CN102020706B - Associated protein of biology cadmium resistance and coding gene of same - Google Patents
Associated protein of biology cadmium resistance and coding gene of same Download PDFInfo
- Publication number
- CN102020706B CN102020706B CN200910093926A CN200910093926A CN102020706B CN 102020706 B CN102020706 B CN 102020706B CN 200910093926 A CN200910093926 A CN 200910093926A CN 200910093926 A CN200910093926 A CN 200910093926A CN 102020706 B CN102020706 B CN 102020706B
- Authority
- CN
- China
- Prior art keywords
- sequence
- protein
- cadmium
- gene
- bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an associated protein of biology cadmium resistance and coding gene of the same. The protein in the invention is the following protein (a) or (b), wherein protein (a) comprises amino acids according to amino acid sequence as shown in sequence 1 of a sequence table, and protein (b) is protein derived from the sequence 1, with the amino acid sequence of the sequence 1 undergoing replacement and/or miss and/or addition of one or several amino acid residues and with the amino acid sequence associated with biology cadmium resistance. The invention also protects coding gene of the protein and expression box, recombination expression vector, transgenic cell lines or recombinant bacterium which contain the coding gene. The resistance of recombinant bacterium with the coding gene to high density cadmium (1mMCdCl2) is proved by experiments to be obviously enhanced. The invention can be applied to cultivate cadmium-resistant recombinant bacterium or cadmium-resistant transgenic plants, which has significant meanings.
Description
Technical field
The present invention relates to a kind of biological cadmium resistance-associated protein and encoding sox thereof.
Background technology
It is one of main environment public hazards of harm agriculture prodn and human health that heavy metal (cadmium, arsenic, lead, mercury etc.) pollutes, and the pollution of cadmium is particularly serious.Cadmium is widely used in departments such as machinery, chemical industry, plating, printing and dyeing, all has every year a large amount of cadmiums to be discharged in the environment through industry " three wastes ", wherein has 82%～94% to enter into soil.Cadmium is not the necessary element of growth and development of plants, but is prone to by plant absorbing, get into people's cognition and cause nerve and renal dysfunction, and the bone pathology, toxicity is only second to mercury.Can poison even death by cadmium food for edible too much the containing of people, and the itai-itai disease of world-famous Japan are exactly typical illustration.Phytoremediation is one of the most desirable approach of removing soil heavy metal cadmium.And the enforcement of this approach depends on the Cadmium resistance mechanism of understanding plant and excavates the new functional gene of a collection of important Cadmium resistance, for the molecular designing of economic plants Cadmium resistance proterties provides gene element and technical support.
Phytolacca acinosa belongs to the Phytolaccaceae Phytolacca, extensively is distributed in the most of areas of China.Phytolacca acinosa not only is used as a kind of Chinese medicinal materials and is known by people; And in recent years discover that it still is the super enriching plant of a heavy metal species; To super enriching plant be defined as blade or over-ground part (dry weight) cadmium content reaches 100mg/kg; Satisfy S/R simultaneously greater than 1 (S, plant shoot cadmium enrichment concentration; R, plant underground part cadmium enrichment concentration).Research shows that Phytolacca acinosa satisfies above condition to the enrichment of cadmium element, and the concentration of the over-ground part enrichment cadmium of the Phytolacca acinosa of grow 2 months or 4 months is basically all greater than 100mg/kg, and reaches as high as 400mg/kg; The S/R value is all greater than 1.
Summary of the invention
The purpose of this invention is to provide a kind of biological cadmium resistance-associated protein and encoding sox thereof.
Biological cadmium resistance-associated protein provided by the invention from dyers' grapes (Phytolacca americanaLinn.), is (a) or protein (b) as follows:
(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;
(b) with the aminoacid sequence of sequence 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with biological cadmium resistance by sequence 1 deutero-protein.
In order to make the albumen in (a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table connect label as shown in table 1.
The sequence of table 1 label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being generally 5) | RRRRR |
| Poly-His | 2-10 (being generally 6) | HHHHHH |
| |
8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c- |
10 | EQKLISEEDL |
Above-mentioned (b) but in the albumen synthetic, also can synthesize its encoding sox earlier, carry out biology again and express and to obtain.Proteic encoding sox in above-mentioned (b) can be through the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 2; And/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.
The gene of above-mentioned biological cadmium resistance-associated protein of encoding also belongs to protection scope of the present invention.
Said gene can be following 1) or 2) or 3) dna molecular:
1) encoding sequence is the dna molecular shown in the sequence 2 in the sequence table;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;
3) with 1) or 2) dna sequence dna that limits has 90% above homology, and the coding proteic dna molecular relevant with biological cadmium resistance.
Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
The recombinant expression vector that contains above arbitrary said gene also belongs to protection scope of the present invention.
Said recombinant expression vector can obtain the MCS of said gene insertion pET-28a (+) plasmid.Specifically, said recombinant expression vector can be and the small segment between pET-28a (+) plasmid NcoI and XhoI site is substituted by said gene obtains.
Contain above arbitrary said expression of gene box, transgenic cell line and reorganization bacterium and all belong to protection scope of the present invention.
Said reorganization bacterium can be said gene is imported in the bacterium that sets out, and the Cadmium resistance ability that obtains is higher than the reorganization bacterium of the said bacterium that sets out.Specifically, said gene imports in the said bacterium that sets out through said recombinant expression vector, and the said bacterium that sets out is E.coli DH5 α.
Increase said full length gene or arbitrary segmental primer to also belonging to protection scope of the present invention.
Said gene, said recombinant expression vector or said expression cassette can be applicable to cultivate the biology that the Cadmium resistance ability improves.
Said biology can be plant or intestinal bacteria E.coli DH5 α.
When using the plant of said gene cultivation Cadmium resistance ability raising, available existing plant expression vector construction contains the recombinant expression vector of said gene.Said plant expression vector comprises double base agrobacterium vector and the carrier etc. that can be used for the plant micropellet bombardment.Said plant expression vector also can comprise 3 ' end untranslated zone of foreign gene, promptly comprises the dna fragmentation of polyadenylic acid signal and any other participation mRNA processing or genetic expression.Said polyadenylic acid signal can guide polyadenylic acid to join 3 ' end of mRNA precursor, and the non-translational region of inducing (Ti) plasmid gene (like kermes synthetic enzyme Nos gene), plant gene (like soybean storage protein gene) 3 ' end to transcribe like the Agrobacterium crown-gall nodule all has similar functions.When using said gene constructed recombinant plant expression vector; Before its transcription initiation Nucleotide, can add any enhancement type promotor or constitutive promoter; Like the ubiquitin promoter (Ubiquitin) of cauliflower mosaic virus (CAMV) 35S promoter, corn, they can use separately or be used in combination with other plant promoter; In addition; When using gene constructed plant expression vector of the present invention; Also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc.; But must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of said translation wave and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.For the ease of transgenic plant cells or plant being identified and screening; Can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, luciferase genes etc.) as adding the coding that in plant, to express, have antibiotic marker thing (qingfengmeisu qiong affinity tag, kantlex affinity tag etc.) or the anti-chemical reagent marker gene (like anti-weedkiller gene) of resistance etc.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.Utilize any carrier that can guide foreign gene in plant, to express,, can obtain transgenic cell line and transfer-gen plant that the Cadmium resistance ability improves the gene transfered plant cell of encoding said proteins.Carry that said expression carrier can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated through using, and the plant transformed tissue cultivating is become plant.By the plant transformed host both can be monocotyledons, also can be dicotyledons, as: tobacco, Root or stem of Littleleaf Indianmulberry, Arabidopis thaliana, paddy rice, wheat, corn, cucumber, tomato, willow, turfgrass, lucerne place etc.
Among the present invention; The dyers' grapes (Phytolaccaamericana Linn.) that have the ultra accumulation ability of heavy metal cadmium with China within the border are material; Through the design degenerated primer; (rapidamplification of cDNA ends, RACE) technology has successfully been cloned the Phytolacca acinosa enolase gene to adopt the terminal rapid amplifying technology of cDNA.Through genetic transformation, change this gene over to intestinal bacteria, and obtain positive colony through screening.To high density cadmium (1mM CdCl
2) resistant proof shows, goal gene transforms the resistance of bacterial strain apparently higher than control strain.The present invention can be applicable to cultivate Cadmium resistance bacterial strain or Cadmium resistance plant, is significant.
Description of drawings
Fig. 1 detects the expression of Phytolacca acinosa enolase in intestinal bacteria for SDS-PAGE; Lane1 and lane6: molecular weight of albumen marker; Lane2 and lane3:IPTG inductive empty carrier control strain, applied sample amount is respectively 10 μ L and 20 μ L; Lane4 and lane5:IPTG inductive recombinant bacterial strain, applied sample amount are respectively 10 μ L and 20 μ L.
Fig. 2 is recombinant bacterial strain and empty carrier control strain upgrowth situation in containing the LB solid medium of 1mM Cadmium chloride fine powder; Left side figure is recombinant bacterial strain (a goal gene conversion bacterial strain); Right figure is control strain (an empty carrier conversion bacterial strain).
Fig. 3 is recombinant bacterial strain (conversion bacterial strain) and empty carrier control strain (control strain) upgrowth situation in containing the LB liquid nutrient medium of ImM Cadmium chloride fine powder.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment like no specified otherwise, is ordinary method.Used test materials among the following embodiment like no specified otherwise, is to buy from routine biochemistry reagent shop and obtains.Following % all refers to the quality percentage composition like no specified otherwise.In following examples, repeated experiments is set all three times.
Primer sequence is seen table 1.
The primer sequence among table 1 embodiment
| The primer title | Primer sequence (5 ' → 3 ') |
| ENO-DE | TGTAAGCAAAAGCTGGGAgcnaaygcnat |
| ENO-DR | CTTGAATATTAGGAGCAAATCCTccytcrtcncc |
| 3’Qt | CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT |
| 3’Qo | CCAGTGAGCAGAGTGACG |
| 3’Qi | GAGGACTCGAGCTCAAGC |
| 3’GSPo | GAGGCAATGAAGATGGGAAGT |
| 3’GSPi | AATGAAGATGGGAAGTGAGGTG |
| 5’Qt | GGCCACGCGTCGACTAGTACGGGGGGGGGGGGGGGG |
| 5’adaptor | GGCCACGCGTCGACTAGTAC |
| 5’GSP-RT | GCATTGCAAGCTTGTTTCCTG |
| 5’GSPi | TGTGCTTGTACAGAGGGGTTT |
| ENO-F | TTCCTCTGCAAAACTCCACA |
| ENO-R | CAAGCCAACAACATTCATCC |
| ENO-petF | CCATGGTTACCATCAAGTGCGTCAAAGCC |
| ENO-petR | CTCGAGGTAGGGCTCAACAGGCTGG |
All three rich polygala root biotechnology Ltds synthesize above primer in Beijing,
Dyers' grapes (Phytolacca americana Linn.): seed is available from academy of agricultural sciences, Hubei Province Chinese medicinal materials institute; PET-28a (+) carrier: available from Invitrogen company; Intestinal bacteria E.coli DH5 α: available from precious biotechnology (Dalian) ltd, D9057.
The discovery of embodiment 1, gene
1, material is cultivated
After the Phytolacca acinosa seed soaked 20min with 98% vitriol oil, the HgCl with 0.1%
2Sterilization places on the 1/2MS substratum and sprouts, and about two weeks get seedling leaves and are used for subsequent experimental behind the seed germination.
2, the total RNA of Phytolacca acinosa extracts
With reference to total RNA of TIANGEN Biotech (Beijing) Co., Ltd. plant total RNA extraction reagent box operation instruction extraction dyers' grapes, specific as follows:
Take by weighing the Phytolacca acinosa seedling leaves about 0.1g, in liquid nitrogen, grind, pour into behind the powdered in the 1.5mL centrifuge tube of containing 1mL lysate RZ, the vibration mixing.After room temperature was placed 5min, 4 ℃, the centrifugal 5min of 12000rpm got supernatant, change in the centrifuge tube of new no RNase.Add 200 μ L chloroforms, build the pipe lid, thermal agitation 15s, room temperature is placed 3min.4 ℃, the centrifugal 10min of 12000rpm.In the centrifuge tube of new no RNase, slowly add the absolute ethyl alcohol of 0.5 times of volume to the upper water phase transition, mixing.Solution that obtains and deposition are all changed in the adsorption column.4 ℃, the centrifugal 30s of 12000rpm abandon waste liquid in the centrifuge tube, add 500 μ L protein liquid removals, and 4 ℃, the centrifugal 30s of 12000rpm abandon waste liquid.Add 700 μ L rinsing liquids, room temperature leaves standstill 2min, and 4 ℃, the centrifugal 30s of 12000rpm abandon waste liquid.Add 500 μ L rinsing liquids again, room temperature leaves standstill 2min, and 4 ℃, the centrifugal 30s of 12000rpm abandon waste liquid.4 ℃, the centrifugal 2min of 12000rpm remove residual liquid, uncap and dry.Adsorption column is changed in the centrifuge tube of a new no RNase, add 60 μ L RNase-free dd-H
2O, room temperature is placed 2min, 4 ℃, the centrifugal 2min of 12000rpm.
3, cDNA first chain is synthetic
With total RNA is template, uses synthetic cDNA first chain of the cDNA of TIANGEN Biotech (Beijing) Co., Ltd. first chain synthetic agent box.
20 μ L reaction systems: 2 μ L, 10 μ mol OligodT
12-18, the total RNA of 1-5 μ g, 2 μ L dNTP mixture (each 2.5mM) mend sterilization distilled water to 14 μ L.
70 ℃ the heating 5min after rapidly at cooled on ice 2min.Add 4 μ L, 5 * First-StrandBuffer, 1 μ L 0.1M DTT after brief centrifugal.Add 1 μ L (200U) TianScript M-MLV and use the pipettor mixing gently.42 ℃ of temperature are bathed 50min.95 ℃ of heating 5min termination reactions.
4, the segmental amplification of Phytolacca acinosa enolase gene, clone and order-checking
Enolase gene conservative region at other species designs a pair of degenerate primer: ENO-DF and ENO-DR.With synthetic cDNA first chain is that template is carried out the PCR reaction.PCR response procedures: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 30s, 48 ℃ of annealing 30s, 72 ℃ are extended 1min, 30 circulations; 72 ℃ are extended 10min.Reaction system: 2 * GC buffer I, 12.5 μ L, dNTP mixture (each 2.5mM) 2 μ L, template cDNA 1 μ L, LA Taq (5U/ μ L) 0.25 μ L, each 1 μ L of ENO-DF and ENO-DR (10 μ M) mends ddH
2O to 25 μ L.
The PCR product is checked order.
5, RACE design of primers, RACE amplification
(1) 3 ' RACE reaction
Design reverse transcription primer a 3 ' Qt; TransScript II reverse transcription test kit with full formula King Company carries out reverse transcription, reaction system: total RNA 1-5 μ g, 3 ' Qt (10 μ M), 1 μ L; 10mM dNTP mixture 1 μ L; 10 * RT buffer, 2 μ L, TransScript II RT Enzyme Mix 1 μ L mends RNase-free H
2O to 20 μ L.Add mixing gently, hatch 50min for 50 ℃.70 ℃ of heating 15min inactivation TransScript II RT.
CDNA fragment according to after the order-checking designs two Auele Specific Primer 3 ' GSP
0With 3 ' GSPi, with 3 ' Q
0Being used for 3 ' of nest-type PRC amplification enolase gene together with 3 ' Qi holds.One takes turns the PCR reaction system: 10 * PCR buffer5 μ L, dNTP mixture (each 2.5mM) 5 μ L, template cDNA 1 μ L, 3 ' GSP
0With 3 ' Q
0(10 μ M) each 2.5 μ L, rTaq 0.5 μ L, moisturizing to 50 μ L.Reaction conditions: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 1min30s, 30 circulations.One take turns be used for after 100 times of the product dilutions of PCR reaction two take turns the PCR reaction template, the same term harmonization of taking turns the PCR reaction of other conditions.
The PCR product is checked order.
(2) 5 ' RACE reaction
CDNA fragment according to after the order-checking designs specific reverse transcription primer a 5 ' GSP-RT, is used for reverse transcription.Reaction system: total RNA 1-5 μ g, 5 ' GSP-RT (10 μ M), 0.3 μ L, 10mM dNTP mixture 1 μ L, 10 * RT buffer, 2 μ L, TransScript II RT Enzyme Mix 1 μ L mends RNase-free H
2O to 20 μ L.Add mixing gently, hatch 50min for 50 ℃.70 ℃ of heating 15min inactivation TransScript II RT.With cDNA with the absolute ethyl alcohol purifying after, add Poly (C) tail, the tailing system: 5 * TdT buffer, 5 μ L, the cDNA 16 μ L behind the purifying, 0.1%BSA 2.5 μ L, dCTP 0.5 μ L, TdT 1 μ L.37 ℃ of reaction 30min are used for the template that follow-up PCR reacts.
Carry out taking turns the PCR reaction with poly (G) primer 5 ' Qt that has adaptor and 5 ' GSP-RT.Reaction system and reaction conditions are all with 3 ' RACE reaction system.One take turns be used for after 100 times of the product dilutions of PCR reaction two take turns the PCR reaction template, primer is 5 ' adaptor and 5 ' GSPi, the same term harmonization of taking turns the PCR reaction of other conditions.
The PCR product is checked order.
6, the acquisition of gene
According to the sequencing result of Phytolacca acinosa enolase gene fragment and RACE splicing sequence, design a pair of Auele Specific Primer ENO-F and ENO-R amplification total length Phytolacca acinosa enolase gene.The PCR product detects with 1% agarose gel electrophoresis; The purpose band is connected with pMD-19T simple vector (available from Takara company) with sepharose purification kit purifying, transformed into escherichia coli Escherichia coli DH5 α competent cell; With blue hickie method screening positive clone; The picking mono-clonal is cultivated, and carries out pcr amplification once more with above-mentioned primer, and is positive with further checking clone.Positive colony is checked order.
The length of total length Phytolacca acinosa enolase gene is 1521bp, comprises the complete opening code-reading frame that a length is 1335bp (shown in the sequence 2 of sequence table).
Protein shown in the sequence 1 of Phytolacca acinosa enolase gene code sequence tabulation, albumen shown in the sequence 1 is made up of 444 amino-acid residues, approximately 53kD.Blastp through NCBI carries out similarity analysis, finds that the aminoacid sequence of Phytolacca acinosa Hydratase, phosphoenolpyruvate is the most similar with the sequence of known ice plant (Mesembryanthemum crystallinum), and the sequence similarity degree is 93%.
Acquisition and the Cadmium resistance ability of embodiment 2, reorganization bacterium are identified
One, the preparation of Phytolacca acinosa enolase gene
After the Phytolacca acinosa seed soaked 20min with 98% vitriol oil, the HgCl with 0.1%
2Sterilization places on the 1/2MS substratum and sprouts, about two weeks behind the seed germination, and to get seedling leaves and extract RNA, reverse transcription is cDNA.With cDNA is template, adopts Auele Specific Primer to (ENO-petF and ENO-petR) pcr amplification total length Phytolacca acinosa enolase gene.
Two, construction of prokaryotic expression vector
With NcoI and XhoI double digestion pcr amplification product, reclaim the purpose fragment, link between the NcoI and XhoI restriction enzyme site of prokaryotic expression carrier pET-28a (+), obtain recombinant expression vector.With recombinant expression vector transformed into escherichia coli DH5 α competent cell.Auele Specific Primer with step 1 is selected positive colony to detection, cuts evaluation with NcoI and XhoI enzyme then, extracts plasmid at last and checks order.The result shows, the recombinant bacterial strain that has obtained correct recombinant plasmid (skeleton carrier is pET-28a (+), between NcoI and XhoI restriction enzyme site, contains the Phytolacca acinosa enolase gene shown in the sequence 2 of ordered list) and contained recombinant plasmid.
With pET-28a (+) transformed into escherichia coli DH5 α competent cell, obtain the empty carrier control strain.
Three, Expression of Fusion Protein
The single recombinant bacterial strain of picking contains 100 * 10 in 2mL
-6In the LB nutrient solution of g/mL kantlex, 37 ℃ of incubated overnight.Next day, be inoculated in 1: 100 volume ratio in the LB nutrient solution of 10mL, in 37 ℃ of shaking culture, to OD
600=0.6～0.8 o'clock, add IPTG to final concentration be 0.1mmol/L.Extract the 0.5mL nutrient solution in 6h, the centrifugal 1min of 5000r/min collects thalline, adds 100 μ L SDS-PAGE sample buffers and mixes, and boils behind the 10min centrifugally, gets supernatant electrophoresis on 12% SDS-PAGE gel, coomassie brilliant blue R250 dyeing.
Cultivate the empty carrier control strain and carry out electrophoresis, method is the same.
The SDS-PAGE electrophorogram is seen Fig. 1.The result shows that IPTG induces escherichia coli expression target protein success (the about 53kD of target protein molecular weight).
Four, recombinant bacterial strain Cadmium resistance growth phenotype detects
1, the Cadmium resistance of recombinant bacterial strain growth phenotype on solid medium
Respectively the recombinant bacterial strain bacterium liquid or the empty carrier control strain bacterium liquid of incubated overnight are transferred OD
600To about 0.8, stepwise dilution to 1000 times then is coated onto and contains 1mM CdCl
2The LB solid medium on, and add 0.8M IPTG 6 μ L and smoothen 37 ℃ of cultivations.
The result sees Fig. 2 (1000 times of dilutions of bacterium liquid).Has more bacterium colony on the substratum of cultivation recombinant bacterial strain.The result shows that than control strain, the recombinant bacterial strain that changes goal gene (Phytolacca acinosa enolase gene) over to is to 1mM CdCl
2Bigger resistance is arranged.
2, recombinant bacterial strain Cadmium resistance growth phenotype detects in the liquid medium within
Respectively with the recombinant bacterial strain bacterium liquid of incubated overnight and the empty carrier control strain bacterium liquid dilution proportion by 1: 100,37 ℃, 200rpm shake to OD
600=0.6～0.8; Respectively recombinant bacterial strain bacterium liquid and empty carrier control strain bacterium liquid are diluted to OD with the LB substratum
600About=0.1, add CdCl
2To final concentration be 1mM, add IPTG to final concentration be 0.1mmol/L (inducing destination gene expression).Every at a distance from 1h survey OD
600Detect its upgrowth situation.
The result sees Fig. 3.The result shows that than control strain, the recombinant bacterial strain that changes goal gene (Phytolacca acinosa enolase gene) over to is to 1mM CdCl
2Than control strain bigger resistance is arranged, quantity approximately is 3 times of control strain.
More than explanation, the expression of Phytolacca acinosa enolase gene in intestinal bacteria improved it greatly to CdCl
2Resistance.
Sequence table
< 110>Institute of Botany, Chinese Academy of Sciences
< 120>a kind of biological cadmium resistance-associated protein and encoding sox thereof
<130>CGGNARY92555
<160>2
<210>1
<211>444
<212>PRT
< 213>dyers' grapes (Phytolacca americana Linn.)
<400>1
Met Val Thr Ile Lys Cys Val Lys Ala Arg Gln Ile Tyr Asp Ser Arg
1 5 10 15
Gly Asn Pro Thr Val Glu Ala Asp Val His Leu Asp Asp Gly Thr Phe
20 25 30
Ala Arg Ala Ala Val Pro Ser Gly Ala Ser Thr Gly Ile Tyr Glu Ala
35 40 45
Leu Glu Leu Arg Asp Gly Gly Ser Asp Tyr Met Gly Lys Gly Val Gln
50 55 60
Lys Ala Val Asn Asn Val Asn Glu Ile Ile Gly Pro Ala Leu Val Gly
65 70 75 80
Lys Asp Pro Thr Gln Gln Thr Ala Ile Asp Asn Phe Met Val Gln Gln
85 90 95
Leu Asp Gly Thr Val Asn Glu Trp Gly Trp Cys Lys Gln Lys Leu Gly
100 105 110
Ala Asn Ala Ile Leu Ala Val Ser Leu Ala Val Cys Lys Ala Gly Ala
115 120 125
Gln Val Lys Lys Thr Pro Leu Tyr Lys His Ile Ala Glu Leu Ala Gly
130 135 140
Asn Lys Asn Leu Val Leu Pro Val Pro Ala Phe Asn Val Ile Asn Gly
145 150 155 160
Gly Ser His Ala Gly Asn Lys Leu Ala Met Gln Glu Phe Met Ile Leu
165 170 175
Pro Ile Gly Ala Ser Ser Phe Lys Asp Ala Met Lys Met Gly Ser Glu
180 185 190
Val Tyr His His Leu Lys Ser Val Ile Lys Lys Lys Tyr Gly Gln Asp
195 200 205
Ala Thr Asn Val Gly Asp Glu Gly Gly Phe Ala Pro Asn Ile Gln Glu
210 215 220
Asn Lys Glu Gly Leu Glu Leu Leu Lys Thr Ala Ile Glu Lys Ala Gly
225 230 235 240
Tyr Thr Gly Lys Val Val Ile Gly Met Asp Val Ala Ala Ser Glu Phe
245 250 255
Tyr Asn Asp Asp Lys Thr Tyr Asp Leu Asn Phe Lys Glu Glu Asn Asn
260 265 270
Asp Gly Ser Gln Lys Ile Ser Gly Asn Ala Leu Lys Asp Leu Tyr Lys
275 280 285
Ser Phe Val Thr Glu Tyr Pro Ile Val Ser Ile Glu Asp Pro Phe Asp
290 295 300
Gln Asp Asp Trp Glu His Tyr Ala Lys Met Thr Ala Glu Ile Gly Asp
305 310 315 320
Lys Val Gln Ile Val Gly Asp Asp Leu Leu Val Thr Asn Pro Lys Arg
325 330 335
Val Gln Lys Ala Ile Asp Glu Lys Thr Cys Asn Ala Leu Leu Leu Lys
340 345 350
Val Asn Gln Ile Gly Ser Val Thr Glu Ser Ile Glu Ala Val Lys Met
355 360 365
Ser Lys Gln Ala Gly Trp Gly Val Met Ala Ser His Arg Ser Gly Glu
370 375 380
Thr Glu Asp Thr Phe Ile Ala Asp Leu Ser Val Gly Leu Ser Thr Gly
385 390 395 400
Gln Ile Lys Thr Gly Ala Pro Cys Arg Ser Glu Arg Leu Ala Lys Tyr
405 410 415
Asn Gln Leu Leu Arg Ile Glu Glu Glu Leu Gly Ala Glu Ala Val Tyr
420 425 430
Ala Gly Ala Lys Phe Arg Gln Pro Val Glu Pro Tyr
435 440
<210>2
<211>1335
<212>DNA
< 213>dyers' grapes (Phytolacca americana Linn.)
<400>2
atggttacca tcaagtgcgt caaagccagg cagatctacg acagtcgtgg taaccccacc 60
gttgaggctg atgttcatct agatgatgga actttcgcta gagctgctgt tcctagtggt 120
gcatccactg gaatttatga ggcacttgaa ctcagggatg gaggttcaga ctacatggga 180
aaaggtgttc aaaaggctgt taacaatgta aacgagatta tcggcccagc attggttggc 240
aaggacccaa ctcagcaaac tgctattgac aacttcatgg ttcaacaact tgatggaact 300
gtgaacgagt ggggttggtg caaacaaaag ttgggggcaa atgctatctt agctgtttcc 360
cttgctgtct gcaaagctgg agcccaggtc aagaaaactc ctttgtacaa gcacatagca 420
gagctcgctg gtaacaagaa cttggttttg ccagtacctg ctttcaatgt catcaatggt 480
ggatcccatg ccggaaacaa gcttgcgatg caggagttca tgattcttcc tattggagct 540
tcctcattca aggatgcaat gaagatgggc agtgaagtgt atcaccattt gaagagtgtg 600
atcaagaaga agtacggtca agatgcaacc aatgtaggtg atgagggtgg ttttgctcct 660
aatatccagg agaacaagga gggtcttgaa ctgcttaaga cagccattga gaaagctgga 720
tacacaggca aagtcgttat tggaatggat gttgctgcat ctgagttcta caatgatgac 780
aagacctatg acttgaactt caaagaagag aacaatgatg gatcacaaaa gatctctggc 840
aatgccctca aggatcttta caaatcattt gtaacagagt accctatagt gtcaattgaa 900
gacccatttg accaggatga ctgggagcac tatgccaaaa tgaccgctga aattggagat 960
aaagtacaaa ttgttggtga tgatctcttg gtcaccaacc ccaagagagt ccaaaaggcc 1020
atcgatgaaa agacctgcaa cgcccttctt ctcaaggtca atcaaattgg gtctgtgaca 1080
gagagcattg aagctgtgaa gatgtccaaa caagctggat ggggtgtgat ggccagccac 1140
cgcagtggtg aaactgaaga cactttcatc gctgaccttt ctgtgggttt gtctacggga 1200
caaatcaaga caggagcacc atgcagatct gagcgtcttg ctaaatacaa ccagctattg 1260
cgtattgaag aagagcttgg cgcagaagct gtttatgctg gagccaaatt ccgccagcct 1320
gttgagccct actaa 1335
Claims (9)
1. protein, the protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1.
2. coding claim 1 said proteic gene.
3. gene as claimed in claim 2 is characterized in that: said gene is the dna molecular shown in the sequence 2 in the sequence table.
4. the recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain claim 2 or 3 said genes.
5. recombinant expression vector as claimed in claim 4 is characterized in that: said recombinant expression vector is that the MCS that claim 2 or 3 said genes insert pET-28a (+) plasmids is obtained.
6. reorganization bacterium as claimed in claim 4 is characterized in that: said reorganization bacterium is that claim 2 or 3 said genes are imported in the bacterium that sets out, and the Cadmium resistance ability that obtains is higher than the reorganization bacterium of the said bacterium that sets out.
7. reorganization bacterium as claimed in claim 6 is characterized in that: claim 2 or 3 said genes import in the said bacterium that sets out through claim 4 or 5 said recombinant expression vectors; The said bacterium that sets out is E.coli DH5 α.
8. the application of expression cassette in the biology of cultivating the raising of Cadmium resistance ability in arbitrary said recombinant expression vector or the claim 4 in claim 2 or 3 said genes, the claim 4 or 5.
9. application as claimed in claim 8 is characterized in that: said biology is plant or intestinal bacteria E.coli DH5 α.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910093926A CN102020706B (en) | 2009-09-23 | 2009-09-23 | Associated protein of biology cadmium resistance and coding gene of same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910093926A CN102020706B (en) | 2009-09-23 | 2009-09-23 | Associated protein of biology cadmium resistance and coding gene of same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102020706A CN102020706A (en) | 2011-04-20 |
| CN102020706B true CN102020706B (en) | 2012-08-29 |
Family
ID=43862518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910093926A Expired - Fee Related CN102020706B (en) | 2009-09-23 | 2009-09-23 | Associated protein of biology cadmium resistance and coding gene of same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102020706B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417899A (en) * | 2011-12-19 | 2012-04-18 | 中山大学 | Metallic cadmium resistance associated protein KdpD and coding gene and application thereof |
| CN102517266B (en) * | 2011-12-19 | 2013-12-04 | 中山大学 | Metallic cadmium resistance related protein UvrA and coding gene and application thereof |
| CN102432677B (en) * | 2011-12-19 | 2013-07-03 | 中山大学 | Metal-cadmium-resistance-related protein DbsCPA2, coding gene and application thereof |
| CN102603873B (en) * | 2012-03-22 | 2014-12-03 | 中山大学 | Heavy metal cadmium resistance related protein DbsCzcA as well as coding gene and application thereof |
| CN102617711B (en) * | 2012-04-28 | 2013-09-18 | 中山大学 | Cation diffusion assisting protein DbsCDF and encoding gene and application thereof |
| CN112175056B (en) * | 2020-09-14 | 2022-03-25 | 中国科学院华南植物园 | OsABCG48 gene and application thereof in improving cadmium stress resistance of unicellular organisms and plants |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597959A (en) * | 2004-09-16 | 2005-03-23 | 上海交通大学 | Code sequence of anti-anaerobic enolase protein in rape of cabbage type |
| CN1603413A (en) * | 2004-10-21 | 2005-04-06 | 上海交通大学 | Cotton anaerobic enolase protein encoding sequence |
-
2009
- 2009-09-23 CN CN200910093926A patent/CN102020706B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597959A (en) * | 2004-09-16 | 2005-03-23 | 上海交通大学 | Code sequence of anti-anaerobic enolase protein in rape of cabbage type |
| CN1603413A (en) * | 2004-10-21 | 2005-04-06 | 上海交通大学 | Cotton anaerobic enolase protein encoding sequence |
Non-Patent Citations (1)
| Title |
|---|
| Hannaert V. et al.AJ271719.1.《GenBank》.2005,全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102020706A (en) | 2011-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102020706B (en) | Associated protein of biology cadmium resistance and coding gene of same | |
| CN102234653B (en) | Salt-tolerant and drought-resistant gene TaMYB33 of wheat and coding protein as well as application thereof | |
| CN107383179B (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN103194456B (en) | Lilium regale antifungal gene Lr14-3-3 and application thereof | |
| CN102337253B (en) | Polypeptide, polynucleotides, carrier and the host cell of separation | |
| CN108070578A (en) | A kind of and plant stress tolerance correlative protein GmHAD1 and its encoding gene and application | |
| CN109929019A (en) | A kind of and plant salt tolerance alkali GAP-associated protein GAP GsERF7 and its encoding gene and application | |
| CN110452911A (en) | Corn ATP binding cassette transporter body protein raq gene ZmABCE2 and application | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN109810961B (en) | A- amylase mutant and its encoding gene and their application for high concentration starch liquefacation | |
| CN101250543B (en) | Japan snakeroot strictosidine synthase gene and its coding protein and application | |
| CN112813079B (en) | Danbo black soybean GmFER84 gene and application thereof in soybean aluminum stress improvement | |
| CN104561036A (en) | Plant salt-tolerance related gene PpSIG1 as well as encoding protein and application of gene | |
| CN111560056B (en) | Wheat stripe rust resistance related protein TaERF8 and coding gene and application thereof | |
| CN101255428B (en) | Plant salt resistance related gene and use thereof in plant breeding | |
| CN107459566B (en) | L hWDR protein derived from lily and coding gene and application thereof | |
| CN102746391A (en) | Arsenic-resistance related protein PvArrp1, and coding gene and application thereof | |
| CN101792488A (en) | Cotton disease resistance related transcription factor MEREB2, and protein encoding gene and application thereof | |
| CN101701210B (en) | Plant drought-resistant associated protein P5CS, encoding genes and application thereof | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN106636030B (en) | Plant drought GAP-associated protein GAP EtSnRK2.2 and its encoding gene and application | |
| CN100370027C (en) | High-molecular glutelin By8 gene of flint wheat and use thereof | |
| CN1970765A (en) | High-molecular wheat glutelin subunit gene, nucleic acid sequence of promoter thereof, and application thereof | |
| CN114990140B (en) | Cassava pyridoxal kinase gene and application thereof in improving salt tolerance of plants | |
| CN113913450B (en) | Method for expressing chitosanase by rhodopseudomonas palustris, chitosanase, recombinant plasmid, recombinant bacteria, fermentation bacteria and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120829 Termination date: 20150923 |
|
| EXPY | Termination of patent right or utility model |