CN101985651B

CN101985651B - New molecular marker for diagnosis and prediction of gastrointestinal tumor

Info

Publication number: CN101985651B
Application number: CN 201010160684
Authority: CN
Inventors: 王弢; 陈菲; 渠香云
Original assignee: SUZHOU MICRO DIAG BIOMEDICINE CO Ltd
Current assignee: Jiangsu Weizhen Biomedical Technology Co., Ltd
Priority date: 2010-04-30
Filing date: 2010-04-30
Publication date: 2013-09-25
Anticipated expiration: 2030-04-30
Also published as: CN101985651A

Abstract

The invention discloses a detection method for predicting and diagnosing gastrointestinal tumor as well as a kit and a gene chip thereof. The method comprises the following steps: (1) obtaining a sample to be detected; and (2) detecting whether the following coding mRNA gene is overexpressed in the sample, wherein the gene is a CST1 gene shown in SEQ ID No:39, or a primer of one of mRNA of specificity recognition CST1 gene, CST1 cutter shown in SEQ ID No:43, SEQ ID No:44, cDNA of CST1 gene and cDNA of CST1 cutter, or/and a probe recognized gene, or a gene identified by using an amplicon corresponding to at least one CST1 primer. The method can be applied to diagnosis of gastrointestinal caner, dynamic monitoring and prognosis judgment and has the advantages that a large number of verification samples can be obtained, the result is accurate and reliable result, the sensitivity is high and the like.

Description

Recruit's mark of gastrointestinal tumor diagnosis and indication

Technical field

The invention belongs to biotechnology and medical field, more specifically, the present invention relates to a kind of gastric and intestinal cancer mark and uses thereof, reagent or test kit and using method thereof that gastrointestinal cancer diagnosis, detection of dynamic and prognosis are judged.

Background technology

The sickness rate of malignant tumour continues to rise in recent years, wherein more than 60% is digestive system tumor, and is the most common with cancer of the stomach, large bowel cancer.In the world, the incidence gastric cancer rate is only second to lung cancer and accounts for second in male sex's malignant tumour, occupies the 4th in women's malignant tumour.And occupying the malignant tumour first place in China's mortality ratio, the annual mortality ratio is in per 100,000 populations 25.53 people to be arranged.Large bowel cancer comprises colorectal carcinoma and the rectum cancer, is number and death toll one of the fastest tumour that rises in world's most countries and area of falling ill in recent decades.In recent years epidemiologic data shows that large bowel cancer has risen to the 3rd the modal cancer in the whole world, and the whole world had 700,000 people to suffer from large bowel cancer in 2000, wherein 500,000 people so and dead.

The early discovery gastroenteric tumor, early treatment is the key that improves the gastrointestinal cancer curative effect.Neoplasm staging is more high, shows that then discovery is more late.Then be respectively 93%, 84%, 44% and 8% according to foreign data report I, II, III, 5 years survival rates of IV phase rectal cancer patient.But the clinical symptom of gastrointestinal cancer usually is not true to type, and is often thought oneself as gastritis that we often say, stomach ulcer, maldigestion, constipation etc. by us, thus delay diagnosis and treatment.

Present Chinese clinical diagnosis mostly is symptomatic screening, abdominal discomfort, secret anguish, pantothenic acid, belch namely occur or becomes thin, carries out after the symptom such as melena inspection such as scope, and the cancer that finally the detects overwhelming majority is the progressive stage cancer.Existing diagnostic method such as the normally used mark of serology immunodetection such as CEA, CA series antigen, low, the poor specificity of ubiquity sensitivity is especially all very low to early cancer recall rate, validity.Though it is cheap easy that cytology commonly used detects, sensitivity is on the low side equally, and iconography detects only to there being the tumour that cancerates than big occupy-place that very high diagnosis is arranged.China is developing populous nation, and economic condition is less-developed, carries out based on the generaI investigation screening for the entire people of image difficult.In addition, belonged to middle and advanced stage during most gastrointestinal cancer patient clinical definite, how the to undergo surgery monitoring of back patient's prognosis and the effectively selection of methods for the treatment of are the effective ways that improve prognosis.

Development has the gi tract diagnostic products of highly sensitive, high specificity, is raising gastric and intestinal cancer early detective rate, improves one of key of patient's prognosis.In the tumor development process, develop in close relations as the natural arrestin Cystatin gene family of kethepsin and the generation of tumour.In tissue and body fluid, Cystatin family protein reversibility ground prevents the excessively active of kethepsin in conjunction with L-Cysteine HCL Anhydrous.Cystatin C is the strongest arrestin of cathepsin B, but in ovarian cancer and incidence cancer, the expression of cystatin C has the rising of different levels.And in nonsmall-cell lung cancer, the expression level of stefin A (cystatin family member) increases to some extent; In meningioma, stefinB has obvious reduction in the mRNA level; The expression level of cystatin F (also being called leukocystatin or CMAP) in kinds of tumors has remarkable increase.Result of study shows, the expression level of several family members in different tumours of cystatin rises to some extent, be likely owing in the tumor development process, need the participation of kethepsin, induce its expression amount to increase earlier, that activates body itself again stress mechanism, causes the expression amount of cystatin to rise to suppress the protease activity of containing.But the expression amount of cystatin not with the positively related relation of developing into of tumour, because in glioma, the low expression of cystatin C means the late period of disease, and patient's lifetime is shorter, and be easy to recurrence, this conclusion has all obtained checking on mRNA and protein level.

The present invention confirms cystatin family member CST1 and shears sub expression level and gastroenteric tumor in close relations.CST1 has another name called cystatin SN, is cystatin (cystatin) family member, contains 141 amino acid, 2 disulfide linkage, and 16.4Kda is distributed in multiple body fluid and the secretory product, as tears, saliva, serum, blood plasma etc.

Summary of the invention

The object of the invention is to provide a kind of detection method that indicates and provide diagnosis gastrointestinal tumor information, solved the difficult problem that gastrointestinal tumor in the prior art is difficult to early detection.

In order to solve these problems of the prior art, technical scheme provided by the invention is:

A kind of detection method that gastrointestinal tumor susceptibility information is provided is characterized in that said method comprising the steps of:

(1) obtains testing sample;

(2) measure the expression level of gene in sample that is selected from following coding mRNA or cDNA and whether cross expression, described gene is the CST1 gene with SEQ ID No:39; Or mRNA, the CST1 of the specific recognition CST1 gene cDNA, the CST1 that shear son, CST1 gene shears the wherein a kind of primer of cDNA of son or/and the gene that probe is identified; Or shear the amplicon institute genes identified of sub-primer correspondence by at least a CST1.Wherein CST1mRNA has and shears connecting method in 2, and first kind (splice1) (SEQ ID No:43) comprises CST1 exons 1 ((SEQ ID No:40), exon 2 (SEQ ID No:41), exon 3 (SEQ ID No:42); And second kind of cut mode (splice2) (SEQ ID No:44) only comprises CST1 exons 1 ((SEQ ID No:40) and exon 2 (SEQ ID No:41); When surpassing predetermined threshold, then indicates gene expression dose gastrointestinal tumor susceptible or formation.

Preferably, described primer is to have one of at least primer of sequence of SEQ ID No:1～2 or SEQ ID No:4～21; Described probe is the probe with SEQ ID No:3 sequence.

Preferably, first amplicon of shearing sub-primer correspondence of described CST1 has the sequence of SEQ ID No:45.

Preferably, in the described method Auele Specific Primer be have primer that the sequence shown in SEQ ID No:1 and the SEQ ID No:2 forms to and probe with sequence shown in the SEQ ID No:3.

Preferably, detect external RNA amplification technique or the polymerase chain reaction method of the method employing nucleic acid sequence based amplification method of expression level in the described method steps (2).

Preferably, the method that detects expression level in the described method steps (2) adopts the real-time quantitative PCR method, and described real-time quantitative PCR method is selected from based on the PCR in real time of non-specific dinucleotide dyestuff or based on the PCR in real time of special fluorescent probe.

Another object of the present invention is to provide a kind of test kit that detects gastrointestinal function, it is characterized in that described test kit comprises be used to primer or the probe of the CST1 gene of catching SEQ ID No:39 and/or CST1 gene-splicing (SEQ ID No:43,44) and make CST1 and/or it is sheared son and catches primer or the visual reaction reagent of probe mixture.

Preferably, described reaction reagent is by being selected from agarose gel electrophoresis, enzyme connection gel method, electrochemiluminescence technology, hybridization in situ technique, fluorescence detection and making CST1 and/or its shear son and catching primer or probe mixture is visual.

Preferably, described test kit also comprises as positive stomach cancer cell line with reference to product, as negative normal gastric cells strain, nucleic acid extracting reagent, reverse transcription reagent, pcr reagent with reference to product.

The present invention finds that first this gene unconventionality expression and gastrointestinal cancer have close dependency, and provide based on specific molecular Marker's according to this dependency, be used for the diagnosis gastrointestinal illness, the monitoring gastrointestinal illness, whether monitoring gastrointestinal illness result for the treatment of and monitoring and evaluation gastrointestinal cancer the assay method of transfer and relapse, test kit and using method thereof, thereby for gastric and intestinal cancer provides effective molecular diagnosis mark or estimates the molecule marker whether gastric and intestinal cancer shift or the molecule marker of judging gastric and intestinal cancer patient prognosis, these can be used for the gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis are judged.

According to a first aspect of the invention, provide a kind of purposes of CST1 gene, for the preparation of reagent or the test kit of gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis judgement.

Detection method comprises that detecting CST1 mRNA and/or CST1 shears son and cross and express or detect CST1 cDNA and/or CST1 and shear sub-cDNA and cross expression.

Preferably, detection method comprises that using at least one pair of can specificity to shear the primer of son and/or one in conjunction with CST1mRNA and/or CST1 shears the complementary oligonucleotide of son with portion C ST1mRNA and/or CST1 at least.

Preferably, detection method comprises that using at least one pair of can specificity to shear the primer of sub-cDNA and/or one in conjunction with CST1 cDNA and/or CST1 shears the oligonucleotide of sub-cDNA complementation with portion C ST1 cDNA and/or CST1 at least.

Preferably, detection method comprises nucleic acid sequence based amplification method (Nucleic Acid based Amplificatin, NASBA) external RNA amplification technique, the amplification of transcriptive intermediate (Transcription-median amplification, TMA), ligase chain reaction (Ligase chain reaction, LCR), thermophilic strand replacement reaction (thermophilicstrand displacement amplification, tSDA), polymerase chain reaction (polymerase chain reaction, PCR), that best is real-time quantitative PCR (quantitative real-time PCR).

Preferably, real-time quantitative PCR comprise PCR in real time based on non-specific dinucleotide dyestuff such as SYBR Green, based on the PCR in real time of special fluorescent probe.

Preferably, detection method further comprises and makes CST1 and/or its shear son and the visual reaction reagent of capture agent mixture thereof.

The invention provides a kind of method of the experimenter's of detection sample gastrointestinal function, this method comprises CST1 mRNA and/or the sub level of CST1 shearing in the described sample of detecting.

Preferably, described detection further comprises stomach, the intestinal disease of diagnosing described experimenter, monitors described experimenter's stomach, intestinal disease, judges described experimenter's stomach, the prognosis of intestinal disease, monitoring gives described experimenter's stomach, the effect of intestinal disease treatment, described experimenter's cancer by stages.

Preferably, described experimenter comprises the uncomfortable hospitalier of stomach, intestines, and chronic gastritis, enteritis patient have familial stomach, enteron aisle cancer person, and described detection further comprises the experimenter is carried out examination to detect stomach, enteron aisle cancer.Preferably, described experimenter is stomach, enteron aisle cancer patients, and described detection further comprises stomach, the intestinal cancer disease of monitoring described experimenter, judges described experimenter's prognosis, and monitoring gives described experimenter's result for the treatment of.

Preferably, described detection method further comprises CST1 mRNA and/or the sub level of CST1 shearing in the quantitative described sample.

Preferably, detection method comprises that detection by quantitative CST1 cDNA and/or CST1 shear sub-cDNA and cross expression levels.

Testing sample described in the described method comprises operation tissue, microscopy tissue, lymph node tissue, marrow, serum sample, plasma sample, urine sample, blood sample, whole blood sample, blood fraction sample.Preferred detection method, comprise nucleic acid sequence based amplification method (Nucleic Acid based Amplificatin, NASBA) external RNA amplification technique, the amplification of transcriptive intermediate (Transcription-median amplification, TMA), ligase chain reaction (Ligase chain reaction, LCR), thermophilic strand replacement reaction (thermophilic strand displacement amplification, tSDA), polymerase chain reaction (polymerase chain reaction, PCR), that best is real-time quantitative PCR (quantitativereal-time PCR).

Real-time quantitative PCR comprises PCR in real time based on non-specific dinucleotide dyestuff such as SYBR Green, based on the PCR in real time of special fluorescent probe.Also may further include and make CST1 and/or its shear son and the visual reaction reagent of capture agent mixture thereof.

A kind of reagent or material for gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis judgement, described reagent is selected from down group: the Auele Specific Primer of CST1 gene or transcript; And/or the specific recognition probe of CST1 gene or transcript or the surperficial chip that described probe is fixedly arranged.

In another preference, described reagent is primer, and described primer is the primer at the CST1 exon.In the preferred preference, described primer is that first shears the Auele Specific Primer of son (SEQ ID No:43) at the CST1 gene; Or described primer is the Auele Specific Primer at second shearing of CST1 (SEQ ID No:44); Or described primer is the Auele Specific Primer (being that amplified production is crossed over exons 1 and exon 2) of exons 1 (Exon1) (SEQ ID No:40) at the CST1 gene and exon 2 (Exon2) (SEQ ID No:41); Or described primer is at the exons 1 (Exon1) of CST1 gene and the Auele Specific Primer of exon 3 (Exon3) (SEQ ID No:42) (being that amplified production is crossed over exons 1 and exon 3); Or described primer is at the exon 2 (Exon2) of CST1 gene and the Auele Specific Primer of exon 3 (Exon3) (being that amplified production is crossed over exon 2 and exon 3).

Preferred primer is that first shears the Auele Specific Primer of the exons 1 of son at the CST1 gene.In another preference, described Auele Specific Primer be primer with the sequence shown in SEQ ID No:1 and the SEQID No:2 to and the probe of SEQ ID No:3.

A kind of for indication or detect the gene chip of gastrointestinal tumor, it is characterized in that described gene chip comprises that first shears primer or the probe of son corresponding to the CST1 gene of SEQ ID No:39 or corresponding to the CST1 gene of SEQ ID No:43 be used to catching.

According to a first aspect of the invention, provide the method that detects experimenter's sample, first shears the level of sub-mRNA to comprise in the test sample CST1.According to the feature in first aspect preferred embodiment of the present invention, detection comprises the gastrointestinal illness of diagnosing the experimenter, monitoring experimenter's gastrointestinal illness, monitoring experimenter gastrointestinal illness result for the treatment of, in experimenter's cancer staging or the sample CST1 first shear the level of sub-mRNA.

The feature further according to the present invention, the experimenter is the uncomfortable hospitalier of stomach and intestine portion, and detects and comprise the experimenter is carried out examination to detect gastric and intestinal cancer.The feature further according to the present invention, the experimenter is chronic gastritis, enteritis patient, and detects and comprise the experimenter is carried out examination to detect gastric and intestinal cancer.The feature further according to the present invention, the experimenter has the familial gastric and intestinal cancer, and detects and comprise the experimenter is carried out examination to detect gastric and intestinal cancer.According to preferred version as described below, sample comprises gastro-intestinal surgery, stomach and intestine mirror, lymphoglandula, marrow, serum, blood plasma, blood sample, urine sample.According to the feature of preferred embodiment, blood sample can comprise whole blood sample or blood fraction sample.

The test kit that additional aspects of the present invention provide gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis to judge contains in the described test kit: at least one pair of primer and probe of CST1 gene.According to preferred version as described below, the primer in the test kit is to being SEQ ID No:1 and SEQ ID No:2, and probe is SEQ ID No:3.

In another preference, also contain in the described test kit: as positive and negative with reference to product, wherein preferred version is stomach cancer cell line (NCI-N87), people's gastric epithelial cell strain (GES-1) respectively for stomach cancer cell line and normal gastric cells strain; The CST1 recombinant plasmid is as standard substance.

In another preference, also contain in the described test kit: colon-cancer cell strain and the colon-cancer cell strain of not expressing CST1 respectively as positive and negative with reference to product, wherein preferred version is colon-cancer cell strain (SW480), colon-cancer cell strain (HCT116); The CST1 recombinant plasmid is as standard substance.

In another preference, also contain in the described test kit: the specification sheets of nucleic acid extracting reagent, reverse transcription reagent, polymerase chain reaction (PCR) reagent, description diagnosing gastric cancer, dynamic monitoring and prognosis determination methods.

According to the further feature of preferred version of the present invention, detection kit can be used for actual place, includes but not limited to hospital, clinic and private residence.

According to another side of the present invention, whether be provided for according to experimenter's sample evaluation experimenter is gastric and intestinal cancer, or the gastric and intestinal cancer assay method of transfer and relapse whether, comprise at least one pair of primer and a probe at the CST1 gene, take from the total RNA in the sample, whether reverse transcription reagent, polymerase chain reaction (PCR) reagent, how and whether can assess thus is gastric and intestinal cancer, result for the treatment of transfer and relapse.

Preferred detection kit is made up of following components: CST1 and/or its are sheared the ravin of son; A kind of CST1 and/or its of making sheared son and capture agent mixture visualization method thereof; Reaction reagent and working instructions.The ravin that wherein said CST1 and/or its are sheared son comprises that at least one pair of can specificity shears the primer of son and/or one in conjunction with CST1mRNA and/or CST1 and shear the complementary oligonucleotide of son with portion C ST1mRNA and/or CST1 at least.The ravin that wherein said CST1 and/or its are sheared son can comprise that also at least one pair of can specificity shears the primer of sub-cDNA and/or one in conjunction with CST1 cDNA and/or CST1 and shear the oligonucleotide of sub-cDNA complementation with portion C ST1 cDNA and/or CST1 at least.

Described CST1 and/or its of making sheared son and capture agent mixture visualization method thereof, comprise agarose gel electrophoresis, enzyme connection gel method (enzyme-linked gel assay, ELGA), electrochemiluminescence technology (electroluminescence, ECL), hybridization in situ technique (in situ hybridization, ISH), fluorescence detection.Can detect according to following steps: obtain sample from the experimenter; CST1mRNA and/or its are sheared sub-level in the test sample; The CST1 level compares in detected result and the check sample, thereby judges experimenter's gastrointestinal condition.Described sample comprises operation tissue, microscopy tissue, lymph node tissue, marrow, serum sample, plasma sample, urine sample, blood sample, whole blood sample, blood fraction sample.Control sample comprises the sample of the different steps of normal people's sample, patient treatment.Experimenter's gastrointestinal condition can be divided into normally, scorching, cancer, improves, does not improve, and the treatment measure is effective, invalid.

Detection kit of the present invention can be with actual place such as hospital, clinic, private residence.

The inventor is through deep research, and first is sheared sublist to reach the change of level closely related with gastric and intestinal cancer or the transfer of gastric and intestinal cancer tissue to find CST1 first.Concrete, the rise of CST1 genetic expression and gastric and intestinal cancer or gastric and intestinal cancer tissue shift closely related.Therefore can diagnose gastric and intestinal cancer or gastric and intestinal cancer tissue to shift by detecting CST1 genetic expression (particularly CST1 mRNA expresses).

The CST1 gene is the cystatin family member, and it contains two each and every one shears son, three exons.The inventor studies by the tissue that a large amount of cancer of the stomach, intestinal cancer or cancer of the stomach, intestinal cancer tissue is shifted the patient, and compare with gastritis, enteritis patient's tissue or normal control etc., thereby strong confirmation the dependency that shifts of CST1 gene and cancer of the stomach, intestinal cancer or cancer of the stomach, intestinal cancer tissue.In an embodiment of the present invention, at first, the inventor has compared the expression of CST1 mRNA in the human body different tissues, finds outside the desalivation gland, and therefore all low expression of CST1 are used for detecting under the pathological conditions very favourable for CST1 in the human normal tissue.Then, the CST1 that the inventor has more reported, 2,4; CST1; CST2; The expression amount difference of CST4 in cancer of the stomach, intestinal cancer and corresponding cancer side, find CST1 cancer of the stomach and cancer is other and intestinal cancer and cancer side in expression amount difference maximum, secondly be CST4, all be better than the CST1 that reports, 2,4.Then, the inventor has compared two kinds of cut modes of CST1 (splice1, splice2) differential expression in cancer of the stomach and the other operation tissue of cancer respectively, finds that the differential expression degree of first kind of cut mode (splice1) (SEQ ID No:43) in cancer and cancer beside organism is better than cut mode in second (splice2) (SEQ ID No:44); Then, the inventor has compared the other operation of cancer of the stomach and cancer tissue, cancer of the stomach and inflammation/normal people's gastroscope tissue, Metastasis of Gastric Cancer positive lymph nodes and negative lymphoglandula, cancer of the stomach and inflammation/human normal plasma cell-free RNA CST1 respectively, and first shears sub-mRNA differential expression, find that first expression median of shearing sub-mRNA of CST1 is higher 57.5 times than cancer beside organism in the cancer of the stomach, the gastroscope sample is high 24 times, it is high 11.469 times to shift sample, and plasma C ell-freeRNA is high 37.18 times.The inventor has also compared the other operation of intestinal cancer and cancer tissue, intestinal cancer and inflammation/normal people's intestines mirror tissue, intestinal cancer transfer positive lymph nodes and negative lymphoglandula, intestinal cancer and inflammation/human normal plasma cell-free RNA CST1 respectively, and first shears sub-mRNA differential expression, find that first expression median of shearing sub-mRNA of CST1 is higher 48.95 times than cancer beside organism in the intestinal cancer, high about 23 times of intestines mirror sample, it is high 11.469 times to shift sample, high about 20 times of plasma C ell-free RNA.Therefore, first shears son as the mark of diagnosis with CST1, highly sensitive (can be higher than 95%) and specificity good (can reach 100%).

Therefore, based on the inventor's new discovery, can utilize the CST1 gene: (1) carries out differential diagnosis and/or the susceptibility analysis of cancer of the stomach or stomach organization transfer; (2) the relevant crowd's of assessment cancer of the stomach or stomach organization shift medicine, curative effect of medication, prognosis, and select suitable methods for the treatment of; (3) the relevant crowd's cancer of the stomach of early stage assessment or stomach organization shift ill risk, the early detection early prevention; (4) carry out differential diagnosis and/or the susceptibility analysis that intestinal cancer or intestinal cancer tissue shift; (5) the relevant crowd's of assessment intestinal cancer or intestinal cancer tissue shift medicine, curative effect of medication, prognosis, and select suitable methods for the treatment of; (6) the relevant crowd's intestinal cancer of early stage assessment or intestinal cancer tissue shift ill risk, early detection early prevention.

The present invention also provides the reagent for detection of gastric and intestinal cancer or the transfer of gastric and intestinal cancer tissue.Described reagent can be: the specificity of CST1 gene or transcript (not having sequence to repeat or complementation with human other gene) primer; Or the specificity of CST1 gene or transcript (human other gene of nonrecognition) probe; Or fixedly there is the chip of described probe on the surface.

As preferred version of the present invention, described reagent is primer and probe, and described primer is at the primer of CST1 gene extron and probe, and more preferably first shears primer and the probe of sub-exon one at CST1; Or at CST1 first shears sub-exon two, three primer and probe.

As preferred mode of the present invention, described primer and probe are first primer and probe of shearing sub-exon one at CST1, this primer and probe can only be identified first shearing of CST1, and shearing sub and human other gene with second of CST1 all can complementary combination.Described Auele Specific Primer is to have SEQ ID No:1 and SEQ ID No:2, and probe is SEQ ID No:3.Described primer and probe specificity are good, and expanding effect is good.

The present invention also provides a kind of test kit that detects gastric and intestinal cancer or the transfer of gastric and intestinal cancer tissue, and described test kit has better specificity and selectivity than existing gastric and intestinal cancer detection kit.Contain in the described test kit: for detection of the reagent of gastric and intestinal cancer or the transfer of gastric and intestinal cancer tissue.Described reagent can be: the Auele Specific Primer of CST1 gene or transcript; Or the specific probe of CST1 gene or transcript; Or comprise primer and probe simultaneously.Usually, described reagent is present in the proper container.Can use thinner such as deionized water that every kind of described primer and probe are adjusted to the concentration of at least a requirement, be sub-packed in the container.

For the ease of analyzing and comparing, as optimal way of the present invention, also contain in the described test kit: gastrointestinal cancer cell strain and the cell strain of not expressing CST1 respectively as positive and negative with reference to product and the used standard substance of preparation standard curve.

In addition, also can comprise in the described test kit being used for the reagent of PCR for the reagent that extracts nucleic acid, be used for the reagent of dyeing or colour developing etc.For example, these reagent include but not limited to: extract, amplification liquid, hybridization solution, colour developing liquid, washing lotion etc.

In addition, also can comprise in the described test kit and describe specification sheets that gastric and intestinal cancer diagnosis, detection of dynamic and prognosis judge and/or chip image analysis software etc.

Test kit of the present invention can comprise and is suitable for the practicality multiple different reagent of (as at different detection methods), be not limited to cited reagent at present, all comprise within the scope of the present invention so long as carry out the product that gastric and intestinal cancer diagnosis, detection of dynamic and prognosis judge based on the detection of CST1 gene or transcript.

Described reagent also can be that specific recognition probe or the surface of CST1 gene or transcript fixedly has described chip.Probe or chip production method are the ordinary skill in the art, the preparation method for example can reference: Wang Shenwu chief editor's " gene diagnosis technology-on-radiation operational manual "; J.L.erisi, V.R.iyer, P.O.BROWN.Exploring the metabolicand genetic control of gene expression on a genomic scale.Science, 1997; 278:680.

Described specific recognition probe at CST1 gene or transcript includes but not limited to TaqMan hydrolysis probes, MGB probe, hybridization probe, molecular beacon etc.

Detect the method Real-time PCR method preferably of the expression of CST1 gene in the subject group tissue samples or transcript.

Preferred version of the present invention is the gastrointestinal illness that the Real-time PCR method detects the diagnosis experimenter, monitoring experimenter's gastrointestinal illness, monitoring experimenter gastrointestinal illness result for the treatment of, CST1mRNA level in experimenter's cancer staging or the sample.

Test kit of the present invention at the experimenter can be the gastrointestinal upset hospitalier, and detect and to comprise the experimenter is carried out examination to detect gastric and intestinal cancer.

Test kit of the present invention at the experimenter can be chronic gastritis, enteritis patient, and detect and to comprise the experimenter is carried out examination to detect gastric and intestinal cancer.

Test kit of the present invention at the experimenter can be for familial gastric and intestinal cancer person be arranged, and detect and comprise the experimenter is carried out examination to detect gastric and intestinal cancer.

A kind of detection method is: obtain tissue sample, from described tissue sample isolation of RNA; Use CST1 Auele Specific Primer and the probe cDNA copy that from the RNA sample, increase, quantize the cDNA copy of amplification, use the amplification cDNA that quantizes to copy to assess gastrointestinal illness and make progress or result for the treatment of.

The method that detects CST1 mRNA expression is a variety of in addition,, include but not limited to nucleic acid sequence based amplification method ((Nucleic Acid based Amplificatin, external RNA amplification technique NASBA).Certainly, RNA amplification in vitro technology is not limited to NASBA, and the RNA amplification method that other is known and method at once and test kit also are available.Nonrestrictive example has polymerase chain reaction (polymerase chain reaction, PCR), amplified production is detected in homogeneous phase with fluorescent probe by the Beacon method, or product can be detected in solid phase by fluorescence or calorimetry (fluorescent orcalorimetric method).Detect and/or the quantifying target gene RNA according to present invention, multiple fluorescence, side heat or enzyme process can be employed.Best is, based on the real time pcr of special fluorescent probe, and the fluorescent probe special sequence that is complementary to CST1 of fluorescence that can be mark wherein, it also can be nonspecific dinucleotide dyestuff, include but not limited to SYBR Green, Eve Green, LC Green etc.

The acquisition of tissue sample is the ordinary skill in the art, preferably can select Noninvasive or have the invasive method of minimum level to obtain.Described tissue sample can be (but being not limited to): peripheral blood, serum, blood plasma, saliva, gastric juice, intestinal secretion thing, marrow, lymphoglandula, abdominal cavity scavenging solution, urine sample etc.

Can be used for actual place according to detection kit of the present invention, include but not limited to hospital clinic and private residence.In addition, but using multivariate statistical analysis also with the data of testing sample and contrasting data relatively, is conducive to make the judgement about gastric and intestinal cancer diagnosis, progress or result for the treatment of.

Major advantage of the present invention is:

1, finds first and confirms that CST1 gene and gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis judgement have closely related property, and confirm that first shearing of CST1 is having more superiority aspect gastric and intestinal cancer diagnosis, dynamic monitoring and the prognosis judgement, the sample size of checking is many, and the result is accurate.The proposition of this dependency is judged the new approach that provides for gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis.

2, developed reagent or the test kit that is suitable for gastric and intestinal cancer diagnosis, dynamic monitoring and prognosis judgement, detection sensitivity is good.

Description of drawings

Below in conjunction with drawings and Examples the present invention is further described:

Fig. 1 is CST1 and Pmd18-T recombinant plasmid collection of illustrative plates;

Fig. 2 is the expression (chip) of CST1 in human normal tissue, described tissue comprises tonsilla, posterior pituitary, Tiroidina, sialisterium, skeletal muscle, marrow, removes red corpuscle and hematoblastic peripheral blood, lung, stomach, liver, heart, kidney, suprarenal gland, intestines, colon, pancreas spleen, bladder, prostate gland, ovary, uterus, placenta, testis and colon-cancer cell strain SW480, Caco2, LOVO, HCT16, stomach cancer cell line NCI-N87, people's gastric epithelial cell strain GES-1;

The CST1 that Fig. 3 provides for the dye method real-time quantitative PCR, 2,4; CST1; CST2; The expression amount difference of CST4 in 20 pairs of cancer of the stomach and cancer beside organism;

ACTB CP value in 20 pairs of cancer of the stomach that Fig. 4 a provides for the dye method real-time quantitative PCR, the cancer beside organism;

Fig. 4 b is that the other CP value of first kind of cut mode of CST1 (splice1), second kind of cut mode (splice2) cancer in 20 pairs of cancer of the stomach, cancer beside organism compares with the median of the difference of the CP of corresponding cancerous tissue for the reflection of dye method real-time quantitative PCR;

First of the CST1 that Fig. 5 provides for Real-time PCR absolute quantitation method sheared the expression amount of son in 100 routine cancer of the stomach and cancer beside organism and distributed;

First of the CST1 that Fig. 6 provides for Real-time PCR absolute quantitation method sheared the expression amount of son in 36 routine cancer of the stomach and 29 routine gastritis gastroscope tables and distributed;

First of the CST1 that Fig. 7 provides for Real-time PCR absolute quantitation method sheared son 20 pieces of cancer of the stomach pathology positive lymph nodes, and expression amount distributes in 15 pieces of negative lymphoglandula of pathology;

Fig. 8 is the accuracy that detects the free stomach cancer cell of peripheral blood by Real-time PCR absolute quantitation method and the contrast that cytology detects;

Fig. 9 is the accuracy that detects the transfer of cancer of the stomach marrow by Real-time PCR absolute quantitation method and the contrast that cytology detects;

Figure 10 a is by Real-time PCR absolute quantitation method, first shearing amount of CST1 and scorching (30 example)/normal people's (30 example) difference among Patients with Gastric Cancer (50 example) the plasma C ell-free RNA;

The ROC curve of Figure 10 b for obtaining by Real-time PCR absolute quantitation method distinguished cancer of the stomach/inflammation/normal susceptibility and specificity;

Figure 11 is by ligase chain reaction (Ligase chain reaction, LCR) method, first shearing amount of CST1 and scorching (30 example)/normal people's (30 example) difference among Patients with Gastric Cancer (50 example) the plasma C ell-free RNA;

Figure 12 is for passing through thermophilic strand replacement reaction (thermophilic strand displacement amplification, tSDA) method, first shearing amount of CST1 and scorching (30 example)/normal people's (30 example) difference among Patients with Gastric Cancer (50 example) the plasma C ell-free RNA;

Figure 13 for by the amplification of nucleic acid sequences method (Nucleic Acid based Amplificatin, NASBA), 20 routine cancer of the stomach, 10 routine gastritis, in 10 routine normal people's urine samples CST1 first shear the differential expression of son amount.

Figure 14 is that (Transcription-mediated amplification, TMA), first shears the difference of sub-expression amount to detect the different CST1 by stages of 50 routine cancer of the stomach (pTNM by stages, I+II 30 examples, III+IV50 example) for amplification by transcriptive intermediate.

First of the CST1 that Figure 15 provides for Real-time PCR absolute quantitation method sheared the expression amount of son in 100 routine intestinal cancer and cancer beside organism and distributed.

First of the CST1 that Figure 16 provides for Real-time PCR absolute quantitation method sheared the expression amount of son in 36 routine intestinal cancer and 29 routine enteritis intestines mirror organization table and distributed.

First of the CST1 that Figure 17 provides for Real-time PCR absolute quantitation method sheared son 20 pieces of intestinal cancer pathology positive lymph nodes, and expression amount distributes in 15 pieces of negative lymphoglandula of pathology.

Figure 18 a is by Real-time PCR absolute quantitation method, first shearing amount of CST1 and scorching (30 example)/normal people's (30 example) difference among intestinal cancer patient's (50 example) plasma C ell-free RNA.

Figure 18 b has shown the ROC curve that obtains by Real-time PCR absolute quantitation method, distinguishes cancer of the stomach/inflammation/normal susceptibility and specificity.

Figure 19 for by the amplification of nucleic acid sequences method (Nucleic Acid based Amplificatin, NASBA), 30 routine intestinal cancer, 20 routine enteritis, in 20 routine normal people's urine samples CST1 first shear the differential expression of son amount.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.It is the experimental technique that indicates actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: the condition described in the lab guide (New York:Cold Spring HarborLaboratory Press, 1989), or the condition of advising according to manufacturers.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Material and method:

Used sample is all signed the informed consent postscript with patient and is obtained by hospital's regulation approach among the embodiment.

The pathogenic site sample that obtains under the scope and non-pathogenic site sample also can be that non-microscopy mode should be extracted RNA immediately or place liquid nitrogen or RNAlater (Ambion company product) preservation as the lymphoglandula equal samples that obtains in the cell of performing the operation or the gastrointestinal wall wipe method is obtained, the operation as a comparison.

Peripheral blood, marrow or urine specimen are at first passed through whizzer 4000rpm, and 4 ℃, centrifugal 20 minutes, get supernatant, 13000rpm, 4 ℃, centrifugal 10 minutes, cleer and peaceful precipitation in the separation was extracted RNA immediately or is placed-20 ℃ to-80 ℃ of preservations.

The Real-time PCR method of TaqMan hydrolysis probes: above-mentioned sample carries out with business-like nucleic acid method for extracting, a non-limitative example commonly used is phenol/chloroform method for extracting, as the Trizol method extracted total RNA of producing with Invitrogen company, and carrying out the RNA quality evalution, methods involving can be described with reference to book of reference such as " molecular biology experiments ".The reverse transcription process of mRNA adopts commercialization reverse transcription test kit and is undertaken by process specifications, and gained cDNA is diluted to the working concentration that needs in proportion.Used Auele Specific Primer is through optimization design, and first of CST1 sheared the upstream and downstream design of primers of son on exons 1.Preparation comprises CST1 first shears the recombinant plasmid of sub-amplicon, required plasmid be business-like Pegm-T (promega) (Fig. 1), the upstream and downstream design of primers is at exons 1, on 2.Employing is carried out CST1 based on the Real-time PCR method of TaqMan hydrolysis probes, and first shears the son amplification.

First shears primer and the probe of son at CST1, and optimum is as follows:

Upstream primer: TCTCACCCTCCTCTCCTG (SEQ ID No:1)

Downstream primer: TTATCCTATCCTCCTCCTTGG (SEQ ID No:2)

Probe: 5 '-FAM-CTCCAGCTTTGTGCTCTGCCTCT-TAMRA-3 ' (SEQ ID No:3) amplification length is 141bp.

First shears the primer of the recombinant plasmid of sub-amplicon to comprise CST1 at preparation, and optimum is as follows:

Upstream primer: GGGCTCCCTGCCTCGGGCTCTCAC (SEQ ID No:22)

Downstream primer: ACGGTCTGTTGCCTGGCTCTTAGT (SEQ ID No:23)

Experimental group, positive controls, negative control group increases with the recombinant plasmid standard substance.Make typical curve according to recombinant plasmid concentration gradient and the corresponding CP (cross point) in amplification back.Provide the copy number of experimental group, positive controls and negative control group according to this typical curve.

The dye method real-time quantitative PCR: sample process is with the Real-time PCR method of TaqMan hydrolysis probes, CST1,2,4 primers, upstream: AGTCCCAGCCCAACTTGGA (SEQ ID No:24) downstream: GGGAACTTCGTAGATCTGGAAAGA (SEQ ID No:25); Shear the upstream and downstream primer of son with the Real-time PCR method of TaqMan hydrolysis probes for first kind of CST1; Second kind of upstream and downstream primer of shearing son of CST1, upstream: GCACTGGGGAAGAGAGGCAT (SEQ ID No:26) downstream: AGGAGCAGCAGGGTACTCAGATA (SEQ ID No:27) CST2 primer, upstream: CAGAAGAAACAGTTGTGCTC (SEQ ID No:28) downstream: GGAGTAGGAGGTGGTCAG (SEQ ID No:29) CST4 primer, upstream: GCTCTCACCCTCCTCTCCTG (SEQ ID No:30) downstream: TATCCTATTCTCCTCCTTGG (SEQ ID No:31) internal control gene β-actin, upstream primer: AAGATCATTGCTCCTCCTG (SEQ ID No:32), downstream primer: CGTCATACTCCTGCTTGC (SEQ ID No:33).Cancer and cancer beside organism's goal gene and internal control gene increase together, calculate the relative expression quantity of goal gene in cancer and cancer beside organism by 2^ (Δ Δ CT) formula.Fluorescence dye such as SYBR Green, Eve Green, LC Green etc.

Amplification of nucleic acid sequences method (Nucleic Acid based Amplificatin, NASBA) external RNA amplification technique: t7 rna polymerase, RNase H, fowl myeloid leukemia virus (AMV) reversed transcriptive enzyme, ribonucleotide (NTP), deoxyribonucleotide (dNTP), first of CST1 are sheared the upstream and downstream primer of son with the Real-time PCR method of TaqMan hydrolysis probes, RNA fluorescence dye (Ribo-Green fluorescent dye).42 degree, 2 hours, can be with RNA template amplification 2^ (9-12), reaction product is put into fluorescence detector fluorescence intensity (U), thus reaction original template amount.

The differential expression of CST1 in the embodiment 1. human body different tissues

Used tissue sample is except normal gastric mucosa, and colonic mucosa is organized as the contriver outside chain hospital is collected, and other is respectively organized all and buys from commercialization mechanism.Adopt the Nucleotide chip HG-U95Av of Affymetrix to carry out each healthy tissues CST1 mRNA expression ratio, operating process is with reference to product description.The value of the relative expression quantity of this experiment is to carry out normalized signal value after the normalized by house-keeping gene β-actin fluorescent value.

The result as shown in Figure 2, in the desalivation gland CST1 expression amount higher outside, CST1 does not express in other tissue, illustrates that the background value that CST1mRNA is expressed in the healthy tissues is very low, this is used for detecting under the pathological conditions very favourable to CST1.At stomach cancer cell line NCI-N87, colon cancer cell line SW480 crosses among the Caco2 and expresses, and at people's gastric epithelial cell GES-1, colorectal cancer cells strain LOVO does not express among the HCT116, illustrates that CST1 very likely can be used as cancer of the stomach, the Marker of intestinal cancer molecular diagnosis.

Embodiment 2. cancer of the stomach and cancer other operation tissue samples CST1 and CST1,2,4, CST2 mRNA expression amount are relatively

By relatively 20 to CST1 in (G1-G20) cancer of the stomach and the cancer beside organism, CST1,2,4, CST2 mRNA expression amount is found CST1 mRNA expression amount difference maximum in cancer of the stomach and cancer beside organism, the results are shown in Figure 3.Above-mentioned sample all proves by pathology, adopts the dye method real-time quantitative PCR.

First kind of cut mode of CST1 (splice1) in embodiment 3. cancer of the stomach, the cancer beside organism's sample, second kind of cut mode (splice2) expression amount difference

Sample standard deviation by the operation sampling just carries out RNA extracting and reverse transcription cDNA after the pathology checking, adopt the dye method real-time quantitative PCR, at first detect house-keeping gene ACTB expression amount in the sample, find CP value basically identical among the sample ACTB, as Fig. 4 a, that is to say cDNA amount basically identical total in the sample, compared first kind of cut mode of CST1 (splice1) then, second kind of cut mode (splice2) is 20 pairs of cancer of the stomach, the median of the CP value that the cancer in the cancer beside organism is other and the difference of cancer, see Fig. 4 b, find that the expression amount obvious difference of first kind of cut mode of CST1 (splice1) in cancer and cancer side is better than splice2, that is to say that first kind of cut mode of CST1 (splice1) when whether differentiation is cancer, has more superiority.

Embodiment 4. cancer of the stomach, cancer take up the differential expression of first shearing (splice1) of normal operation tissue samples CST1

The sample standard deviation of taking a sample by operation just carries out RNA extracting and reverse transcription cDNA after the pathology checking, Real-timePCR absolute quantitation method is identified CST1, and first shears the differential expression of son in cancer of the stomach, cancer side and healthy tissues, and the test specimens given figure is 100 examples.

The result of Fig. 5 shows, first of specificity overexpression CST1 sheared sub-mRNA under the pernicious pathological conditions of stomach, and healthy tissues is low to be expressed and cancer takes up.The median of cancer copy is by the cancer/normally copy 57.5 times of median, and first of prompting CST1 sheared sub-mRNA and be can be used as good cancer of the stomach molecular marker.In the line of 100.68 copy places, can and normally make a distinction cancer, therefore 100.68 copies can be used as a reference value of cancer of the stomach clinical diagnosis.

The differential expression of first shearing of CST1 in the cancer of the stomach of taking a sample under embodiment 5. gastroscopes, the gastritis

Sampling has than big difference with the sample of operation sampling under the gastroscope, showing that mainly the rate variable of stomach cancer cell in the sampling tissue is very big, may only account for the very little part of monoblock tissue sometimes, have in addition do not have.Therefore inventor's statistical in 36 routine cancer of the stomach and the 36 routine gastritis patient's gastroscopes sampling samples first of CST1 shear the differential expression of son, the median of cancer sample copy number is 24 times of scorching sample copy number median, if rule at 98.89 copy places, cancer and inflammation can be made a distinction, can be the diagnosing gastric cancer of taking a sample under the gastroscope one reference value is provided.

The results are shown in Figure 6, method adopts the method for Real-time PCR absolute quantitation equally.

First of embodiment 6.CST1 sheared the differential expression of son in Metastasis of Gastric Cancer positive lymph nodes and negative lymphoglandula

What obtain in the operation proves 20 pieces in the lymphoglandula of the Metastasis of Gastric Cancer positive through pathology, and metastasis differs in size.The negative lymphoglandula of pathology is mainly taken from the early gastric cancer patient for 15 pieces, and reason is to reduce the pathological diagnosis feminine gender as far as possible but the actual lymphoglandula that has micrometastasis to exist, to avoid experimental error.Real-time PCR detection method is adopted in experiment, and concrete material and process are with embodiment 2.

The result of Fig. 7 shows that first of CST1 sheared son high expression level in shifting positive lymph nodes, and has only low the expression in negative lymphoglandula.It is in the negative lymphoglandula 11.469 times that first that shifts positive lymph nodes CST1 sheared sub-mRNA expression amount.If from the line of 98.5 copies, can distinguish the positive and negative lymphoglandula of Metastasis of Gastric Cancer substantially.First that has in the negative lymphoglandula of pathology that two examples detect CST1 sheared sub p+ lymphoglandula, through the careful observation of pathology doctor serial section, identifies the existence that micrometastasis is arranged.Therefore, shearing sub-mRNA expression degree from first of CST1 divides and not only 100% has distinguished the cytology detected result, and can detect the lymphoglandula that has micrometastasis to exist that cell blood can not detect, compare cytology and detect this detection method and have higher sensitivity.

The accuracy of free stomach cancer cell and cytology detect contrast in the embodiment 7. quantitative PCR detection peripheral bloods

Remove red corpuscle and hematoblastic peripheral blood karyocyte and extract RNA, shear sub-mRNA expression level through first of Real-time PCR method detection by quantitative CST1, by with the contrast of gastritis patient and normal people's expression amount, judge the existence whether free stomach cancer cell is arranged in the peripheral blood of patients with gastric cancer, and and cytology detect comparison.

The result of Fig. 8 shows, detection method 100% of the present invention is confirmed the positive findings of cytological Identification, can detect simultaneously in the case of cytological Identification stomach-Yin has part to shift case, illustrate that this method detects than cytology and has higher sensitivity, can detect the existence of the micrometastasis that cytology can't detect.

Embodiment 8. quantifying PCR methods detect cancer of the stomach marrow and shift the contrast with the cytolgical examination result

The patients with gastric cancer marrow that methods such as puncture obtain is sheared sub-mRNA expression level through first of Real-time PCR method detection by quantitative CST1, by with normal bone marrow relatively judge CST1 first shear whether high expression level of sub-mRNA, confirm whether marrow exists transfer and micrometastasis, and compare with the cytology result.

The result of Fig. 9 shows, detection method of the present invention can 95% be confirmed the cytology positive findings, and positive rate is higher than the cytology result simultaneously, shows that susceptibility is than cytology detection method height.

First shearing amount of CST1 and inflammation/normal people's difference among the embodiment 9. Patients with Gastric Cancer plasma C ell-free RNA

Use commercial test kit, Cell-free RNA in the extracting blood plasma, Real-time PCR detect CST1 first shearing amount and scorching (30 example), normal people's's (30 example) difference among Patients with Gastric Cancer (50 example) the plasma C ell-free RNA.

The result as shown in figure 10, Figure 10 a show CST1 first shear son median of copy number in cancer be scorching/normal about 20 times, in the line of copy number 13.972 places, can be with cancer and inflammation/normally make a distinction.First method of shearing sub-expression amount diagnosis of gastric cancer has higher sensitivity and specificity to the ROC curve display of Figure 10 b based on CST1, so CST1 can be used as the specificity Marker of the plasma sample diagnosing gastric cancer of Noninvasive.

Embodiment 10. ligase chain reactions (Ligase chain reation, LCR) first shearing amount of CST1 and inflammation/normal people's difference among the method detection Patients with Gastric Cancer blood sample Cell-free RNA

The result as shown in figure 11, CST1 first shear son in cancer relative intensity of fluorescence (relative light units, median RLU) be scorching/normal about 19 times, rule at relative intensity of fluorescence 13.66RLU place, can be with cancer and inflammation/normally make a distinction.

Embodiment 11 thermophilic strand displacement amplifications (thermophilic strand displacement amplification, tSDA) first shearing amount of CST1 and inflammation/normal people's difference among the method Patients with Gastric Cancer blood sample Cell-free RNA

The results are shown in Figure 12, CST1 first shear son in cancer relative intensity of fluorescence (relative light units, median RLU) be scorching/normal about 19 times, rule at relative intensity of fluorescence 12.44RLU place, can be with cancer and inflammation/normally make a distinction.

First shearing amount of CST1 and inflammation/normal people's difference among the embodiment 12. Patients with Gastric Cancer urine sample Cell-free RNA

Use commercial test kit, Cell-free RNA in the extracting urine, the amplification of nucleic acid sequences method of fluoroscopic examination (Nucleic Acid based Amplificatin, NASBA) detect CST1 first shearing amount and scorching (10 example), normal people's's (10 example) difference among Patients with Gastric Cancer (20 example) the urine sample Cell-free RNA.

The result as shown in figure 13, CST1 first shear son median of fluorescence intensity in cancer be scorching/normal about 7 times, rule at 14.329U place, cancer and inflammation/normally make a distinction namely can be can be used as a reference value of the urine specimen diagnosing gastric cancer of Noninvasive.

First shears sub-expression amount and the commercial test kit of cancer of the stomach pTNM relational application by stages embodiment 13.CST1, Cell-free RNA in the extracting blood plasma, use amplification (the Transcription-Mediated amplification of Gen-probe transcriptive intermediate, TMA) method, (pTNM by stages to detect 50 routine cancer of the stomach, I+II 30 examples, III+IV50 example) different CST1 by stages first shear the difference of sub-expression amount.

The results are shown in Figure 14, first shears son relative intensity of fluorescence (relative light units in cancer of the stomach I+II CST1, RLU) median is 2.1 times of III+IV, at relative intensity of fluorescence (relative light units, RLU) 12.44RLU place line can be with cancer and inflammation/normally make a distinction.

First of the other operation of embodiment 14. large bowel cancers and cancer tissue samples CST1 sheared the differential expression of son

Sample standard deviation by the operation sampling just carries out RNA extracting and reverse transcription cDNA after the pathology checking, Real-timePCR absolute quantitation method is identified CST1, and first shears the differential expression of son in large bowel cancer and cancer beside organism, and the test specimens given figure is 100 pairs.

The result of Figure 15 shows, first of specificity overexpression CST1 sheared sub-mRNA under the malignant colonic pathological conditions, and other low expression of healthy tissues of cancer.The median of cancer copy is 48.95 times of the other copy of cancer median, and first of prompting CST1 sheared sub-mRNA and be can be used as good intestinal cancer molecular marker.In the line of 77.7 copy places, can and normally make a distinction cancer, therefore 77.7 copies can be used as a reference value of large bowel cancer clinical diagnosis.

The differential expression of first shearing of CST1 in the intestinal cancer of taking a sample under the embodiment 15. intestines mirrors, the enteritis.

Sampling has than big difference with the sample of operation sampling under the intestines mirror, showing that mainly the rate variable of colon-cancer cell in the sampling tissue is very big, may only account for the very little part of monoblock tissue sometimes, have in addition do not have.Therefore inventor's statistical in 36 routine intestinal cancer and the 36 routine enteritis patient's intestines mirrors sampling samples first of CST1 shear the differential expression of son, the median of cancer sample copy number is about 23.1 times of scorching sample copy number median, if rule at 87.5 copy places, cancer and inflammation can be made a distinction, can be the diagnosing gastric cancer of taking a sample under the intestines mirror one reference value is provided.

The results are shown in Figure 16, method adopts the method for Real-time PCR absolute quantitation equally.

First of embodiment 16.CST1 sheared the differential expression of son in intestinal cancer transfer positive lymph nodes and negative lymphoglandula

What obtain in the operation proves 20 pieces in the positive lymphoglandula of intestinal cancer transfer through pathology, and metastasis differs in size.The negative lymphoglandula of pathology is mainly taken from early stage intestinal cancer patient for 15 pieces, and reason is to reduce the pathological diagnosis feminine gender as far as possible but the actual lymphoglandula that has micrometastasis to exist, to avoid experimental error.Real-time PCR detection method is adopted in experiment, and concrete material and process are with embodiment 2.

The result of Figure 17 shows that first of CST1 sheared son high expression level in shifting positive lymph nodes, and has only low the expression in negative lymphoglandula.It is in the negative lymphoglandula 11.469 times that first that shifts positive lymph nodes CST1 sheared sub-mRNA expression amount.If from the line of 100 copies, can distinguish intestinal cancer substantially and shift positive and negative lymphoglandula.First that has in the negative lymphoglandula of pathology that two examples detect CST1 sheared sub p+ lymphoglandula, through the careful observation of pathology doctor serial section, identifies the existence that micrometastasis is arranged.Therefore, shearing sub-mRNA expression degree from first of CST1 divides and not only 100% has distinguished the cytology detected result, and can detect the lymphoglandula that has micrometastasis to exist that cell blood can not detect, compare cytology and detect this detection method and have higher sensitivity.

First shearing amount of CST1 and inflammation/normal people's difference among the embodiment 17. intestinal cancer patient plasma C ell-free RNA

Use commercial test kit, Cell-free RNA in the extracting blood plasma, Real-time PCR detect CST1 first shearing amount and scorching (30 example), normal people's's (30 example) difference among intestinal cancer patient (50 example) the plasma C ell-free RNA.

The result as shown in figure 18, Figure 18 a show CST1 first shear son median of copy number in cancer be scorching/normal about 20 times, in the line of copy number 13.89 places, can be with cancer and inflammation/normally make a distinction.First method of shearing sub-expression amount diagnosis intestinal cancer has higher sensitivity and specificity to the ROC curve display of Figure 18 b based on CST1, so CST1 can be used as the specificity Marker of the plasma sample intestinal cancer diagnosis of Noninvasive.

First shearing amount of CST1 and inflammation/normal people's difference among the embodiment 18. intestinal cancer patient urine sample Cell-free RNA

Use commercial test kit, Cell-free RNA in the extracting urine, the amplification of nucleic acid sequences method of fluoroscopic examination (Nucleic Acid based Amplificatin, NASBA) detect CST1 first shearing amount and scorching (20 example), normal people's's (20 example) difference among intestinal cancer patient (30 example) the urine sample Cell-free RNA.

The result as shown in figure 19, CST1 first shear son median of copy number in cancer be scorching/normal about 7 times, in copy number 16.96U place line, can be with cancer and inflammation/normally make a distinction, namely can be used as the reference value that the urine specimen intestinal cancer of Noninvasive is diagnosed.

First shears sub-expression amount for cancer of the stomach, the dynamic monitoring of intestinal cancer therapeutic process embodiment 19.CST1

Use real time quantitative PCR method, first shears sub-expression amount by CST1 in the detection patient blood, monitors chemotherapy of gastric cancer patient 3 people in real time, radiotherapy group 2 people, intestinal cancer chemotherapy patients 3 people, radiotherapy 2 people, result for the treatment of.

The results are shown in Table 1, first is sheared sub-expression amount and reduces gradually along with the increase of the course for the treatment of to treat effective patient CST1, and iconography result shows that also lump reduces gradually; And the patient CST1 that fails to respond to any medical treatment first shear sub-expression amount and increase gradually along with the increase of the course for the treatment of, iconography result shows that lump has the trend that becomes big.Therefore, first shearing of CST1 can be used as the index of a dynamic monitoring in cancer of the stomach, the intestinal cancer patient treatment process.

Table 1 is that first shears the amount of son by CST1 in the gastrointestinal tumor blood samples of patients in the real-time quantitative PCR detection chemicotherapy process

First shears the relation that sub-expression amount and cancer of the stomach, intestinal cancer patient's prognosis are judged embodiment 20.CST1

Based on the real-time quantitative PCR technology, respectively 1 month, 3 months, 1 year after surgery or behind the chemicotherapy is followed the tracks of and has been followed up a case by regular visits to 3 cancer of the stomach, in 2 intestinal cancer blood samples of patients CST1 first shear the situation of sub-expression amount.

The result is as shown in table 2,2 patients of recurrence after a year, and first shears sub-expression amount along with the prolongation of time is increased gradually CST1, is just found to make a definite diagnosis by iconography when reaching 1000 copy left and right sides; And do not have the patient of recurrence in 1 year, and first shears CST1 expression amount and there is no considerable change, and iconography is also no abnormal.Therefore, first shearing sublist of CST1 reaches the index that quantitative changeization can be used as gastrointestinal tumor patient prognosis judgement.Table 2 is to detect behind operation back or the chemicotherapy 1 month, 3 months, 1 year by real-time quantitative PCR, in the gastrointestinal tumor blood samples of patients CST1 first shear the amount of son.

Embodiment 21. is based on the CST1 mRNA real-time quantitative detection kit of Taqman hydrolysis probes method

The preparation test kit, contain in the described test kit:

(1) primer, probe comprises:

Upstream primer: TCTCACCCTCCTCTCCTG (SEQ ID No:1)

Downstream primer: TTATCCTATCCTCCTCCTTGG (SEQ ID No:2)

Probe: 5 '-FAM-CTCCAGCTTTGTGCTCTGCCTCT-TAMRA-3 ' (SEQ ID No:3)

(2) Chang Gui nucleic acid extract and reverse transcription reagent, dNTP, Taq enzyme, the water of no RNA enzyme (Rnase-freeH2O), standard substance, positive reference substance, negative control product, 10*Buffer, Mgcl2.

(3) working instructions.

Embodiment 22. is based on the CST1 mRNA real-time quantitative detection kit of dye method

Contain in the test kit:

(1) CST1 primer comprises:

Upstream primer: TCTCACCCTCCTCTCCTG (SEQ ID No:1)

Downstream primer: TTATCCTATCCTCCTCCTTGG (SEQ ID No:2)

β-actin：

Upstream primer: AAGATCATTGCTCCTCCTG (SEQ ID No:30)

Downstream primer: CGTCATACTCCTGCTTGC (SEQ ID No:31)

(2) Chang Gui nucleic acid extract and reverse transcription reagent, SYBR Green dyestuff, dNTP, Taq enzyme, the water of no RNA enzyme (RNase-free H2O), standard substance, positive reference substance, negative control product 10*Buffer, Mgcl2.

(3) working instructions.

Embodiment 23. nucleic acid sequence based amplification methods (Nucleic Acid based Amplificatin, NASBA) the CST1 mRNA detection by quantitative test kit of method

Contain in the test kit:

(1) CST1 primer comprises:

Upstream primer: TCTCACCCTCCTCTCCTG (SEQ ID No:1)

Downstream primer: TTATCCTATCCTCCTCCTTGG (SEQ ID No:2)

Conventional nucleic acid extract and reverse transcription reagent, t7 rna polymerase, RNase H,

Fowl myeloid leukemia virus (AMV) reversed transcriptive enzyme, ribonucleotide (NTP), deoxyribonucleotide (dNTP), RNA fluorescence dye (Ribo-Green fluorescent dye).

Working instructions.

Embodiment 24. is based on amplification (Transcription-mediated amplification, CST1 mRNA detection by quantitative test kit TMA) of transcriptive intermediate.

The preparation test kit, contain in the described test kit:

(1) primer, probe comprises:

Upstream primer: TCTCACCCTCCTCTCCTG (SEQ ID No:1)

Downstream primer: TTATCCTATCCTCCTCCTTGG (SEQ ID No:2)

Probe: 5 '-FAM-CTCCAGCTTTGTGCTCTGCCTCT-TAMRA-3 ' (SEQ ID No:3)

(2) other reaction reagent is the reagent except primer and probe among the Gen-probe TMA assay.

(3) working instructions

Embodiment 25. is based on ligase chain reaction (Ligase chain reation, CST1 mRNA detection by quantitative test kit LCR)

The preparation test kit, contain in the described test kit:

(1) 4 of probes (hapten-marked)

1)AGTATCTGAGTACCCTGCTGCTCCTGC(SEQ?ID?No：34)

2)ACCCTAGCTGTGGCCCTGGCCTGGAG(SEQ?ID?No：35)

3)CATAGACTCATGGGACGACG(SEQ?ID?No：36)

4)ACACCGGGACCGGACCTC(SEQ?ID?No：37)

(2) business-like nucleic acid extracting reagent, reverse transcription reagent, other reagent is with Abbott Laboratories (LCX)

(3) specification sheets

Embodiment 26. is based on thermophilic strand displacement amplification (thermophilic strand displacement amplification, CST1mRNA detection by quantitative test kit tSDA)

The preparation test kit, contain in the described test kit:

(1) primer

Randam primer:GTCGAC-TCTCA, CCCTCCTCTCCTG (SEQ ID No:1) (adding Hinc II restriction enzyme site)

Downstream primer: TTATCCTATCCTCCTCCTTGG (SEQ ID No:2)

Probe:

5′-FAM-GTCGAC-TCTCAATCGACCGGCCAGGTTAGCGTCGATCTCCCTCCTCTCCTG-TAMRA-3′(SEQ?ID?No：38)

(2) commercialization nucleic acid extracting reagent, reverse transcription reagent, other reagent is with Thermophilicstrand displacement amplification (tSDA) assay of Becton Dickinson.

(3) specification sheets.

Above-mentioned example only is explanation technical conceive of the present invention and characteristics, and its purpose is to allow the people who is familiar with this technology can understand content of the present invention and enforcement according to this, can not limit protection scope of the present invention with this.All equivalent transformations that spirit is done according to the present invention or modification all should be encompassed within protection scope of the present invention.

Claims

1. test kit that is used for indication or detects gastrointestinal tumor is characterized in that: described test kit comprises that first shears primer and the probe of son be used to catching CST1 gene shown in SEQ ID No:39 or the CST1 gene shown in SEQ ID No:43;

Described primer is the nucleotide sequence shown in SEQ ID No:1～2; Described probe is 5 '-FAM-ctccagctttgtgctctgcctct-TAMRA-3 '

Or

5′-FAM-gtcgac-tctcaatcgaccggccaggttagcgtcgatctccctcctctcctg-TAMRA-3′。

2. test kit according to claim 1 is characterized in that described test kit also comprises CST1 gene or the sub corresponding visual reaction reagent of amplicon of primer of first shearing of the CST1 gene shown in SEQ ID No:43 that makes shown in SEQID No:39; Described reaction reagent comprises by being selected from agarose gel electrophoresis, enzyme connection gel method, electrochemiluminescence technology, hybridization in situ technique, fluorescence detection to be made CST1 gene or CST1 gene first shears the visual reagent of amplicon of the primer correspondence of son.

3. test kit according to claim 2, it is characterized in that described test kit comprise positive stomach cancer cell line with reference to product, the normal gastric cells strain as negative reference product, standard substance, nucleic acid extracting reagent, reverse transcription reagent, pcr reagent, the primer shown in SEQ ID No:1～2 to as 5 '-probe shown in the FAM-ctccagctttgtgctctgcctct-TAMRA-3 '.

4. test kit according to claim 1 is characterized in that: described CST1 gene or first amplification method of shearing son of the CST1 gene shown in SEQ ID No:43 TRAP or thermophilic strand displacement amplification method of being selected from real-time quantitative PCR method, transcriptive intermediate shown in SEQ ID No:39.

5. a gene chip that is used for indication or detects gastrointestinal tumor is characterized in that described gene chip comprises be used to CST1 gene or sub primer and the probe of first shearing of the CST1 gene shown in SEQ ID No:43 of catching shown in SEQ ID No:39; Described primer is SEQ ID No:1～2, described probe is 5 '-FAM-ctccagctttgtgctctgcctct-TAMRA-3 '.