CN101974089A

CN101974089A - Recombination fusion protein Trx-TAT-hMsrA and application thereof to aspect of nerve cell protection

Info

Publication number: CN101974089A
Application number: CN2010101977294A
Authority: CN
Inventors: 陈建国; 曾建华; 吴鹏飞; 王芳; 张醉; 杨远坚
Original assignee: Huazhong University of Science and Technology
Current assignee: Huazhong University of Science and Technology
Priority date: 2010-06-11
Filing date: 2010-06-11
Publication date: 2011-02-16
Anticipated expiration: 2030-06-11
Also published as: CN101974089B

Abstract

The invention discloses a preparation method of a fusion protein Trx-TAT-hMsrA and application thereof to an aspect of nerve cell protection. The fusion protein Trx-TAT-hMsrA comprises a TAT protein transduction structure domain, thioredoxin Trx and anthropogenic methionine sulfoxide reductase hMsrA. The fusion protein of the invention has various biological effects for reducing the oxidization of functional protein methionine residues, treating oxidative stress injury, relieving the relevant nerve cell pathological change of parkinsonism, preventing and treating calcium ion overloading and the like, simultaneously has good capability for entering nerve cells through the epicyte, and belongs to novel biotechnological medicine candidates with good druggability.

Description

Reorganization Trx-TAT-hMsrA fusion rotein and the application aspect neurocyte protection thereof

Technical field

The invention belongs to gene engineering technology field; being specifically related to a kind of fusion has TAT nexin transduction domain and humanized's methionine sulphoxide reductase enzyme hMsrA and the formed fusion rotein of sulphur hydrogen reduction albumen Trx (reorganization Trx-TAT-hMsrA fusion rotein), and preparation method thereof and the application aspect neurocyte protection.

Background technology

A large amount of modern Neuroscience Research show that the pathology damage of Mediated by Free Radicals participates in the generation and the development of multiple neural system major disease.The lipid content that brain is abundant and the antioxidase level of relative shortage make it easier to be impaired in oxidative stress.Multiple factor (as unusual folded protein gather, ischemical reperfusion injury etc.) induce neurone to produce more active oxygen (ROS) by approach such as plastosome aerobic repiration, as O ^2-., H ₂O ₂, OH and ¹O ₂, and in the aging course often with the weakening of ROS scavenge system (as gsh restoring system, superoxide-dismutase etc.), thereby cause the abnormal accumulation of oxyradical or oxidation products, cause the generation of neural system major disease.Protein is the basic substance of most cells physiological activity, oxyradical is for the oxidative modification of functional protein such as ionic channel, enzyme and acceptor etc., tend to cause the inactivation of protein function, unusual even proteinic degraded aggravation, thus the disorder of mediated cell physiological function.What be vulnerable to attack most in the protein molecule is the sulfur-containing amino acid residue, comprise cysteine residues (cysteine, Cys) and methionine(Met) (methionine, Met) residue, the oxidation products of Cys comprises sulfeno disulphide and sulfo group, usually based on disulphide.When having reducing substanceses such as sulphur hydrogen reduction albumen or the external DTT of existence in the body, disulfide linkage easily is reduced into sulfydryl.The cysteine residues oxidation forms disulfide linkage, can influence comprise the important proteic functions of neural system such as L type calcium channel, glutamate receptor, the applicant place is breadboard to be studies show that in a large number, use sulfydryl reductibility medicine to reverse this variation of reduction, can treat old and feeble relevant cynapse function damage.The methionine residue oxidation is another crucial induction factor of protein function oxidative damage.Under the weak oxidant effect, methionine(Met) easily is oxidized to MetO, under the effect of more strong oxidizer such as Ch-T, can further be oxidized to MetO2.MetO can be reduced into Met by the methionine(Met) reductase enzyme, but MetO2 is highly stable, can not be reduced under the physiological condition.On structure, normal methionine(Met) side chain is very long, flexible, nonpolarity.After being oxidized to MetO, it is stiff that side chain becomes, and it is big that polarity becomes, thereby whole protein function is changed.External a large amount of breadboard studies show that, the methionine residue oxidation of key protein matter and the generation of multiple neural system major disease development are closely related.The applicant place is breadboard to be studies show that in a large number, and the oxidative modification of protein methionine residue and ion channel function are unusual, synaptic plasticity damage and cell calcium stable state are unbalance all substantial connection.Therefore, regulate the oxidation of protein methionine residue, may become the New Policy of treatment neural system major disease.

(methionine sulfoxide reductase A is that can reducing in vivo of finding at present reverses that protein methionine residue oxidation structure changes and the main antioxidase system of function damage MsrA) to methionine sulphoxide reductase enzyme A.MsrA is in a lot of organisms, and very ancient archeobacteria intestinal bacteria all have discovery to plant and Mammals on evolving, and its antioxygenation has the meaning of particularly important for the existence of organism.Studies show that in a large number MsrA is a kind of anti-oxidant reparative factor that is present in the organism.Cross and express the MsrA gene and can significantly alleviate human T-cell, people Lens cell, PC12 cell and isocellular damage of WI-38SV40 and the apoptosis that oxidative stress causes.There is research to think that MsrA and aging and Mammals life-span are closely related.Therefore, regulate the genetic expression of MsrA, provide new angle and technique means for treating the relevant pathologic conditions of multiple oxidation.And sulphur hydrogen reduction albumen (Trx) be in a kind of lower molecular weight, the evolution high conservative reduction disulfide linkage oxidation products active protein arranged, major function is to regulate redox equilibriums in the cell born of the same parents, participates in oxidative stress inductive apoptosis.It is that the MsrA system brings into play the most important mate molecule of function in vivo, also is simultaneously to go back cysteine residues oxidation most important function molecule in the substance, and we imagine, and by the method for gene recombination, prepare the fusion rotein of a kind of MsrA and Trx.In the neural system major disease, numerous disease is closely related with oxidative damage and apoptosis, comprises parkinsonism, ischemic brain injury, senile dementia, vascular dementia etc.Use this fusion rotein, in these treatment of diseases, may play important effect.

Methionine sulphoxide reductase enzyme A (MsrA) and sulphur hydrogen reduction albumen (Trx) all are functional protein in essence, can be prepared according to engineered method.But protein-based biotech drug is difficult to enter cell, the peripherally administered also very difficult hemato encephalic barrier that sees through.For these that overcome pharmaceutical grade protein become the shortcoming of property of medicine differences, development can be used in the new bio technical agent of central nervous system disease, and we imagine by MsrA and the Trx of gene recombination transformation as functional protein.HIV-1 virus is a kind ofly to have very strong penetration cell and enter the protein particulate of central nervous system ability, and its key structure territory that enters cell and enter central nervous system is its Tat albumen 49-57 amino acids.This Tat dietary protein origin wear the little peptide in membrane structure territory, enter in transporter matter and shown extremely strong application prospect aspect the cell.We pass through gene engineering method at imagination, the wear little peptide in membrane structure territory, humanized's methionine sulphoxide reductase enzyme A albumen and the sulphur hydrogen reduction albumen of Tat dietary protein origin are built into fusion rotein, thereby are used for preparation treatment neural system major disease related drugs in the future.

Summary of the invention

The purpose of this invention is to provide a kind of fusion rotein, make it have the neurocyte protection effect.

Another task of the present invention provides the preparation method and the application of this fusion rotein.

Realize that technical scheme of the present invention is:

This fusion rotein provided by the invention is made up of sulphur hydrogen reduction albumen Trx and TAT nexin transduction domain and humanized's methionine sulphoxide reductase enzyme hMsrA, and patent application of the present invention is called reorganization Trx-TAT-hMsrA fusion rotein with this fusion rotein.

Reorganization Trx-TAT-hMsrA fusion rotein provided by the invention has 416 amino acid altogether, and wherein the 1-109 amino acids is a Trx albumen, and the 110-165 amino acids is the joining region, and the 166-179 amino acids is a TAT albumen, and the 180-416 amino acids is a hMsrA albumen.Reorganization Trx-TAT-hMsrA fusion rotein provided by the invention is just like the aminoacid sequence shown in the SEQ ID NO:1, and molecular weight is 45KD.

Reorganization Trx-TAT-hMsrA fusion rotein comprises three functional zone, and the function of each functional zone is as follows: the Trx major function is to regulate redox equilibrium in the cell born of the same parents; TAT albumen is a polypeptide fragment that is rich in basic aminoacids, and major function is a guiding reorganization Trx-Tat-hMsrA fusion rotein permeates cell membranes; Humanized's methionine sulphoxide reductase enzyme hMsrA is the unique reductase enzyme that can go back the oxidation of crude protein methionine residue in the body, and major function is to repair the protein oxidation damage.Because numerous disease is closely related with oxidative damage, comprise parkinsonism, ischemic brain injury, senile dementia, vascular dementia etc., the present invention's Trx-TAT-hMsrA fusion rotein of recombinating can be used for these treatment of diseases.

Experimental data one:

The preparation method that patent application embodiment 1 of the present invention provides the present invention to recombinate the Trx-TAT-hMsrA fusion rotein.Experimental data one provides the present invention the Trx-TAT-hMsrA fusion rotein materials of identification of recombinating.

1. the Western blot of reorganization Trx-TAT-hMsrA fusion rotein identifies

Fusion rotein is Western blot and is detected qualification test.Deposition condition and embodiment two are consistent.Press table three preparation transfering buffering liquid.Press table four preparation TBST damping fluid.After electrophoresis finishes, cut out glue about target protein position (45KD) according to albumen market, immersing with NC film, filter paper changeed in the film liquid balance at least 15 minutes.According to negative pole, sponge, filter paper, glue, the NC film, filter paper, sponge, anodal puts it in proper order to be changeed in the bellows, and the wet commentaries on classics method of constant current is transferred to albumen on the NC film from glue.After changeing film and finishing, the NC film was immersed in the confining liquid in (5% degrease milk powder is dissolved in TBST) sealing 1 hour, with one anti-(1% degrease milk powder is dissolved in the TBST preparation) that the NC film places proper concn, 4 ℃ of vibration overnight incubation.After the abundant rinsing of TBST, add two of HRP mark and resist, after the abundant rinsing of .TBST in 1 hour is hatched in vibration under the room temperature, the ECL fluorescent agent, 5 minutes, according to fluorescence intensity, the correct exposure compressing tablet developed. after the film scanning, the density of using Image J software analysis to develop.

Table three

Table four

(Upstate USA) further confirms this fusion rotein Trx-TAT-hMsrA fusion rotein of recombinating exactly with MsrA antibody.Referring to accompanying drawing 4.

2. the film activity of wearing of reorganization Trx-TAT-hMsrA fusion rotein is identified

In the DMEM substratum, cultivate the Chinese hamster ovary celI strain, went down to posterity once in 2-3 days.When cell state is better, plant on slide.Use reorganization Trx-TAT-hMsrA fusion rotein (5nM) incubated cell, fixing after 24 hours.(Upstate USA) carries out the cellular immunofluorescence experiment to use MsrA antibody.Step comprises: preparation PBS solution 250ml:Na2HPO4:0.725g; NaH2PO4:0.075g; Nacl:2.25g.Regulate PH to 7.2-7.4.There is the slide of cell to put into 24 orifice plates with long, PBS rinsing three times, each 10min; Every hole adds 4% the Paraformaldehyde 96 of 500ul, and 20min carries out cell fixation; PBS rinsing three times, each 10min;

0.3% the Triton that every hole adds 500ul changes 30min thoroughly; 3% the BSA that every hole adds 500ul seals 30min; Use 1: 500 ratio, in the PBS that contains 1%BSA, 10%Triton and NGS (sheep blood serum) 3%, add MsrA antibody, 4 ℃, spend the night; PBS rinsing three times, each 10min; Use 1: 1000 ratio, in the PBS that contains 1%BSA, 10%Triton and NGS (sheep blood serum) 3%, add FITC mark mouse-anti rabbit two and resist room temperature, 2h; PBS rinsing three times, each 10min; 30% glycerine mounting, cell faces down.Use the Lycra fluorescent microscope to take pictures.The result shows that reorganization Trx-TAT-hMsrA fusion rotein can enter Chinese hamster ovary celI.Conclusion: reorganization Trx-TAT-hMsrA fusion rotein has film activity.See Fig. 5.

3. the methionine sulphoxide reducing activity of reorganization Trx-TAT-hMsrA fusion rotein is identified

The measuring method of methionine sulphoxide reductase activity is followed the method that this laboratory has been set up: preparation contains the reaction solution of following reaction reagent, and its final concentration is respectively: MgCl ₂10mM; KCl 30mM; Tris.HCl 25mM; Dithiothreitol (DTT) 1mM.Regulate PH to 7.4 with hydrochloric acid.The adding methionine sulphoxide is to final concentration 10mM and add sample to be tested to this reaction solution, 37 ℃ of reactions are after 60 minutes, add colour developing liquid Ellman reagent (5,5 '-dithio-two-2-nitrobenzoic acid) 0.01M and NaOH 0.1M, regulate PH to 8.0-8.5,37 ℃ of reactions 5-10 minute are with the microplate reader detection 412nm OD of place value.With not adding the background liquid OD value of reactant and the OD value after the reaction end, bring following formula into, calculate enzyme and live:

Enzyme (U/ml)=(OD enzyme background-OD enzyme reaction) * V system alive * diluted sample multiple/reaction times * 1* ε TNB*V sample

In the formula:

The OD enzyme reaction finishes the OD value in afterreaction hole for reaction, OD enzyme background finishes the OD value in rear backdrop hole for reaction, and the V system is the reaction cumulative volume, and the V sample is that population of samples is long-pending, l is light path thickness (instrument(al)constant), ε TNB: be the optical extinction coefficient of sulfo--2-nitrobenzoic acid.L* ε TNB numerical value can also can calculate by typical curve by searching the instrument specification sheets and chemical handbook method obtains.The making method of typical curve: with damping fluid (MgCl ₂10mM, KCl 30mM, Tris.HCl 25mM, PH=7.4) configuration different concns dithiothreitol (DTT) (100 μ M-2000 μ M), reacted 10 minutes at 37 ℃ with DTNB methanol solution (0.01M) equal-volume, add NaOH solution (0.1M) and regulate PH, read the OD value at the 412nm place to 8.0-8.5, OD value and dithiothreitol (DTT) concentration are carried out linear regression analysis, can calculate l* ε TNB numerical value.In 96 orifice plates, add damping fluid (MgCl ₂10mM, KCl 30mM, Tris.HCl 25mM, PH=7.4) each 50 μ l of Pei Zhi dithiothreitol (DTT) (1mM) and methionine sulphoxide solution (10mM) are as reacting hole; The dithiothreitol (DTT) of damping fluid configuration and each 50 μ l of damping fluid are the hole as a setting.37 ℃ of preheatings 10 minutes.The protein liquid that adds etc. protein content 5 μ g and 10 μ g to reacting hole and corresponding background hole respectively.37 ℃ of joltings were reacted 60 minutes.Add 20 μ l NaOH solution (0.1M) respectively to reacting hole and corresponding background hole.37 ℃ of joltings 5 minutes.Add 100 μ l reagent E llman reagent (0.01M) respectively to reacting hole and corresponding background hole.37 ℃ of joltings 5 minutes.With microplate reader in 412nm place reading numerical values, by formula:

Enzyme (U/ml)=(OD enzyme background-OD enzyme reaction) * V system alive * diluted sample multiple/reaction times * l* ε TNB*V sample

Calculate enzymic activity.

Table five reaction system OD value and protease activity

Enzyme amount (μ g) OD background OD reaction enzymes (U/g) alive

5 0.498 0.355 326

10 0.942 0.634 544

Conclusion: the reorganization Trx-TAT-hMsrA fusion rotein of table five explanation preparation has the activity of reduction methionine sulphoxide.

Experimental data two: reorganization Trx-TAT-hMsrA fusion rotein is to the provide protection of neural cell injury

1, reorganization Trx-TAT-hMsrA fusion rotein causes the provide protection of neural cell injury for oxidative stress

The neural female tumor cell strain SH-SY5Y of humanized is with containing the DMEM culture medium culturing of 15% foetal calf serum in 37 degrees centigrade of 5%CO2 incubators.Went down to posterity once in every 3-5 days.The experiment before with the SH-SY5Y kind in 96 orifice plates.Use hydrogen peroxide 250 μ M to handle and made oxidative stress damaging cells model in 12 hours.Reorganization Trx-TAT-hMsrA fusion rotein (5nM and 0.5nM) adds in hydrogen peroxide and added substratum in preceding 2 hours, and remains to the experiment end always.Experiment finishes the back and uses MTT to detect cytoactive.Culture supernatant in the hole is absorbed in each hole, adding the serum-free cell culture medium 200ul that contains 0.5mg/ml MTT continued to hatch 4 hours, stop cultivating, absorb culture supernatant in the hole, every hole adds 100 μ l DMSO, vibrates 10 minutes, carries out colorimetric immediately after crystallisate is fully melted, the mensuration wavelength is 570nm, and measuring each hole absorbancy on microplate reader is the OD value.Detection hole OD value deducts blank well zeroing hole OD value and is the actual OD value in detection hole.The result is referring to accompanying drawing 6.The result shows that hydrogen peroxide 250 μ M handle and can cause that tangible cytoactive descended in 12 hours, and the processing of Trx-TAT-hMsrA fusion rotein can significantly improve the cytoactive after the hydrogen peroxide treatment.

2, reorganization Trx-TAT-hMsrA fusion rotein causes the provide protection of neural cell injury for parkinsonism related pathologies factor MPP

The neural female tumor cell strain SH-SY5Y of humanized is with containing the DMEM culture medium culturing of 15% foetal calf serum in 37 degrees centigrade of 5%CO2 incubators.Went down to posterity once in every 3-5 days.The experiment before with the SH-SY5Y kind in 96 orifice plates.Use MPP (sigma) 2mM to handle and made PD relevant cell damage model in 48 hours.Reorganization Trx-TAT-hMsrA fusion rotein (5nM and 0.5nM) adds in MPP and added substratum in preceding 2 hours, and remains to the experiment end always.Experiment finishes the back and uses MTT to detect cytoactive.Culture supernatant in the hole is absorbed in each hole, adding the serum-free cell culture medium 200ul that contains 0.5mg/ml MTT continued to hatch 4 hours, stop cultivating, absorb culture supernatant in the hole, every hole adds 100 μ l DMSO, vibrates 10 minutes, carries out colorimetric immediately after crystallisate is fully melted, the mensuration wavelength is 570nm, and measuring each hole absorbancy on microplate reader is the OD value.Detection hole OD value deducts blank well zeroing hole OD value and is the actual OD value in detection hole.The result is referring to accompanying drawing 7.The result shows that MPP (2mM) handles and can cause that tangible cytoactive descended in 24 hours, and the Trx-TAT-hMsrA fusion rotein is handled the cytoactive that can significantly improve after MPP handles.

3, reorganization Trx-TAT-hMsrA fusion rotein causes the provide protection of cell calcium overload for oxidation

In the DMEM substratum, cultivate the Chinese hamster ovary celI strain, went down to posterity once in 2-3 days.When cell state is better, plant on slide.Use reorganization Trx-TAT-hMsrA fusion rotein (5nM) incubated cell, carry out the calcium ion imaging experiment after 24 hours.Use Fura-2/AM probe incubated cell.Fura-2/AM is an Ester, can permeate through cell membranes, can be become activated Fura-2 by esterase hydrolyzed specific in the born of the same parents again, then with born of the same parents in Free Ca ²⁺In conjunction with, be respectively about 340nm and 380nm in conjunction with the excitation wavelength of after product.[Ca in the born of the same parents ²⁺] _iCan be directly calculate promptly two excitation wavelength fluorescent methods by the ratio of the fluorescence intensity on two excitation wavelengths.With after being seeded in Chinese hamster ovary celI strain on the slide and cleaning three times with extracellular fluid, adding the certain volume final concentration is 1 μ M Fura-2/AM, hatches 30min for 37 ℃.Clean twice again and begin experiment to remove the outer Fura-2/AM of born of the same parents.Ca in the born of the same parents ²⁺Signal with fluorescence survey the calcium system detect (TILL Photpnics GmbH, Germany).The native system major parts comprises: OLYMPUS inverted microscope, CCD, optical fiber cold light source, controller and computer Vision process software etc.Cell sheet glass is put into the cell groove that is fixed on inverted microscope (Olympus IX-70) moveable platform, and with normal extracellular fluid perfusion, perfusion rate is 1.5～4ml/min.Microscopically is observed, and the good cell of selection mode is as detected object.Corresponding cell is selected region of interest (ROI), as real-time monitored object.Fluorescence with 340nm and 380nm excites respectively.Per second writes down the F340/F380 fluorescence ratio image of a width of cloth ROIs.The F340/F380 fluorescence ratio is represented the concentration of intracellular calcium.Experimental data is carried out record by TILLVISION software, imports at last to carry out data analysis in the Excel form.The result is referring to accompanying drawing 8.The result shows, 2mM H ₂O ₂[the Ca of remarkable rising CHO ²⁺] _i, but the cell after the processing of use reorganization Trx-TAT-hMsrA fusion rotein, its [Ca ²⁺] _iThe rising amplitude significantly is lower than contrast, and prompting reorganization Trx-TAT-hMsrA fusion rotein can reduce the calcium ion overload that oxidation causes.

The present invention is cleverly with TAT albumen transfer system and humanized's methionine sulphoxide reductase enzyme hMsrA and sulphur hydrogen reduction albumen Trx formation fusion rotein, having overcome in the past, these macromolecular enzymes can not enter intracellular shortcoming, their new functions have been given, make them can stride across stopping of cytolemma, in cell, bring into play anti-oxidant function.The easiest oxidized cysteine residues (cysteine in the protein, Cys) and methionine(Met) (methionine, Met) residue can be reduced by sulphur hydrogen reduction albumen Trx and humanized's methionine sulphoxide reductase enzyme hMsrA respectively, thus the damage that opposing ROS oxyradical causes neurocyte.Experiment confirm of the present invention, fusion rotein provided by the invention has provide protection to neural cell injury, can be used for the medicine of preparation treatment neural system major disease (comprising parkinsonism, ischemic brain injury, senile dementia, vascular dementia etc.).

Description of drawings

Fig. 1: the structure of reorganization Trx-TAT-hMsrA fusion protein expression vector; Fig. 1 reflection be, the position that Tat-hMsrA inserts, between the BamHI and XhoI restriction enzyme site of expression vector pet32a, Trx albumen is in the front of Tat-hMsrA, between contain the his tag label that purifying is used.

Fig. 2: reorganization Trx-TAT-hMsrA fusion rotein SDS-PAGE coomassie brilliant blue staining result of supernatant liquor behind the abduction delivering in BL21 (DE3) expression strain; Fig. 2 reflection be, reorganization Trx-TAT-hMsrA fusion rotein in BL21 (DE3) expression strain behind the abduction delivering, the result of supernatant liquor SDS-PAGE coomassie brilliant blue staining.Among the figure, M represents protein molecular weight Marker; 1,3: added white protein on the bacterial strain of recombinant protein inductor IPTG; 2,4: do not add white protein on the bacterial strain of recombinant protein inductor IPTG.

Fig. 3: the SDS-PAGE coomassie brilliant blue staining result of reorganization Trx-TAT-hMsrA fusion rotein behind the purifying; What Fig. 3 reflected is the result of the recombinant protein SDS-PAGE coomassie brilliant blue staining before and after the purifying.Among the figure, M represents protein molecular weight Marker; 1: represent the preceding bacterial strain supernatant total protein of purifying; 2: representative strain supernatant total protein is through the product behind purifying; 3: representative strain supernatant total protein is through the product behind twice purifying; 4: representative strain supernatant total protein is through the product behind three purifying.

Fig. 4: the Western Blotting result of reorganization Trx-TAT-hMsrA fusion rotein behind the purifying; What Fig. 4 reflected is the result that the recombinant protein Western Blotting behind the purifying detects.Among the figure, 1: represent the positive control cerebral tissue to extract the expression of MsrA in the albumen; 2: the MsrA antigenicity of representing recombinant protein behind the purifying.

Fig. 5: reorganization Trx-TAT-hMsrA fusion rotein wears the film activity qualification result behind the purifying; What Fig. 5 reflected is that the recombinant protein behind the purifying sees through the ability of Chinese hamster ovary celI.Among the figure, 1: the Chinese hamster ovary celI that representative is handled without recombinant protein; 2: the Chinese hamster ovary celI that representative is handled through recombinant protein.

Fig. 6: reorganization Trx-TAT-hMsrA fusion rotein is for the provide protection of oxidative stress neural cell injury behind the purifying; What Fig. 6 reflected is that the recombinant protein behind the purifying causes the provide protection of SH-SY5Y neural cell injury for oxidative stress.Among the figure, 1: the cell survival rate of representing normal SH-SY5Y neurocyte; 2: represent the oxygenant modeling to handle the cell survival rate of back model group; 3: represent the cell survival rate after the recombinant protein (5nM) of high density is handled back oxidizer modeling; 4: represent the cell survival rate after the recombinant protein (0.5nM) of lower concentration is handled back oxidizer modeling.

Fig. 7: reorganization Trx-TAT-hMsrA fusion rotein causes the provide protection of neural cell injury behind the purifying for parkinsonism related pathologies factor MPP; Fig. 7 reflection be the provide protection of the cell injury that the recombinant protein behind the purifying causes for MPP.Among the figure, 1: the cell survival rate of representing normal SH-SY5Y neurocyte; 2: represent MPP to handle the cell survival rate of back model group; 3: add the cell survival rate after the MPP modeling after representing the recombinant protein (5nM) of high density to handle; 4: add the cell survival rate after the MPP modeling after representing the recombinant protein (0.5nM) of lower concentration to handle.

Fig. 8: reorganization Trx-TAT-hMsrA fusion rotein causes the provide protection of cell calcium overload behind the purifying for oxidation; What Fig. 8 reflected is the provide protection that the Chinese hamster ovary celI calcium ion that the recombinant protein behind the purifying causes for oxidation overloads.Among the figure, 1: represent oxidation to cause the result of calcium ion overload on the normal Chinese hamster ovary celI; 2: represent recombinant protein (5nM) to handle the result that rear oxidation causes calcium ion overload on the normal Chinese hamster ovary celI.340/380 Ratio value is represented free calcium ion concentration in the born of the same parents.

Embodiment

Embodiment 1 preparation fusion rotein of the present invention

1. the structure of reorganization Trx-TAT-hMsrA fusion protein expression vector

The carrier collection of illustrative plates that makes up is seen accompanying drawing 1.

The detailed step of vector construction:

(1). order-checking: the Pcmv-XL4 carrier (Beijing YiXin Industry Science and Technology Ltd.) that contains the hMsrA gene, giving Beijing AudioCodes biotechnology limited liability company checks order, the MsrA gene of humanized in sequencing result and the gene pool is consistent, shows that this plasmid can use.

(2). design primer: for the hMsrA gene is extracted from the Pcmv-XL4 carrier, changing to the pet32a carrier gets on, with BamHI and XhoI is restriction enzyme site, design a pair of primer, and on the primer of design, add the Tat sequence, 5 ' terminal sequence: 5-CGCGGATCCGGTTACGGTCGTAAGAAACGTAGACAGCGCAGACGTGGTCGCCCT CCCATGCTCTCGGC-3;

3 ' terminal sequence:

5-CCGCTCGAGTTATTTTTTAATACCCACTGGGCAGGACACGC-3，

It is synthetic to give Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

(3) .PCR: after primer is sent here, owing to be pulverous, volatilization easily, the centrifugal 13000rpm of elder generation, 1min allows primer deposit, and the ddH2O of sterilization is provided by the method that provides on the synthetic report.Use the PCR instrument of Bio-Rad to increase, the PCR system comprises 7 samples: { template: 0.6ul, 0.37ug/ul; Primer up:0.5ul; Primer down:0.5ul; Pfu:1ul; DNTP:4ul; Pfu buffer:5ul; H2O:38.4ul}.The program setting of PCR: { initial sex change: 3min, 95 ℃; Sex change: 30s, 94 ℃; Annealing: 30s, 54 ℃; Extend: 1min, 72 ℃; Circulation: 29 times; The final extension: 10min, 72 ℃; At last: 8 ℃, forever}.PCR carries out electrophoresis after finishing, and identifies whether PCR is successful: { first swimming lane: DNA ladder; Second swimming lane: PCR sample.Electrophoretic program setting: 100V, 35min, after electrophoresis finished, with gel imaging instrument observations, seeing did not have very bright purpose band, the correct position of purpose band carries out next step }.

(4) the .PCR product reclaims: correct purpose band is cut with a knife, reclaim test kit specification sheets (sky, Beijing root biochemical technology company limited) by gel and carry out the gel recovery.

(5). enzyme is cut: enzyme is cut and is comprised that purpose fragment Tat-MsrA enzyme is cut with carrier pet32a enzyme and cut.The purpose fragment enzyme system of cutting comprises: { purpose fragment (50ul): 36ul, 0.25ug/ul; BamHI:0.5ul; XHOI:0.5ul; BSA:0.5ul; NEbufferIII:5ul; H2O:7.5ul}.The carrier enzyme system of cutting comprises: { carrier: 15ul, 0.37ug/ul; BamHI:0.5ul; XHOI:0.5ul; XHOI:0.5ul; BSA:0.5ul; NEbufferIII:5ul; H2O:35.5ul}.The enzyme tangent condition is 37 ℃, 12h.

(6). enzyme cuts back to close: the purpose fragment is PCR and is reclaimed, and carrier is done gel and reclaimed, and recovery method is undertaken by test kit specification sheets (sky, Beijing root biochemical technology company limited).

(7). connect: { linked system comprises: carrier: 4ul; Goal gene: 3ul; T4 ligase enzyme: 1ul; T4buffer:1ul; H2O:1ul} placed 7 hours for 16 ℃; Placed 9 hours for 4 ℃.

(8). transform: take out from-70 ℃ of refrigerators and experience peptide trans 5 α (the triumphant victory in Wuhan is biological), seal heat, make it to thaw rapidly with hand, approximately 10min draws the adding of 10ul connection plasmid with liquid-transfering gun and experiences peptide, flicks mixing with finger, put 4 ℃ of about 30min of refrigerator, taking-up contains Amp ⁺The 2YT culture plate, be coated on the plank experiencing peptide, on super clean bench, operate, put into 37 ℃ incubator 14h.

(9). shake bacterium: 12 reasonable bacterium colonies of rising trend of picking are in the pipe of 12 15ml in the culture plate to clamp the lancet head with tweezers, and every pipe has had adding of the 3-4ml liquid nutrient medium of Amp+ at 37 ℃, shook in the shaking table of 280rpm 14 hours.

(10). plasmid extracts in a small amount: the operation instructions of extracting test kit by plasmid is in a small amount operated, and runs agarose gel electrophoresis behind the extraction plasmid, and deposition condition is: 108V, 55min, whether the preliminary evaluation goal gene connects up.

(11). enzyme is cut evaluation: the enzyme of doing of choosing 3 band correct positions in the electrophoresis result of extracting in a small amount from plasmid is cut evaluation, and 37 ℃, the 3h enzyme is cut, electrophoresis then, observe whether the purpose band is arranged,, show that connection may success if the purpose band of size, correct position is arranged.

(12). order-checking: cut the correct order-checking of picking in the result of evaluation from enzyme, forward uses sequencing primer T7, oppositely uses T7ter, and sequencing result comes out, use software DNAssist to carry out sequence assembly after, sequence is correct, the molecule construction success.The nucleotide sequence of coding reorganization Trx-Tat-hMsrA fusion rotein is shown in SEQ ID NO:2.

2. reorganization integration and the abduction delivering of Trx-TAT-hMsrA antigen-4 fusion protein gene in the BL21 expression strain

With containing the proteic recombinant plasmid transformed e. coli bl21 of Trx-TAT-hMsrA (Wuhan life technology company limited) expression strain, coating contains the LB agar plate of penbritin, and 37 ℃ of constant temperature culture are spent the night, and grow better bacterium colony on the flat board.The positive bacterium colony of picking is seeded in the LB test tube that 10ml contains amicillin resistance, and 37 ℃, 280rmin, thermal agitation overnight incubation.Spend the night in 1: 100 ratio inoculation next day, culture contains in the LB test tube of penbritin (containing whole mass concentration is 50mgL) resistance in 200mL, being cultured to OD600nm in 37 ℃ of thermal agitations is 0.6-0.8, dividing equally this culture is two portions, a part add isopropyl ss thiogalactoside (IPTG) to final concentration be 1mmolL with abduction delivering, another part does not add IPTG and compares, and continues to cultivate 4h, 4 ℃, 12000rmin.Centrifugal 15min results thalline, 1L add the resuspended thalline of 50mL binding buffer liquid (20mmol/LTris.HCl, pH 7.9 for 5mmol/L imidazoles, 500mmol/LNaCl), add PMSF, carrying out ultrasonic bacteria breaking (pulse:10s, 10s under the ice bath state then at 1: 1000; Amp:60%; Timer:16min), after the abundant fragmentation of ultrasonic wave, 4 ℃, behind the centrifugal 20min of 12000r/min, then fusion rotein is present in the supernatant with natural, soluble form.Decide protein concentration, collect and respectively to organize sample, by 4: 1 volumes (sample: sample-loading buffer) with the abundant mixing of 5 * sample-loading buffer after, heat inactivation 5min in the boiling water.Each sample of getting same protein amount (20 μ g) carries out the SDS-PAGE electrophoretic analysis.According to prescription in the table one, preparation SDS-polyacrylamide gel (SDS-PAGE).According to prescription in the table two, the preparation electrophoretic buffer.

Table one

	Separation gel (10%)	Concentrate glue (4%)
			Ultrapure water (ml)	3.2	?2.4
1.5M?Tris(8.8)(ml)	2.7	?0.615
			30％Acry/bis(ml)	2	?0.5
10％SDS(μl)	80	?40
			TEMED(μl)	80	?40

10％APS(μl)	3.2	?4
			Cumulative volume:	8(ml)	?4(ml)

Table two

Reagent	Concentration	Configuration (500ml)
			?Tris-base	25mM(pH8.3)
Glycine	200mM
			?SDS	0.1％
Ultrapure water		Be settled to 500ml after the dissolving

Every swimming lane adds equal protein (general about 20 μ g), and 100V voltage is through SDS-polyacrylamide gel (SDS-PAGE) electrophoretic separation 120min.After electrophoresis finishes, behind coomassie brilliant blue R250 dyeing 40min, with the destainer that contains 10% Glacial acetic acid and 10% methyl alcohol decolour to background colourless till, contrast through albumen marker, with do not add IPTG inductive contrast and compare, discovery has a large amount of Trx-TAT-hMsrA expressing fusion proteins near 45KD.Referring to accompanying drawing 2.

3. the purifying of reorganization Trx-TAT-hMsrA fusion rotein

Supernatant changed over to Ni is housed ²⁺In the chromatography column of-NTA resin (qiagen company), after finishing, last sample leaves standstill 2h, so that Ni in the label of 6 Histidines and the filler ²⁺Fully combination is collected.Ni-NTA fast startkit specification sheets in strict accordance with QIAGEN company adds wash buffer, collects.Add Elute buffer, collect.Carry out mark, the capable SDS-PAGE electrophoresis of all collection liquid (method is with embodiment 2), after electrophoresis finishes, behind coomassie brilliant blue R250 dyeing 40min, with the destainer that contains 10% Glacial acetic acid and 10% methyl alcohol decolour to background colourless till, through albumen marker contrast, can draw the relative molecular mass of target protein.The result is referring to accompanying drawing 3.As seen obviously eliminated nearly all foreign protein behind the purifying.Carry out centrifugally concentrating that (2000rpm, 15min), after the filter membrane degerming of the fusion rotein of purifying with 0.22 μ m ,-20 ℃ of preservations are standby with the albumen evaporating pipe of Millipore.

It below is the aminoacid sequence table that the present invention relates to.

The sequence signature of SEQ ID NO:1:

(A) length: 416 amino acid

(B) type: amino acid

(C) chain: strand

(D) topology: linearity

The sequence signature of SEQ ID NO:2:

(A) length: 1248 bases

(B) type: nucleic acid

(C) chain: strand

(D) topology: linearity

Sequence table

＜110〉Central China University of Science and Technology

＜120〉reorganization Trx-TAT-hMsrA fusion rotein and the application aspect neurocyte protection thereof

<130>/

<160>4

<170>PatentIn?version?3.5

<210>1

<211>416

<212>PRT

＜213〉artificial

<400>1

Met?Ser?Asp?Lys?Ile?Ile?His?Leu?Thr?Asp?Asp?Ser?Phe?Asp?Thr?Asp

1 5 10 15

Val?Leu?Lys?Ala?Asp?Gly?Ala?Ile?Leu?Val?Asp?Phe?Trp?Ala?Glu?Trp

20 25 30

Cys?Gly?Pro?Cys?Lys?Met?Ile?Ala?Pro?Ile?Leu?Asp?Glu?Ile?Ala?Asp

35 40 45

Glu?Tyr?Gln?Gly?Lys?Leu?Thr?Val?Ala?Lys?Leu?Asn?Ile?Asp?Gln?Asn

50 55 60

Pro?Gly?Thr?Ala?Pro?Lys?Tyr?Gly?Ile?Arg?Gly?Ile?Pro?Thr?Leu?Leu

65 70 75 80

Leu?Phe?Lys?Asn?Gly?Glu?Val?Ala?Ala?Thr?Lys?Val?Gly?Ala?Leu?Ser

85 90 95

Lys?Gly?Gln?Leu?Lys?Glu?Phe?Leu?Asp?Ala?Asn?Leu?Ala?Gly?Ser?Gly

100 105 110

Ser?Gly?His?Met?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro

115 120 125

Arg?Gly?Ser?Gly?Met?Lys?Glu?Thr?Ala?Ala?Ala?Lys?Phe?Glu?Arg?Gln

130 135 140

His?Met?Asp?Ser?Pro?Asp?Leu?Gly?Thr?Asp?Asp?Asp?Asp?Lys?Ala?Met

145 150 155 160

Ala?Asp?Ile?Gly?Ser?Gly?Tyr?Gly?Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg

165 170 175

Arg?Gly?Arg?Pro?Pro?Met?Leu?Ser?Ala?Thr?Arg?Arg?Ala?Cys?Gln?Leu

180 185 190

Leu?Leu?Leu?His?Ser?Leu?Phe?Pro?Val?Pro?Arg?Met?Gly?Asn?Ser?Ala

195 200 205

Ser?Asn?Ile?Val?Ser?Pro?Gln?Glu?Ala?Leu?Pro?Gly?Arg?Lys?Glu?Gln

210 215 220

Thr?Pro?Val?Ala?Ala?Lys?His?His?Val?Asn?Gly?Asn?Arg?Thr?Val?Glu

225 230 235 240

Pro?Phe?Pro?Glu?Gly?Thr?Gln?Met?Ala?Val?Phe?Gly?Met?Gly?Cys?Phe

245 250 255

Trp?Gly?Ala?Glu?Arg?Lys?Phe?Trp?Val?Leu?Lys?Gly?Val?Tyr?Ser?Thr

260 26 5270

Gln?Val?Gly?Phe?Ala?Gly?Gly?Tyr?Thr?Ser?Asn?Pro?Thr?Tyr?Lys?Glu

275 280 285

Val?Cys?Ser?Glu?Lys?Thr?Gly?His?Ala?Glu?Val?Val?Arg?Val?Val?Tyr

290 295 300

Gln?Pro?Glu?His?Met?Ser?Phe?Glu?Glu?Leu?Leu?Lys?Val?Phe?Trp?Glu

305 310 315 320

Asn?His?Asp?Pro?Thr?Gln?Gly?Met?Arg?Gln?Gly?Asn?Asp?His?Gly?Thr

325 330 335

Gln?Tyr?Arg?Ser?Ala?Ile?Tyr?Pro?Thr?Ser?Ala?Lys?Gln?Met?Glu?Ala

340 345 350

Ala?Leu?Ser?Ser?Lys?Glu?Asn?Tyr?Gln?Lys?Val?Leu?Ser?Glu?His?Gly

355 360 365

Phe?Gly?Pro?Ile?Thr?Thr?Asp?Ile?Arg?Glu?Gly?Gln?Thr?Phe?Tyr?Tyr

370 375 380

Ala?Glu?Asp?Tyr?His?Gln?Gln?Tyr?Leu?Ser?Lys?Asn?Pro?Asn?Gly?Tyr

385 390 395 400

Cys?Gly?Leu?Gly?Gly?Thr?Gly?Val?Ser?Cys?Pro?Val?Gly?Ile?Lys?Lys

405 410 415

<210>2

<211>1248

<212>DNA

＜213〉artificial

<400>2

atgagcgata?aaattattca?cctgactgac?gacagttttg?acacggatgt?actcaaagcg 60

gacggggcga?tcctcgtcga?tttctgggca?gagtggtgcg?gtccgtgcaa?aatgatcgcc 120

ccgattctgg?atgaaatcgc?tgacgaatat?cagggcaaac?tgaccgttgc?aaaactgaac 180

atcgatcaaa?accctggcac?tgcgccgaaa?tatggcatcc?gtggtatccc?gactctgctg 240

ctgttcaaaa?acggtgaagt?ggcggcaacc?aaagtgggtg?cactgtctaa?aggtcagttg 300

aaagagttcc?tcgacgctaa?cctggccggt?tctggttctg?gccatatgca?ccatcatcat 360

catcattctt?ctggtctggt?gccacgcggt?tctggtatga?aagaaaccgc?tgctgctaaa 420

ttcgaacgcc?agcacatgga?cagcccagat?ctgggtaccg?acgacgacga?caaggccatg 480

gctgatatcg?gatccggtta?cggtcgtaag?aaacgtagac?agcgcagacg?tggtcgccct 540

cccatgctct?cggccacccg?gagggcttgc?cagctcctcc?tcctccacag?cctctttccc 600

gtcccgagga?tgggcaactc?ggcctcgaac?atcgtcagcc?cccaggaggc?cttgccgggc 660

cggaaggaac?agacccctgt?agcggccaaa?catcatgtca?atggcaacag?aacagtcgaa 720

cctttcccag?agggaacaca?gatggctgta?tttggaatgg?gatgtttctg?gggagctgaa 780

aggaaattct?gggtcttgaa?aggagtgtat?tcaactcaag?ttggttttgc?aggaggctat 840

acttcaaatc?ctacttataa?agaagtctgc?tcagaaaaaa?ctggccatgc?agaagtcgtc 900

cgagtggtgt?accagccaga?acacatgagt?tttgaggaac?tgctcaaggt?cttctgggag 960

aatcacgacc?cgacccaagg?tatgcgccag?gggaacgacc?atggcactca?gtaccgctcg 1020

gccatctacc?cgacctctgc?caagcaaatg?gaggcagccc?tgagctccaa?agagaactac 1080

caaaaggttc?tttcagagca?cggcttcggc?cccatcacta?ccgacatccg?ggagggacag 1140

actttctact?atgcggaaga?ctaccaccag?cagtacctga?gcaagaaccc?caatggctac 1200

tgcggccttg?ggggcaccgg?cgtgtcctgc?ccagtgggta?ttaaaaaa 1248

<210>3

<211>68

<212>DNA

＜213〉artificial

<400>3

cgcggatccg?gttacggtcg?taagaaacgt?agacagcgca?gacgtggtcg?ccctcccatg 60

ctctcggc 68

<210>4

<211>41

<212>DNA

＜213〉artificial

<400>4

ccgctcgagt?tattttttaa?tacccactgg?gcaggacacg?c 41

Claims

1. reorganization Trx-Tat-hMsrA fusion rotein, it is characterized in that: sequence is shown in SEQ ID N0:1.

2. the nucleotide sequence of the described reorganization of the claim 1 of encoding Trx-Tat-hMsrA fusion rotein, it is characterized in that: sequence is shown in SEQ ID NO:2.

3. reorganization Trx-Tat-hMsrA fusion rotein according to claim 1, it is characterized in that: the 1-109 amino acids is a Trx albumen in the reorganization Trx-Tat-hMsrA fusion rotein, the 110-165 amino acids is a connection peptides, the 166-179 amino acids is a TAT albumen, and the 180-416 amino acids is a hMsrA albumen.

4. claim 1 or the application of 3 described reorganization Trx-Tat-hMsrA fusion roteins in preparation treatment neural system major disease medicine.

5. the application of reorganization Trx-Tat-hMsrA fusion rotein according to claim 4 in preparation treatment neural system major disease medicine, it is characterized in that described neural system major disease is parkinsonism, Alzheimer syndromes, ischemic brain injury or vascular dementia.