CN102002491A - 11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues - Google Patents
11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues Download PDFInfo
- Publication number
- CN102002491A CN102002491A CN2009101948123A CN200910194812A CN102002491A CN 102002491 A CN102002491 A CN 102002491A CN 2009101948123 A CN2009101948123 A CN 2009101948123A CN 200910194812 A CN200910194812 A CN 200910194812A CN 102002491 A CN102002491 A CN 102002491A
- Authority
- CN
- China
- Prior art keywords
- mirna
- seq
- chip
- sequence
- microrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to 11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues, in particular to a kind of microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues. The tests prove that the specific microRNA markers can very effectively distinguish the primary liver cancer tissues and para-cancer tissues. The invention also relates to a chip and a kit for detecting the microRNA markers.
Description
Technical field
The present invention relates to biological technical field, more specifically, the present invention relates to microRNA mark and purposes that a class can be used for distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.The invention still further relates to the chip and the test kit that detect described microRNA mark.
Background technology
Primary hepatocarcinoma is one of modal malignant tumour of China, and annual new cases account for the whole world 50%.The grade malignancy height of liver cancer, development are treated difficulty, the case fatality rate height rapidly.Therefore, the diagnosis as early as possible of liver cancer just more seems urgent.
The generation development of anything all is under the internal and external reasons acting in conjunction, and is interior because main, outer because auxilliary.Gene is as the hereditary medium of life, organism sick, old,, be in the status of basic internal cause in dead.Overwhelming majority gene is by transcribing the product nucleus ribosomal ribonucleic acid, and translation generates protein and brings into play biological function again.
MicroRNA (miR or miRNA, Microrna) is that a class extensively exists the single stranded RNA molecule of the about 18-26 of a length base in more high most eukaryotes.It can combine with target site on some mRNA specifically by basepairing rule, causes that said target mrna degraded or translation suppress, and then at post-transcriptional level target gene is regulated and control.
MicroRNA derives from the initial transcription product of long-chain RNA (Pri-miRNA) that length is about 1000bp, and the Pri-miRNA molecule is sheared the miRNA precursor (Pre-miRNA) with loop-stem structure that forms the about 60~80nt of length through the Drosha enzyme in nucleus.After Pre-miRNA is transported to kytoplasm, further cut into the double-stranded miRNA that is about 22nt by the Dicer enzyme.After double-stranded miRNA unties, sophisticated miRNA enter the reticent mixture of RNA induced gene (RNA-induced silencing complex, RISC), with complementary mRNA fully or incomplete pairing, degraded said target mrna or check its expression.
Although microRNA shared proportion in cell total rna is very little, but because it can produce regulating and controlling effect to all mRNA with target site efficiently, microRNA still can't neglect in the growth of organism and even generation, the evolution role of tumour.
Yet up to now, this area is understood very few for the microRNA relevant with tumour (as liver cancer), so this area presses for and separate various microRNA further, especially with generation, transfer, the recurrence of tumour or detect relevant microRNA.
Summary of the invention
Purpose of the present invention just provides class microRNA mark new, that can be used for distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.
Another object of the present invention just provides the purposes of described microRNA mark.
In a first aspect of the present invention, a kind of isolating miRNA is provided, described miRNA is selected from:
(i) miRNA of sequence shown in SEQ ID NO:n, wherein n is the positive integer that is selected from 1-11; Or
(ii) with sequence complementary miRNA shown in the SEQ ID NO:n.
In another preference, described miRNA separates from the people.
In a second aspect of the present invention, a kind of miRNA collection (set) or combination (combination) are provided, described collection or combination are made of 11 kinds of miRNA of sequence shown in SEQ ID NO:1-11.
In a third aspect of the present invention, a kind of isolating or artificial constructed precursor miRNA is provided, the miRNA described in the first aspect present invention can be sheared and be expressed as to described precursor miRNA in people's cell.
In a fourth aspect of the present invention, a kind of isolating polynucleotide are provided, described polynucleotide can be become precursor miRNA by people's cell transcription, and described precursor miRNA can be sheared and be expressed as the miRNA described in the first aspect present invention in people's cell.
In another preference, described polynucleotide have the structure shown in the formula I:
Seq
Forward-X-Seq
OppositelyFormula I,
Among the formula I,
Seq
ForwardFor in people's cell, being expressed as the nucleotide sequence of described miRNA,
Seq
OppositelyFor with Seq
ForwardBasically complementary or complete complementary nucleotide sequence;
X is for being positioned at Seq
ForwardAnd Seq
OppositelyBetween intervening sequence, and described intervening sequence and Seq
ForwardAnd Seq
OppositelyIt is not complementary,
And the structure shown in the formula I forms the secondary structure shown in the formula II after changing people's cell over to:
Among the formula II, Seq
Forward, Seq
OppositelyWith the definition of X such as above-mentioned,
|| be illustrated in Seq
ForwardAnd Seq
OppositelyBetween the base complementrity pair relationhip that forms.
In a fifth aspect of the present invention, a kind of carrier is provided, it contains the miRNA described in the first aspect present invention, or the polynucleotide described in the fourth aspect.
In a sixth aspect of the present invention, the purposes of the miRNA described in the first aspect present invention is provided, be used to prepare chip or the test kit of distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.
In a seventh aspect of the present invention, a kind of miRNA chip is provided, described miRNA chip comprises:
Solid phase carrier; And
Be fixed on the oligonucleotide probe on the described solid phase carrier in order, described oligonucleotide probe is specifically corresponding to the part or all of sequence shown in the SEQ ID NO:1-11.
In another preference, described oligonucleotide probe contains:
Complementary land; And/or
The joining region that links to each other with solid phase carrier.
In a eighth aspect of the present invention, the purposes of above-mentioned miRNA chip is provided, be used to prepare the test kit of distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.
In a ninth aspect of the present invention, a kind of test kit is provided, contain the above-mentioned described miRNA chip of the present invention in the described test kit.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1: after the MDS algorithm conversion cancer sample (red or light color) and the scatter diagram of the other sample of cancer (blue or dark color) in three-dimensional space to be arranged.
Embodiment
The inventor is through long-term and extensive studies, and the cancerous tissue sample by detecting primary hepatocarcinoma and the microRNA express spectra level of cancer beside organism's sample are used statistical method, therefrom filter out 11 specific microRNA first.Through testing identity, these specific microRNA marks can be distinguished primary hepatocarcinoma cancerous tissue and cancer beside organism very effectively.Finished the present invention on this basis.
Particularly, the inventor adopts the method for chip hybridization to obtain the cancerous tissue sample of primary hepatic carcinoma and the microRNA express spectra of cancer beside organism's sample, by comparing the express spectra of two kinds of tissues, obtain the microRNA that these two kinds of sample differences of cancerous tissue sample and cancer beside organism are expressed.As the candidate, using the screening of C-SVC or V-SVC classifier algorithm to obtain classify accuracy is a classifiers (containing 11 microRNA) of 100% with these difference microRNA.By these 11 sorters that microRNA forms, measurable sample is from cancerous tissue or cancer beside organism, and its prediction accuracy reaches 100%.Based on these 11 microRNA of the present invention, can be developed to small-sized microRNA chip or RT-PCR test kit and be used to distinguish liver cancer tissue and cancer beside organism.
MiRNA and precursor thereof
The invention provides the new miRNA of a class from the philtrum discovery.As used herein, described " miRNA " is meant a kind of RNA molecule, from forming the transcript processing of miRNA precursor.Sophisticated miRNA has 18-26 Nucleotide (nt) (more particularly about 19-22nt) usually, does not also get rid of the miRNA molecule with other number Nucleotide.MiRNA can be detected by the Northern trace usually.
The miRNA in people source can be separated from people's cell.As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
MiRNA can (described precursor miRNA can be folded into a kind of stable stem ring (hair clip) structure for Precursor miRNA, Pre-miRNA) processing, and described loop-stem structure length is generally between 50-100bp from precursor miRNA.Described precursor miRNA can be folded into stable loop-stem structure, and the stem both sides of loop-stem structure comprise complementary two sequences basically.Described precursor miRNA can be natural or synthetic.
Precursor miRNA can be sheared and generate miRNA, and described miRNA can be complementary basically with at least a portion sequence of the mRNA of encoding gene.As used herein, " complementary basically " is meant that the sequence of Nucleotide is enough complementary, can interact in a kind of foreseeable mode, as forming secondary structure (as loop-stem structure).It is complementary that the nucleotide sequence of two usually, " basically complementary " has 70% Nucleotide between mutually at least; Preferably, having 80% Nucleotide at least is complementary; Preferred, having 90% Nucleotide at least is complementary; Further preferred, having 95% Nucleotide at least is complementary; As 98%, 99% or 100%.Usually, can have maximum 40 unmatched Nucleotide between two enough complementary molecules; Preferably, have maximum 30 unmatched Nucleotide; Preferred, have maximum 20 unmatched Nucleotide; Further preferred, have maximum 10 unmatched Nucleotide, as have 1,2,3,4,5,8,11 unmatched Nucleotide.
As used herein, " stem ring " structure also is known as " hair clip " structure, be meant a kind of nucleic acid molecule, it can form a kind of secondary structure that comprises double-stranded region (stem), described double-stranded region is formed by two zones (being positioned at on a part) of this nucleic acid molecule, the both sides of two double-stranded parts of regional apportion; It also comprises at least one " ring " structure, comprises non-complementary nucleic acid molecule, i.e. the strand zone.Even two zones of this nucleic acid molecule are not complete complementary, the double-stranded part of Nucleotide also can keep double-stranded state.For example, insertion, disappearance, replacement etc. can cause not complementary or this zonule self the formation loop-stem structure of a zonule or the secondary structure of other form, yet these two zones still can be complementary basically, and in foreseeable mode, interact, form the double-stranded region of loop-stem structure.Loop-stem structure is well-known to those skilled in the art, and usually behind the nucleic acid that has obtained a nucleotide sequence with primary structure, those skilled in the art can determine whether this nucleic acid can form loop-stem structure.
MiRNA of the present invention has the sequence shown in SEQ ID NO:n, and wherein n is the positive integer (also being that n is selected from 1,2,3,4,5,6,7,8,9,10 or 11) that is selected from 1-11.
In order to improve stability or other character of miRNA, also can add at least one protectiveness base, as " TT " etc. at least one end of described miRNA.
Antisense oligonucleotide
According to miRNA sequence provided by the present invention, can design their antisense oligonucleotide, described antisense oligonucleotide can be reduced the expression of corresponding miRNA in vivo.As used herein, " antisense oligonucleotide (antisense-oligonucleotides, AS-Ons or ASO) " is called " antisense nucleotide " again, is meant that length is about dna molecular or RNA molecule or its analogue of 18-26nt (more particularly about 19-22nt).
In the present invention, described " antisense oligonucleotide " also comprises the modified antisense nucleotide that adopts as based on means acquisitions such as nucleic acid lock or nucleic acid chains backbone modification technology, described modification does not change the activity of antisense oligonucleotide substantially, more preferably, described modification can improve stability, activity or the result of treatment of antisense oligonucleotide.(locked nucleic acid LNA) typically refers to the modification technique that the 2 ' Sauerstoffatom and the 4 ' carbon atom of ribose is coupled together by a methylene bridge for nucleic acid lock.LNA can prolong the serum half-life of miRNA, improves the target affinity, reduces the scope and the degree of the effect of missing the target.The antisense drug that goes out based on the modification technique development of nucleic acid chains skeleton is in solubility, and aspects such as nuclease-resistant degraded have improvement greatly, and are easy to a large amount of synthetic.The backbone modification method of oligonucleotide has multiple, comprises the sulfo-method, is sulfo-deoxynucleotide chain with deoxynucleotide chain thio-modification for example.This method is that the Sauerstoffatom of the phosphate bond on the DNA skeleton is alternative with sulphur atom, can resist nuclease degradation.Should be understood that and anyly can keep most of or whole active modifications of described antisense oligonucleotide to be included among the present invention.
As optimal way of the present invention, antisense oligonucleotide is carried out the nucleic acid lock modify; More preferably also carry out thio-modification.
After transferring to antisense oligonucleotide of the present invention in the human body, they can obviously reduce the expression of relevant miRNA.
The polynucleotide construction
According to people miRNA sequence provided by the present invention, can design the polynucleotide construction that after being imported into, can be processed to influence the miRNA that corresponding mRNA expresses, also be the amount that described polynucleotide construction can raise corresponding miRNA in vivo.Therefore, the invention provides a kind of isolating polynucleotide (construction), described polynucleotide (construction) can be become precursor miRNA by people's cell transcription, and described miRNA can be sheared and be expressed as to described precursor miRNA by people's cell.
As a kind of optimal way of the present invention, described polynucleotide construction contains the structure shown in the formula I:
Seq
Forward-X-Seq
OppositelyFormula I,
Among the formula I,
Seq
ForwardFor can in cell, being expressed as the nucleotide sequence of described miRNA, Seq
OppositelyFor with Seq
ForwardBasically complementary nucleotide sequence; Perhaps, Seq
OppositelyFor can in cell, being expressed as the nucleotide sequence of described miRNA, Seq
Just ToFor with Seq
ForwardBasically complementary nucleotide sequence;
X is for being positioned at Seq
ForwardAnd Seq
OppositelyBetween intervening sequence, and described intervening sequence and Seq
ForwardAnd Seq
OppositelyNot complementary;
Structure shown in the formula I forms the secondary structure shown in the formula II after changing cell over to:
Among the formula II, Seq
Forward, Seq
OppositelyWith the definition of X such as above-mentioned;
|| be illustrated in Seq
ForwardAnd Seq
OppositelyBetween the base complementrity pair relationhip that forms.
Usually, described polynucleotide construction is positioned on the expression vector.Therefore, the present invention also comprises a kind of carrier, and it contains described miRNA, or described polynucleotide construction.Described expression vector also contains promotor, replication orgin and/or marker gene etc. usually.Method well-known to those having ordinary skill in the art can be used to make up expression vector required for the present invention.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, as kalamycin, gentamicin, Totomycin, amicillin resistance.
Chip
The microRNA chip of expression spectrum contains a nearly hundreds of probe usually, contains multiple microRNA, utilizes dna double chain homology complementary principle to detect the content of contained various microRNA in the sample on full genomic level.Therefore, can be at one time the transcriptional level of the microRNA in the full genome range in the sample to be tested be detected.
Utilize miRNA sequence of the present invention, can also prepare corresponding miRNA chip, and then study the regulative mode of its express spectra and miRNAs.
On the other hand, the present invention also provides a kind of chip that is used to analyze the miRNA express spectra, and described chip can be used for distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.Described miRNA chip of the present invention comprises:
Solid phase carrier; And
Be fixed on the oligonucleotide probe on the described solid phase carrier in order, described oligonucleotide probe is specifically corresponding to the sequence shown in the SEQ ID NO:1-11.
Particularly, can design suitable probe, be fixed on the solid phase carrier, form " oligonucleotide arrays " according to miRNA of the present invention.Described " oligonucleotide arrays " is meant have the addressable point array of (promptly with distinctive, addressable address is the position of feature), and a coupled characteristic oligonucleotide is all contained in each addressable point.As required, oligonucleotide arrays can be divided into a plurality of inferior battle arrays.
Described solid phase carrier can adopt the various common used materials in gene chip field, such as but not limited to nylon membrane, and the slide of slide of modifying through active group (as aldehyde radical, amino etc.) or silicon chip, unmodified, plastic sheet etc.
The preparation of described miRNA chip can be adopted the conventional manufacture method of biochip known in the art.For example, if what solid phase carrier adopted is to modify slide or silicon chip, 5 ' end of probe contains amido modified poly-dT string, oligonucleotide probe can be mixed with solution, adopt point sample instrument that its point is being modified on slide or the silicon chip then, be arranged in predetermined sequence or array, spending the night by placement then fixes, and just can obtain miRNA chip of the present invention.If it is amido modified that nucleic acid does not contain, then its preparation method also can reference: Wang Shenwu chief editor's " gene diagnosis technology-on-radiation operational manual "; J.L.erisi, V.R.Iyer, P.O.BROWN.Exploring the metabolic and genetic control of gene expression on agenomic scale.Science, 1997; 278:680 and Ma Li people, the Jiang Zhonghua chief editor. biochip. Beijing: Chemical Industry Press, 2000,1-130.
Another aspect, the present invention also provides a kind of method by miRNA express spectra in the miRNA chip detection people tissue, comprises step:
(1) provides the RNA sample of separation, on described RNA, marker is set from people's tissue;
(2) RNA with (1) contacts with described chip, makes the oligonucleotide probe generation hybridization on described RNA and the solid phase carrier, thereby forms " oligonucleotide probe-RNA " binary complex on solid phase carrier;
(3) detect the marker of the binary complex of (2) formation, thereby determine the express spectra of corresponding miRNA in people's tissue.
The method of extracting RNA from people's tissue is a method well known to those skilled in the art, comprises the Trizol method.
Preferred, in step (1), after from people's tissue tissue, isolating the RNA sample, the RNA sample is suitably handled, have the RNA of certain-length with enrichment, described length is between 10-100 (small fragment RNA) generally.Through after the above-mentioned processing, utilize these small fragment RNAs to carry out follow-up hybridization, can improve the accuracy that chip is caught miRNA like this.Those skilled in the art can isolate the RNA with certain fragment length easily, such as adopting gel electrophoresis to separate.
It also is method well known to those skilled in the art that RNA is carried out mark, and it can be by the method realization of adding when hybridizing with RNA specificity bonded marker, and described marker is such as being labelling groups.Described labelling groups includes but not limited to: digoxin molecule (DIG), biotin molecule (Bio), fluorescein and the biomolecules of deriving (FITC etc.) thereof, other fluorescence molecule (as Cy3, Cy5 etc.), alkaline phosphatase (AP), horseradish peroxidase (HRP) etc.These marks and marking method thereof all have been routine techniques well-known in the art.
When above-mentioned RNA and miRNA chip are hybridized, can earlier miRNA chip and prehybridization damping fluid be carried out prehybridization.
Solid-phase hybridization between RNA of the present invention and the miRNA chip carries out according to the classical way of this area, and the general personnel in this area determine relevant damping fluid, probe and the optimum condition of concentration of specimens, prehybridization temperature, hybridization temperature and time etc. easily according to experience.Perhaps also can be with reference to described in " molecular cloning experiment guide ".
Obtain according to information such as the position of marking signal on the miRNA chip, intensity then and treat measurement information.If amplified production fluorophor mark, also can be directly obtain and treat measurement information with fluorescence detection device (as laser confocal scanning instrument Scanarray 3000 etc.).
Detection kit
The present invention also provides a kind of test kit, contains chip of the present invention in the described test kit.Described test kit can be used for detecting the express spectra of miRNA; Or be used to distinguish primary hepatocarcinoma cancerous tissue and cancer beside organism.
Preferred, also contain the marker that is useful on the labeled rna sample in the described test kit, and with the corresponding substrate of described marker.
In addition, also can comprise required all ingredients such as being used to extract RNA, PCR, hybridization, colour developing in the described test kit, include but not limited to: extract, amplification liquid, hybridization solution, enzyme, contrast liquid, colour developing liquid, washing lotion, antibody etc.
In addition, also can comprise working instructions and/or chip image analysis software in the described test kit.
Major advantage of the present invention is:
(a) the invention provides a class and can be used for distinguishing microRNA mark primary hepatocarcinoma cancerous tissue and cancer beside organism, new.
(b) sorter that is made of the new microRNA mark of the present invention can be distinguished primary hepatocarcinoma cancerous tissue and cancer beside organism very effectively.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
The preparation of embodiment 1RNA sample
Tissue samples:
The 49 pairs of cancers and cancer beside organism come from the excision sample of Patients with Primary, and these samples come from first affiliated hospital of Zhejiang University and Qidong liver cancer research institute.Above-mentioned all samples obtain all agreement by the Ethics Committee of WHO cooperative association of Shanghai City government authorization.The clinical data of tissue samples comprises: sex, age, tumour size, pathological grading (Edmonson), liver cirrhosis whether, whether shift, whether recur, HBV and HCV infection conditions etc.All do not accept chemotherapy before all patient's arts, postoperative is followed up a case by regular visits to and is reached 60 months most.
Gene chip:
The microRNA chip of expression spectrum adopts the miRNA chip of expression spectrum (single passage chip) of Boao Biological Co., Ltd.
Total tissue RNA is extracted
1. the collection of sample and preservation: in vitro tissue places the liquid nitrogen quick-frozen after cutting into fritter immediately, can move to-80 ℃ of refrigerators then and preserve.
2. tissue block fragmentation: tissue block is put in the liquid nitrogen and pulverizes, and every gram tissue adds 1ml Trizol (Invitrogen company).
3. total RNA extracting: add the chloroform of 0.2ml, thermal agitation 15 seconds, incubated at room 2-3 minute by every milliliter of Trizol; 4 ℃, 10, centrifugal 15 minutes of 000g; Colourless supernatant liquor is moved in the new centrifuge tube, add the 0.5ml Virahol, incubated at room 10 minutes, 4 ℃ of 10000g are centrifugal 10 minutes; Outwell supernatant, 0.75ml 75% washing with alcohol, 4 ℃, 7, centrifugal 5 minutes of 500g; Outwell supernatant, drying at room temperature RNA precipitates 5-10 minute (not making the RNA complete drying), the no RNA enzyme H after handling with DEPC
2The O dissolution precipitation.
4. spectrophotometer standard measure RNA, and the Total RNA that takes a morsel carries out electrophoresis, checks whether RNA degrades.
The extraction of embodiment 2microRNA and mark
MiRNAs extraction agent box extracting with Ambion company obtains miRNA, and concrete operations are according to the respective description book.The sample method of T4 RNA ligase enzyme markers step according to Thomson.In brief, method is as follows:
1.4 the little RNA of μ g and 500ng 5 '-phosphoric acid salt-cytosine(Cyt)-uridylic-cy3-3 ' (Dharmacon, Chicago, USA) and the 2 2units T4 RNA ligase of unit (NEB, Ipswich USA), were hatched 2 hours in 4 ℃, and miRNA is carried out mark.Every part of miRNA sample is all established the corresponding negative control of equivalent.
2. the RNA of mark precipitates with 0.3M sodium-acetate and 2.5 volume ethanol, contains resuspended, all hybridization repetition twice of hybridization solution of 3 * SSC, 0.2%SDS and 15% methane amide again with 15 μ l, hybridization LifterSlip
TM(Erie, PA USA) evenly flows between chip and cover plate to guarantee hybridization solution.
3. hybridization chamber is placed on hybridization instrument BioMixer
TMII is last, and (Capital Bio Corp, Beijing China) spend the night in 42 ℃ of water-bath hybridization, wash twice with washing lotion afterwards.
The microRNA of embodiment 3 screening significant differences
49 routine cancer samples and the other sample of 49 routine cancers are respectively behind fluorochrome label, with the probe competitive hybridization on the microRNA chip of expression spectrum.Chip after the hybridization is with brilliant
LuxScan
TMThe scanning of 10K micro-array chip scanner obtains result images, and is quantitative to results of hybridization by its incidental at random LuxScan 3.0 general microarray image analysis softwares again.Thus, obtain 49 pairs of cancer samples (cancer, Cancer, C) and the other sample of cancer (by the cancer, Pericancerous, microRNA express spectra data P).
Above-mentioned 49 cancer chip results and 49 other chip results of cancer are at first used LOWESS (local weighted regression analysis) normalization method.Afterwards, to get with 2 be the logarithm (log at the end to the other chip results of the cancer after normalization method, cancer
2X), use the Tobin's mean variance model at random (RVM) after the pairing T method of inspection (because cancerous tissue and cancer beside organism derive from same patient) is proofreaied and correct to screen the significant difference microRNA that obtains cancer/cancer other (C/P).
For the significance of verifying microRNA difference is not caused by coincidence, the inventor introduces after the above-mentioned T method of inspection data random rearrangement 1000 times again, detect a microRNA and screening the tested false positive rate (FDR, False DiscoveryRate) that is decided to be significant difference microRNA in back by preceding method.
Only in above-mentioned statistical method, have only the microRNA of p value<0.05 just can screenedly be significant difference microRNA.
The screening and the checking of sorter (can distinguish two histioid microRNA)
For searching is used to distinguish two class samples (by cancer and the cancer), the inventor uses the Lib-SVM tool kit of Matlab software, use C-SVC (the support vector sorter of parameters C) and two kinds of methods of V-SVC (the support vector sorter of V parameter), and adopt four kinds of kernel function (linear kernel separately, ploykernel, gauss kernel, tanh kernel), amount to 8 kinds of methods and make up the svm classifier device.SVM (support vector mechine, support vector machine) sorter is the nonlinear function of logarithmic value of the difference multiple of two class sample differences microRNA, its seek can maximize two class sample separation from lineoid, thereby can distinguish two class samples best.
Be the classify accuracy of inspection-classification device, the inventor selects for use in all crosscheck methods the most stable 10 to take advantage of 10 folding crosscheck methods.10 folding crosscheck methods are that sample totally is divided into 10 sons part, select 1 son part as test data set at every turn, and all the other 9 sons are part as training dataset, repeat 10 times (at every turn with different son parts as test data set).10 assays that so obtain combine and form a assessed value to the sorter classify accuracy.
Again by the highest a kind of of selection sort accuracy in 8 kinds of algorithms as the optimal classification device.
For showing on the same group similar between sample and not different between sample on the same group intuitively, the inventor 3 dimensions look introduce in the effect multidimensional scaling (multidimensional scaling, MDS).The MDS algorithm is determined the position of each sample in lower dimensional space based on similarity matrix between the sample-sample that is classified device (one group of microRNA) definition, and makes it to be adapted to 3 and tie up and look effect.In this 3 dimension space, two samples are approaching more, and then they are similar more; Otherwise, if two samples are at a distance of far away more, then different more between them.
The result
Screen 74 difference microRNA between cancerous tissue and cancer beside organism altogether.With these difference microRNA as the sorter candidate.Be inserted in 8 kinds of svm classifier device algorithms and use aforesaid 10 to take advantage of 10 crosschecks of rolling over to verify the classify accuracy of sorter.
After 1000 secondary data metathetical 10 take advantage of 10 folding cross validations to obtain sorter, for testing the predictive ability of this sorter, 18 samples of inventor's random choose are predicted tissue-derived (by the cancer or the cancer) of each sample with this sorter as unknown sample, are observed its prediction accuracy.Comprehensive 8 kinds of algorithms, the classify accuracy that is obtained by C-SVC (tanh kernel) or these several algorithms of V-SVC (linear kernel, ploy kernel, tanh kernel) is the highest.These several algorithms obtain is used to distinguish the sorter (seeing Table 1) that 11 microRNA of cancer and the other sample of cancer form, and its classify accuracy can reach 100%., the predictablity rate of unknown sample is reached 100%.
For ease of the classifying quality that shows sorter directly perceived, the inventor uses the MDS algorithm 20 microRNA signal values of each sample to be converted to the eigenvector of 3 dimensions, and they are located in 3 dimension spaces, be depicted as the three-dimensional scatter diagram (see figure 1) of the other two class samples of cancer and cancer.Can judge by figure whether the distance between any two samples of different group is bigger than the distance between any two samples on the same group.
Table 1: 11 microRNA that form sorter.
SEQ?ID NO: | The MicroRNA title | The p-value | miRBase_ID | Sequence | The other multiple of liver cancer/cancer |
1 | hsa-miR-106a | 1.00E-007 | MIMAT0000103 | AAAAGUGCUUACAGUGCAGGUAG | 1.58 |
2 | hsa-miR-103 | 2.00E-007 | MIMAT0000101 | AGCAGCAUUGUACAGGGCUAUGA | 1.72 |
3 | hsa-let-7i | 5.00E-007 | MIMAT0000415 | UGAGGUAGUAGUUUGUGCUGUU | 1.58 |
4 | hsa-miR-125b | 1.10E-006 | MIMAT0000423 | UCCCUGAGACCCUAACUUGUGA | 0.6 |
5 | hsa-miR-29c | 2.80E-006 | MIMAT0000681 | UAGCACCAUUUGAAAUCGGUUA | 0.69 |
6 | hsa-miR-148a | 5.40E-006 | MIMAT0000243 | UCAGUGCACUACAGAACUUUGU | 0.76 |
7 | hsa-miR-99a | 1.04E-005 | MIMAT0000097 | AACCCGUAGAUCCGAUCUUGUG | 0.64 |
8 | hsa-miR-451 | 1.13E-005 | MIMAT0001631 | AAACCGUUACCAUUACUGAGUU | 0.64 |
9 | PREDICTED_MIR191 | 1.53E-005 | - | CGCCGCCCCGCACCUGCUGCUG | 1.56 |
10 | hsa-miR-130a | 2.46E-005 | MIMAT0000425 | CAGUGCAAUGUUAAAAGGGCAU | 0.69 |
11 | hsa-miR-107 | <le-07 | MIMAT0000104 | AGCAGCAUUGUACAGGGCUAUCA | 1.66 |
As above shown in the table, hsa-miR-106a raises in the cancerous tissue sample, therefore can be decided to be the hsa-miR-106a rise more than or equal to 1.58 with raising multiple (the expression amount ratio of promptly comparing with negative control).Hsa-miR-125b reduces in the cancerous tissue sample, therefore downward modulation multiple (the expression amount ratio of promptly comparing with negative control) can be less than or equal to 0.6 and be decided to be the hsa-miR-125b downward modulation.The rest may be inferred for other microRNA.
Embodiment 4 preparation miRNA chips
The miRNA sequence (SEQ ID NO:1-11) that table 1 is provided converts complementary sequence to, adds the catenation sequence of 10-20nt at the sequence two ends according to features such as the GC that produces sequence compare; Core sequence difference, catenation sequence are also different.Catenation sequence can be produced at random by program, and the probe that catenation sequence and core sequence form meets the following conditions:
1) in the probe sequence, can not be with the quantity of a kind of Nucleotide (A, C, G, T) above 50% of sequence sum;
2) quantity of any successive A, T or C, G can not surpass 25% of sequence sum;
3) G, C content account for the 40%-60% of sequence sum;
4) probe sequence can not be from hybridization, and promptly complementary segmental length can not surpass 30% of probe length in the probe sequence.
For making stable being combined on the slide of synthetic probe, adopt conventional method to carry out glycosyl modified at 5 ' end of synthetic back probe.
The point system of chip: earlier the surface of slide is carried out alkylation and modify, to improve binding ability.Adopt conventional chip point sample method to carry out point sample, in order to detect the repeatability of cross experiment, each probe is 3-6 hybridization point of point on slide.
The preparation of embodiment 5 test kits
The Chip Packaging of preparation among the embodiment 4 is good, place a box with working instructions, constitute test kit.
The detection of embodiment 6 chips
To the sample (comprising 12 routine cancerous tissue samples and the other sample of 12 routine cancers) that obtains a plurality of primary hepatocarcinoma from hospital, press preparation of embodiment 1 and 2 methods and mark microRNA, with the chip of preparation among the embodiment 4, detect then with double-blind method.According to the existence of 11 kinds of microRNA marks shown in the table 1 whether and go up and be in harmonious proportion the downward modulation situation and come judgement sample.Wherein, positive control and negative control are respectively known cancerous tissue sample and the other sample of known cancer.
The result shows that by the sorter that 11 species specific microRNA constitute, its exactness is 100% (identical with the types of organization that hospital is indicated), and the sample that can distinguish primary hepatocarcinoma very effectively belongs to cancerous tissue or cancer beside organism.The expression pattern of 11 kinds of microRNA of 12 routine cancerous tissue samples all meets the situation of table 1.In contrast, the expression pattern of the other sample of 12 routine cancers is just in time opposite fully, does not all meet the situation of table 1.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
<110〉Shanghai Inst. of Tumor
<120〉11 microRNA marks that are used to distinguish primary hepatocarcinoma cancerous tissue and cancer beside organism
<130>092877
<160>11
<170>PatentIn?version?3.4
<210>1
<211>23
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>1
aaaagugcuu?acagugcagg?uag 23
<210>2
<211>23
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>2
agcagcauug?uacagggcua?uga 23
<210>3
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>3
ugagguagua?guuugugcug?uu 22
<210>4
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>4
ucccugagac?ccuaacuugu?ga 22
<210>5
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>5
uagcaccauu?ugaaaucggu?ua 22
<210>6
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>6
ucagugcacu?acagaacuuu?gu 22
<210>7
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>7
aacccguaga?uccgaucuug?ug 22
<210>8
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>8
aaaccguuac?cauuacugag?uu 22
<210>9
<211>22
<212>RNA
<213〉homo sapiens (IIomo sapiens)
<400>9
cgccgccccg?caccugcugc?ug 22
<210>10
<211>22
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>10
cagugcaaug?uuaaaagggc?au 22
<210>11
<211>23
<212>RNA
<213〉homo sapiens (Homo sapiens)
<400>11
agcagcauug?uacagggcua?uca 23
Claims (10)
1. an isolating miRNA is characterized in that, described miRNA is selected from:
(i) miRNA of sequence shown in SEQ ID NO:n, wherein n is the positive integer that is selected from 1-11; Or
(ii) with sequence complementary miRNA shown in the SEQ ID NO:n.
2. a miRNA collection is characterized in that, described collection is made of 11 kinds of miRNA of sequence shown in SEQ ID NO:1-11.
3. an isolating or artificial constructed precursor miRNA is characterized in that, the described miRNA of claim 1 can be sheared and be expressed as to described precursor miRNA in people's cell.
4. isolating polynucleotide is characterized in that, described polynucleotide can be become precursor miRNA by people's cell transcription, and described precursor miRNA can be sheared and be expressed as the described miRNA of claim 1 in people's cell.
5. polynucleotide as claimed in claim 4 is characterized in that, described polynucleotide have the structure shown in the formula I:
Seq
Forward-X-Seq
OppositelyFormula I,
Among the formula I,
Seq
ForwardFor in people's cell, being expressed as the nucleotide sequence of described miRNA,
Seq
OppositelyFor with Seq
ForwardBasically complementary or complete complementary nucleotide sequence;
X is for being positioned at Seq
ForwardAnd Seq
OppositelyBetween intervening sequence, and described intervening sequence and Seq
ForwardAnd Seq
OppositelyIt is not complementary,
And the structure shown in the formula I forms the secondary structure shown in the formula II after changing people's cell over to:
Among the formula II, Seq
Forward, Seq
OppositelyWith the definition of X such as above-mentioned,
|| be illustrated in Seq
ForwardAnd Seq
OppositelyBetween the base complementrity pair relationhip that forms.
6. a carrier is characterized in that, it contains the described miRNA of claim 1, or the described polynucleotide of claim 4.
7. the purposes of the described miRNA of claim 1 is characterized in that, is used to prepare chip or the test kit of distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.
8. a miRNA chip is characterized in that, described miRNA chip comprises:
Solid phase carrier; And
Be fixed on the oligonucleotide probe on the described solid phase carrier in order, described oligonucleotide probe is specifically corresponding to the part or all of sequence shown in the SEQ ID NO:1-11.
9. the purposes of miRNA chip as claimed in claim 8 is characterized in that, is used to prepare the test kit of distinguishing primary hepatocarcinoma cancerous tissue and cancer beside organism.
10. a test kit is characterized in that, contains the described miRNA chip of claim 8 in the described test kit.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101948123A CN102002491A (en) | 2009-08-31 | 2009-08-31 | 11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101948123A CN102002491A (en) | 2009-08-31 | 2009-08-31 | 11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues |
Publications (1)
Publication Number | Publication Date |
---|---|
CN102002491A true CN102002491A (en) | 2011-04-06 |
Family
ID=43810194
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009101948123A Pending CN102002491A (en) | 2009-08-31 | 2009-08-31 | 11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102002491A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103060348A (en) * | 2011-10-24 | 2013-04-24 | 上海市肿瘤研究所 | Genetic markers for detecting recurrence potential of primary liver cancer |
CN103060312A (en) * | 2011-10-24 | 2013-04-24 | 上海市肿瘤研究所 | Gene marker of predicting primary hepatic carcinoma metastatic potential |
-
2009
- 2009-08-31 CN CN2009101948123A patent/CN102002491A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103060348A (en) * | 2011-10-24 | 2013-04-24 | 上海市肿瘤研究所 | Genetic markers for detecting recurrence potential of primary liver cancer |
CN103060312A (en) * | 2011-10-24 | 2013-04-24 | 上海市肿瘤研究所 | Gene marker of predicting primary hepatic carcinoma metastatic potential |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102002490A (en) | 9 microRNA markers for predicting whether primary liver cancer relapses | |
CN102369294B (en) | Non-small cell lung cancer detection marker, detection method thereof, related reagent kit and biochip | |
CN101988060A (en) | Marker for detecting colon and rectum cancer as well as detection method, kit and biological chip thereof | |
CN102292456A (en) | MicroRNA-based methods and compositions for the diagnosis and treatment of ovarian cancer | |
CN103146688A (en) | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis | |
Cui et al. | LncRNA FAM230B promotes gastric cancer growth and metastasis by regulating the miR-27a-5p/TOP2A axis | |
CN101988061A (en) | Breast cancer detecting marker as well as detecting method, kit and biological chip thereof | |
Cai et al. | MicroRNA-200 is commonly repressed in conjunctival MALT lymphoma, and targets cyclin E2 | |
CN104975019B (en) | Application of the finger-print of tiny RNA composition in human ovarian cancer diagnosing and treating | |
CN110628913B (en) | lncRNA marker related to breast cancer | |
CN102851283B (en) | MicroRNA markers for discriminating metastatic and non-metastatic squamous cell lung carcinoma | |
CN110229899B (en) | Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer | |
CN111187840A (en) | Biomarker for early breast cancer diagnosis | |
CN101555519A (en) | Gene chip and application thereof | |
CN110139936A (en) | The biomarker of carcinoma of mouth, pharynx cancer and laryngocarcinoma | |
CN102851282B (en) | MicroRNA markers for discriminating constitutional lung cancer tissue and paracancerous tissue | |
CN101988062A (en) | cervical cancer detection markers and detection method, kit and biochip thereof | |
CN102002491A (en) | 11 microRNA markers for distinguishing primary liver cancer tissues and para-cancer tissues | |
CN102002492A (en) | 11 microRNA markers for predicting whether primary liver cancer metastasizes | |
CN110628914A (en) | LncRNA marker related to breast cancer, detection primer and application thereof | |
CN105985955A (en) | Application of fingerprint atlas composed of microRNAs in gastric cancer | |
US20150329911A1 (en) | Nucleic acid biomarkers for prostate cancer | |
CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
CN108728439A (en) | The finger-print of tiny RNA composition and its application in Diagnosis of Bladder | |
CN109628594B (en) | One kind long-chain non-coding RNA relevant to liver cancer and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110406 |