plasmid, after PMD18-2-VP4/VP7 plasmid and PFastBacl plasmid carry out double digestion with EcoRI and XhoI restriction endonuclease respectively, reclaim test kit with glue respectively and reclaim the purpose fragment.Reclaim the back and connect with the T4 ligase enzyme, be transformed into then in the TOP10 intestinal bacteria, choose 4 bacterium colonies respectively and carry out Preliminary detection with PCR method, 4 bacterium colonies are positive entirely as a result, the results are shown in Figure 10 and 11.

3.5 the enzyme of positive recombinant plasmid is cut evaluation

Choose two positive bacterium colonies respectively, after the access LB liquid nutrient medium overnight incubation, the extracting plasmid.EcoRI and XhoI restriction endonuclease carry out double digestion and detect.PFastBacl-2-VP4 produces the band of 2 treaty 5200bp and 910bp after EcoRI and XhoI enzyme are cut as a result.PFastBacl-2-VP7 produces the band of 2 treaty 5200bp and 1010bp after EcoRI and XhoI enzyme are cut.The result proves that 2 plasmids are positive entirely, and has successfully introduced EcoRI and XhoI restriction enzyme site, the results are shown in Figure 12.

3.6 positive recombinant plasmid sequencing result

PFastBacl-2-VP4 and FastBacl-2-VP7 through PCR and enzyme cut be accredited as the positive after, serve the order-checking of extra large Sani Science and Technology Ltd. and identify.The positive colony sequencing result of screening is as follows, wherein comprises the EcoRI and the XhoI restriction enzyme site of Kozak sequence, 6 Histidine sequences and introducing.

3.7 recombinant plasmid swivel base reorganization back bacterium colony PCR screening

9 whites of picking and 1 blue colonies are carried out bacterium colony PCR evaluation respectively, the PFastBacl-2-VP4 bacterium colony has 7 to be evident as the band that the positive has a treaty 3200bp size as a result, the contrast locus coeruleus produces about 300bp size strip, but these 7 bacterium colonies of preliminary judgement are positive; The FastBacl-2-VP7 bacterium colony has 6 to be evident as the band that the positive has a treaty 3300bp size, and the contrast locus coeruleus produces about 300bp size strip, but these 6 bacterium colonies of preliminary judgement are positive.The results are shown in Figure 13,14.

3.8 positive swivel base recombinant plasmid PCR identifies

Choose two respectively and be accredited as the male bacterium colony through PCR, after cultivating the extracting plasmid, do template after diluting 10 times, primer M13-F, 2-VP4-F respectively with M13-R combine detection PFastBacl-2-VP4 swivel base recombinant plasmid, produce about 3300bp and 1440bp size strip respectively; M13-F, 2-VP7-F detect PFastBacl-2-VP7 swivel base recombinant plasmid with M13-R combination PCR respectively, produce about 3400bp and 1540bp size strip, result and expected results basically identical respectively.

3.9PFastBacl-2-VP4/VP7 swivel base recombinant plasmid baculovirus transfection sf9 insect cell

After the transfection, respectively with 24h, 48h, 96h, 120h controlled observation normal cell and transfectional cell metamorphosis, during 48h, the control cells form does not have to change substantially, and except that small amounts of cells distortion death, other cell outlines are clear, big or small homogeneous, and cell space is bright.

Transfectional cell changes obviously, shows as: cell volume increases, edge blurry, profile is unclear, after the pathology cell come off in a large number, death, and cracking gradually.

Above phenomenon illustrates that tentatively PFastBacl-2-VP4/VP7 swivel base recombinant plasmid is successful by liposome-mediated transfection insect sf9 cell, sees Figure 15,16.

3.10 PCR detects behind a generation and the two generation recombinate shape virus infection normal cells

After the pathology cell come off in a large number, dead and gradually during cracking, collecting cell is got supernatant behind the low-speed centrifugal, 100 ℃ are boiled 5min, do template with this and are used for PCR and detect.The result contain the VP4/VP7 gene a generation and two generation virus can both be detected, the results are shown in Figure 17,18.

The structure of embodiment 3 rotavirus genes and yeast cell GS115 expression vector PPIC9K recombinant vectors

1. material

1.1 pathological material of disease, bacterial strain and plasmid

Pathological material of disease: PRRSV lung group

Bacterial strain: with embodiment 1

Cell: yeast GS115 is preserved by this laboratory

Plasmid: Yeast expression carrier PPIC9K (invitrogen), all the other are with embodiment 1.

1.2 enzyme and main agents

Enzyme: KOD Plus enzyme is available from large alliance biology, and all the other are with embodiment 1.

Main agents: with embodiment 1.

1.3 substratum and reagent preparation

With embodiment 1.

1.4 key instrument equipment

With embodiment 1.

2. method

2.1PRV the extraction of RNA in the lung tissue

With embodiment 1.

2.2PRV-VP4, VP7 gene RT-RCR amplification

2.2.1 primer design is with synthetic

Go up VP4, the VP7 gene order announced according to Genebank and design a pair of primer, and introduce EcoRI, NotI site, and being labeled as 3-VP4-F, 3-VP4-R, 3-VP7-F, 3-VP7-R, sequence is as follows, italic is a restriction enzyme site, and primer is synthetic by Shanghai biotechnology company limited.

Insect cell sf9 fibrocyte expression vector amplimer:

3-VP4-F：

CAGAATTCCATCATCATCATCATCATATGGCTTCGCTCATTTAT

AGACA

3-VP4-R：ATCTGCGGCCGCTCATGACCATTTATAACCCAATCC

3-VP7-F：

CGCAGAATTCCATCATCATCATCATCATATGTATGGTATTGAATATACCACAG

3-VP7-R：ATCTGCGGCCGCCTATACTCTGTAATAAAATGCAGC

2.2.2 reverse transcription

With embodiment 1.

2.2.3PCR reaction

PCR reaction system (50 μ l):

Template (cDNA) 2.0 μ l

10×Buffer(Mg ²⁺free) 5.0μl

MgSO ₄ 4.0μl

dNTP(2mM) 5.0μl

3-VP4/VP7-F(10μM) 2.0μl

3-VP4/VP7-R(10μM) 2.0μl

KOD-Plus enzyme 2.0 μ l

ddH ₂O 28.0μl

Mixing on ice.

2.3PMD18-T-3-VP4, the VP7 vector construction

2.3.1PCR product precipitation

The sodium acetate that the PCR product of KOD-Plus enzymatic amplification adds 1/10th volumes adds 2.5 times dehydrated alcohol again, places 1-2 hour for-20 ℃, and the centrifugal 10min of 12000r abandons supernatant, and 70% ethanol is washed once, oven dry, the ddH of 30ul ₂The O dissolution precipitation.

2.3.2 add the A end reaction

Method is with embodiment 1.

2.3.3PMD18-T be connected with the PCR product

Method is with embodiment 1.

2.3.4 transform

Connector transformed into escherichia coli TOP10 competent cell, step is with embodiment 1.

2.3.5 the positive colony plasmid is chosen bacterium PCR Screening and Identification

Method is with embodiment 1.

2.3.6 plasmid extraction

Method is with embodiment 1.

2.3.7 enzyme is cut evaluation

It is as follows that plasmid PMD18-3-VP4 and PMD18-3-VP7 enzyme are cut system:

Plasmid 5.0 μ l

10×buffer 1.0μl

10×BSA 1.0μl

EcoRI 0.5μl

NotI 0.5μl

ddH ₂O 2.0μl

2.4PIC9K-3-VP4, the PPIC9K-3-VP7 vector construction

2.4.1 enzyme is cut

It is as follows that plasmid PMD18-T-3-VP4 and PMD18-T-3-VP7 enzyme are cut system:

Plasmid 15.0 μ l

10×buffer 4.0μl

10×BSA 4.0μl

EcoRI 2.0μl

NotI 2.0μl

Add water to 40 μ l, 37 ℃ water-bath 3-4 hour.

PPIC9K plasmid enzyme restriction system is as follows:

Plasmid 15.0 μ l

10×buffer 3.0μl

10×BSA 3.0μl

EcoRI 2.0μl

NotI 2.0μl

Add water to 30 μ l, 37 ℃ water-bath 3-4 hour.

Reclaim test kit with glue and reclaim the purpose fragment respectively, method is with embodiment 1.

2.4.2 enzyme is cut product and is reclaimed

Reclaim test kit with a small amount of glue, with embodiment 1.

2.4.3PPIC9K carrier is connected with goal gene

PPIC9K carrier enzyme cuts back to close product 3 μ l, and the PCR enzyme cuts back to close product 5 μ l, T4buffer 1 μ l, and T4 ligase enzyme 1 μ l (cumulative volume 10 μ l), 16 ℃ of connections are spent the night.

2.4.4 transform

Get 5 μ l connection product and be added in the 100 μ l TOP10 competent cells, method is with embodiment 1.

2.4.5 positive plasmid PCR screening

Method is with embodiment 1, and the positive reorganization bacterium that filters out is with its called after PPIC9K-3-VP4, PPIC9K-3-VP7.

2.4.6 the positive plasmid enzyme is cut evaluation

It is as follows that plasmid PPIC9K-3-VP4, PPIC9K-3-VP7, enzyme cut system:

Plasmid 5.0 μ l

10×buffer 1.0μl

10×BSA 1.0μl

EcoRI 0.5μl

NotI 0.5μl

ddH ₂O 2.0μl

The reaction cumulative volume is 10 μ l, 37 ℃, and water-bath 3 hours; Get 5 μ l amplified productions 100V voltage electrophoresis 30-40min in 1.0% sepharose, observe the amplification situation with the ultraviolet lamp gel imaging system.

2.4.7 positive recombinant plasmid sequencing

The positive bacterium colony of PPIC9K-3-VP4, PPIC9K-3-VP7 is served the order-checking of extra large Sani Science and Technology Ltd. and is identified after the LB liquid nutrient medium is cultivated 14-16h.

3. interpretation of result

3.1PRV-VP4, the RT-RCR of VP7 gene amplification

The RNA that the PRV lung tissue is extracted through the RT-PCR amplification, obtains VP7 and the 910bpVP4 fragment of one section about 1010bp, and is consistent with expected results, sees Figure 19,20 respectively.

3.2PMD18-3-VP4/VP7 bacterium colony PCR detected result

Choose white colony PCR and detect, PMD18-3-VP4 selects 3 bacterium colony results to be had positively entirely, obtains the fragment of one section about 910bp, consistent with expected results.PMD18-3-VP7 selects 2 bacterium colony results to be had positively entirely, obtains the fragment of one section about 1010bp, consistent with expected results.

3.3PMD18-3-VP4/VP7 the sequencing result of positive colony

VP4, VP7 gene PCR product are connected conversion with PMD18-T after, the positive colony sequencing result of screening is as follows, and therefrom this gene has successfully been introduced EcoRI (GAATTC) as can be seen, NotI (GCGGCCGC) restriction enzyme site.

3.4PPIC9K-3-VP4/VP7 the bacterium colony PCR Screening and Identification result of recombinant vectors

Choose white colony PCR and detect, PPIC9K-3-VP4 selects 3 bacterium colony results to be had positively entirely, obtains the fragment of one section about 910bp, consistent with expected results.PPIC9K-3-VP7 select 4 bacterium colony results have 3 positive, obtain the fragment of one section about 1010bp, consistent with expected results, see as Figure 21.

3.5 recombinant vectors PPIC9K-3-VP4/VP7 enzyme is cut evaluation

Choose two positive bacterium colonies respectively, after the access LB liquid nutrient medium overnight incubation, the extracting plasmid.Recombinant vectors PPIC9K-3-VP4, PPIC9K-3-VP4VP7 carry out double digestion through EORI and NOtI restriction endonuclease and detect, and PPIC9K-3-VP4 produces the band of 2 about respectively 9300bp and 910bp after EORI and NOtI enzyme are cut.PPIC9K-3-VP4VP7 produces the band of 2 about respectively 9300bp and 1010bp after EORI and NOtI enzyme are cut.The result proves: 2 plasmids are positive entirely, and successfully introduced EcoRI and NotI restriction enzyme site, the results are shown in Figure 22.

3.6PPIC9K-3-VP4/VP7 the sequencing result of positive plasmid

PPIC9K-3-VP4 and PPIC9K-3-VP7 through PCR and enzyme cut be accredited as the positive after, serve the order-checking of extra large Sani Science and Technology Ltd. and identify.The positive colony sequencing result of screening wherein comprises the EcoRI and the NotI restriction enzyme site of 6 Histidine sequences and introducing, and the result is identical with present embodiment 3.3.

Should be noted that at last above embodiment only in order to technical scheme of the present invention to be described but not the limitSystem, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can make amendment or be equal to replacement the technical scheme of invention, and not breaking away from the spirit and scope of technical solution of the present invention, it all should be encompassed in the claim scope of the present invention.

Involved Nucleotide/aminoacid sequence table in the additional copy application:

Wherein:

SEQ ID No 1 is the sequence table of PMD18--T-VP4.

SEQ ID No 2 is the sequence table of primer VP4-F.

SEQ ID No 3 is the sequence table of primer VP4-R.

SEQ ID No 4 is the sequence table of primer 2-VP4-F.

SEQ ID No 5 is the sequence table of primer 2-VP4-R.

SEQ ID No 6 is the sequence table of primer 2-VP7-F.

SEQ ID No 7 is the sequence table of primer 2-VP7-R.

SEQ ID No 8 is the sequence table of primer M13-F.

SEQ ID No 9 is the sequence table of primer M13-R.

Sequence table

＜110〉Academy of Agricultural Sciences, Shanghai City

＜120〉prokaryotic expression of Porcine rotavirus vaccine candidate gene and Construction of eukaryotic thereof

<160>2

<170>PatentIn?version?3.3

<210>SEQ?ID?No?1

<211>887

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

1 GGATCCATGG?CTTCGCTCAT?TTATAGACAA?CTACTTACTA?ATTCATACAC?AGTCAATCTT

61 CCTGACGAAA?TTCAAGAGAT?TGGATCAGCT?AAGTCACAGG?ATGTTACTAT?AAATCCTGGT

121 CCATTCGCAC?AAACAGGTTA?TGCACCAGTT?AATTGGGGAG?CAGGTGAGAC?TAATGACTCC

181 ACAACTGTCG?AGCCGTTATT?AGATGGTCCA?TACCAACCAA?CCACTTTCAA?TCCACCAACA

241 AGCTATTGGG?TACTACTTGC?GCCAACTGTA?GAGGGCGTAA?TTATTCAAGG?AACAAACAAT

301 ACCGATAGAT?GGTTGGCCAC?TATACTAATT?GGACCAAACG?TACAAACAAC?TAACAGAATA

361 TACAATCTTT?TTGGTCAGCA?AGTAACTTTA?TCGGTGGAGA?ATACGTCACA?GACACAATGG

421 AAGTTCATTG?ATGTGAGTAC?AACTACGCCA?ACAGGAAGTT?ATACGCAGCA?CGGACCATTG

481 TTCTCTACAC?CAAAATTATA?CGCTGTAATG?AAATTCAGTG?GTAGAATATA?TACATATAAT

541 GGAACCACAC?CAAACGCAAC?AACAGGATAC?TATTCAACTA?CTAATTATGA?CACAGTAAAT

601 ATGACATCAT?TTTGTGATTT?TTATATTATA?CCAAGAAATC?AAGAAGAAAA?ATGTACTGAG

661 TATATCAATC?ATGGATTACC?TCCTATACAA?AATACAGGGA?ATGTTGTGCC?AGTATCTTTA

721 TCGGCTAGAG?AGATAGTGCA?CACAAGAGCT?CAAGTTAATG?AGGATATTGT?TGTTTCAAAA

781 ACTTCACTTT?GGAAAGAAAT?GCAATGCAAC?AGAGACATAA?CCATAAGATT?CAAATTTGAT

841 AGAACAATTA?TTAAAGCTGG?AGGATTGGGT?TATAAATGGT?C CTCGAG

<210>SEQ?ID?No?2

<211>33

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

AGCAG?GATCC?ATGGC?TTCGC?TCATT?TATAG?ACA

1 5 10 15 20 25 30

<210>SEQ?ID?No?3

<211>40

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

TAACC?TCGAG?TAACC?TCGAG?GACCA?TTTAT?AACCC?AATCC

1 5 10 15 20 25 30 35 40

<210>SEQ?ID?No?4

<211>39

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

CGCAG?AATTC?GCCAC?CATGG?CTTCG?CTCAT?TTATA?GACA

1 5 10 15 20 25 30 35

<210>SEQ?ID?No?5

<211>52

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

ATCTCTCGAGTTAGTGATGGTGATGGTGATGTGACCATTTATAA

1 5 10 15 20 25 30 35 40

CCCAATCC

45 50

<210>SEQ?ID?No?6

<211>41

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

CGCAG?AATTC?GCCAC?CATGG?ATGGT?ATTGA?ATATA?CCACA?G

1 5 10 15 20 25 30 35 40

<210>SEQ?ID?No?7

<211>52

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

ATCTCTCGAGCTAGTGATGGTGATGGTGATGTACTCTGTAATA

1 5 10 15 20 25 30 35 40

AAATGCAGC

45 50

<210>SEQ?ID?No?8

<211>17

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

GTTTT?CCCAG?TCACG?AC

1 5 10 15

<210>SEQ?ID?No?9

<211>17

<212>DNA

＜213〉porcine rotavirus (porcine rotavirus)

<400>

CAGGA?AACAG?CTATG?AC

1 5 10 15

Claims

1. porcine rotavirus VP4, VP7 vaccine candidate Prokaryotic Expression and Construction of eukaryotic method thereof is characterized in that:

Comprise the clone of porcine rotavirus VP4 gene and the structure and the transfection of prokaryotic expression, porcine rotavirus VP4, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors, and the structure of porcine rotavirus VP4, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors.

2. the clone of porcine rotavirus VP4 gene according to claim 1 and the method for prokaryotic expression is characterized in that, the clone and the prokaryotic expression of described porcine rotavirus VP4 gene are as follows:

3. the structure and the transfection method of rotavirus vp 4 according to claim 1, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors, it is characterized in that the structure and the transfection of described porcine rotavirus VP4, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors are as follows:

Go up porcine rotavirus virus PRV nucleocapsid protein VP4, the VP7 gene nucleic acid sequences Design primer of announcing according to GeneBank, amplify nucleocapsid protein VP4, the VP7 gene of PRV with the RT-PCR method; The pig VP4 that obtains, the coding region of VP7 gene are inserted in the pMD18-T carrier; Again through restriction enzyme EcoRI and XhoI double digestion, with the VP4 that reclaims, VP7 gene fragment clone to insect expression vector PFastbac1, with recombinant plasmid called after PFastbac1-2-VP4, PFastbac1-2-VP7 respectively; PFastbac1-2-VP4, PFastbac1-2-VP7 plasmid are transformed into respectively in the DH10Bac1 competent cell, itself and helper plasmid generation swivel base are recombinated; The positive recombinant that shows the baculovirus that has obtained to contain rotavirus gene by the screening of blue hickie, PCR qualification result; This linearized baculovirus recon of purifying makes its transfection insect cell, gathers in the crops recombinant virus behind the 3d, shows according to cellular form variation and PCR evaluation: the success of recombinant virus transfection sf9 cell; Collect viral supernatant, it is contained VP4, VP7 virus supernatant called after A1, B1 respectively; Respectively with A1, B1 for virus inoculation in sf9, treat to receive collecting cell after a large amount of pathologies of cell, PCR is accredited as positive-virus, its supernatant respectively called after A2, B2 for virus.

4. the construction process of rotavirus vp 4 according to claim 1, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors, it is characterized in that the structure of described porcine rotavirus VP4, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors is as follows:

5. the application of method in proteic large-scale purification of the clone of porcine rotavirus VP4 gene according to claim 2 and prokaryotic expression.

6. the Development Application of the structure of rotavirus vp 4 according to claim 3, VP7 gene and insect cell sf9 expression vector PFastbacl recombinant vectors and transfection method protein expression and vaccine in insect cell sf9.

7. construction process application in the expressing protein in the pichia spp cell of rotavirus vp 4 according to claim 4, VP7 gene and yeast cell GS115 expression vector PPIC9K recombinant vectors.