CN101974083A

CN101974083A - Humanized HIRRP (HSV-1 Infection Related Repress) protein molecule for resisting HSV1 virus infection

Info

Publication number: CN101974083A
Application number: CN2010105124360A
Authority: CN
Inventors: 李琦涵; 吴练秋; 刘龙丁; 董承红; 王丽春; 王晶晶; 赵红玲; 纳锐雄; 梁燕; 张雪梅; 张莹; 廖芸
Original assignee: Institute of Medical Biology of CAMS and PUMC
Current assignee: Institute of Medical Biology of CAMS and PUMC
Priority date: 2010-10-20
Filing date: 2010-10-20
Publication date: 2011-02-16

Abstract

The invention discloses an HIRRP (HSV-1 Infection Related Repress) protein molecule with risen expression in a cell after selecting a new virus infection cell from a difference protein expression spectrum of HSV1 virus infection liver L02 cell and a preparation method thereof. The protein molecule is successfully cloned from a liver cell cDNA library. Besides, the invention discovers that the HIRRP protein molecule has specific biological function for resisting HSV1 virus for the first time, and the effective function structural domain of the HIRRP protein is located at the N tail end of the molecule. The research result provides new thought and target for anti-virus prevention and treatment.

Description

The people source HIRRP protein molecular of anti-HSV1 virus infection

Technical field

The invention belongs to the technical field of human application foundation medical science, specifically, the present invention relates to a kind of new antiviral protein HIRRP gene; More particularly, the present invention relates to people's source protein molecule HIRRP, the cDNA full-length clone of anti-HSV1 virus infection, and it is determined in HSV1 virus and the function in the cell interaction process.Simultaneously, the present invention also defines the possible functional domain of this HIRRP albumen.

Background technology

Simplexvirus is that a class formation is extremely complicated, infectious form is various and can causes the dna virus of kinds of clinical pathological effect.The research of this class dna virus biological behavior in preclinical medicine and clinical medicine all is subjected to people's common concern all the time, has important molecular biology, cytobiology and clinical medicine meaning.The general median size of volume of herpetoviridae (Herpesviridae) virion is covered with coating outward, and is very extensive in natural distribution, identified or part is identified that kind more than 100 is arranged approximately.Herpes simplex virus I-type (HSVI) is a kind of stronger communicable pathogenic agent that has, and is found the earliest simplexvirus, also is to be studied one of the most deep virus at present.HSVI can infect the broad variety cell, many research evidences show, during the HSVI host cells infected, a need contacts by virus membrane antigen and cell surface molecule, just can cause the activation of some cell signal path in the infected cell and the activation of specific transcription factor.In the research of HSVI and cell interaction, one of emphasis of work is to analyze significance and the specific function that the coded differential protein of differential gene is had in virus infected cell.Compare with gene, proteinic structure is more complicated, function is more active, more near the essence of life.The differential protein molecule that occurs in the virus infected cell is the executive of specific function in HSVI and the host cell interaction process.The invasion of HSVI virus has changed the protein expression profiles of host cell, a large amount of protein moleculars are set up new balance each other, and produce the molecular basis of a series of cytological effects in the infected just cell of these albumen, study them and associated cell signal path will help being familiar with virus infection mechanism.

Previous work of the present invention, by technology platform by the comparison protein group, with people's normal liver cell L02 of HSVI virus infection with do not infect the L02 cell and carry out 2-DE respectively and make the protein picture group, to protein urine, quantitative analysis, utilize MALDI-TOF-MS to identify differential protein by PDQuest software again.HIRRP albumen is promptly through one of above 2-DE protein diversity electrophoresis identifies, cell inner expression obviously raises behind the virus infection protein molecular, but people almost are " zero " to its understanding instantly, also are in the news without any the research work about the HIRRP protein function at present.HIRRP be protein function the unknown new albumen, be expressing quantity obviously increases behind the HSVI virus infection L-02 cell new albumen, be under the virus infection state, to be activated and new albumen that may be relevant with virus-cell interaction.To the expansion of the new protein molecular research work of this Unknown Function, not only help illustrating the function of biomacromolecule in the cell, also help simultaneously to strengthen to the understanding of virus with the host cell interphase interaction; Not only can promote virus infection, duplicate and the understanding of the molecule mechanism of curing the disease, can also provide new thinking and clue for the prevention and the treatment of virus.

Summary of the invention

One of purpose of the present invention provides the people source HIRRP protein molecular that cell inner expression raises behind a kind of new, virus infected cell.

Two of purpose of the present invention provides the preparation method of described people source HIRRP protein molecular.

Three of purpose of the present invention provides a kind of clone's HIRRP gene and carries out the proteic expression of HIRRP and prepare sero-fast method.

Four of purpose of the present invention is to disclose the effective efficiency structure of described people source HIRRP protein molecular.

Five of purpose of the present invention provides the biological function and the purposes of described people source HIRRP protein molecular.

Purpose of the present invention is achieved by following technical proposals.

* except as otherwise noted, the percentage ratio that is adopted among the present invention is mass percent.

A the invention provides the HIRRP protein molecular that cell inner expression raises behind a kind of new, virus infected cell

People provided by the present invention source HIRRP egg molecule has SEQ ID № in the sequence table: SEQ ID № in 1 described nucleotide sequence and the sequence table: 2 described aminoacid sequences.

B. the invention provides the preparation method of described people source HIRRP protein molecular, this method adopts following sequential steps:

(1) specimen preparation: HSV1 collects the L02 cell that infects back and uninfecting virus respectively and presses test kit manipulation cell sample (Promega company) after infecting 24h;

(2) two-dimensional electrophoresis (Two dimension Gel Electrophoresis, 2-DE).Extract total protein of cell 300 μ g respectively as applied sample amount, aquation sample-loading buffer 350 μ l swelling IPG adhesive tape.The focusing electrophoresis program is: 50V, initiatively aquation 16h; After desalination, the process of boosting, 10000V focuses on 60000 volts hours.After focusing is finished, balance 15min in balance liquid respectively.Adhesive tape is transferred to 12%S S2PAGE glue upper end, carries out second to protein separation.With low voltage 70V electrophoresis 30min, boosted voltage treats to stop when tetrabromophenol sulfonphthalein reaches bottom margin electrophoresis to 180V afterwards when initial.After electrophoresis is finished, 22DE glue is carried out silver dye.Adopt the projection scan pattern to carry out IMAQ, and utilization PDQuest professional software analyzing proteins differential expression point;

(3) biological mass spectrometry analysis: finish protein site cut and mass spectrum is identified, the MALDI-TOF-MS mass spectrum is identified by last sea base health biotech firm and is finished.The peptide finger printing PMF and the Matrixscience database of gained protein site are compared, and finish retrieval by Mascot software;

(4) the HIRRP molecule is and expresses the differential protein that raises in the HSV1 infected cell.

C. the invention provides a kind of clone's HIRRP gene and carry out the proteic expression of HIRRP and prepared sero-fast method, this method adopts following steps:

(1) extract cell total rna behind the HSV1 virus infection people L02 cell, and reverse and to be cDNA, operation steps sees the test kit explanation for details.With the high-fidelity enzyme pcr amplification goal gene hirrp of TAKARA company, obtain the amplified production that length is 630bp.

(2) with specificity upstream and downstream primer amplification HIRRP full-length molecule, and successfully make up prokaryotic expression carrier pGEX-HIRRP,, obtained the total length expressed albumen of HIRRP by process IPTG abduction delivering in e. coli bl21 (DE3).Further go up cleer and peaceful inclusion body in the separating thallus and show that the expression contents of HIRRP in inclusion body is very high.After cutting glue purification, obtain purity higher H IRRP inclusion body protein; Be used for immune mouse and prepare the HIRRP mouse resisting anteserum.

(3) the sero-fast detection of specificity HIRRP: extract the Vero cell protein of transfection pcDNA3-HIRRP plasmid, the protein band that the HIRRP mouse resisting anteserum can specific recognition 23KD; And, fail to detect the HIRRP protein band for the cell sample of transfection pcDNA3 empty plasmid only.

D. the present invention's functional domain of having disclosed the HIRRP molecule first is positioned at N-terminal, and it adopts following step:

In HSV1 virus integral level the proteic functional domain of HIRRP is detected.Experiment is respectively with pcDNA3, pcDNA3-HIRRP-N and three kinds of plasmids difference of pcDNA3-HIRRP-C transfection Vero cell, 24h after the transfection, inoculation HSVI (MOI=01), 24h, 36h and 48h collect sample and detect the HSVI virus titer by the PFU method behind the virus infection.The plaque forming unit experimental implementation as follows.

E. the invention provides the biological function and the purposes of described people source HIRRP protein molecular.

The present invention has disclosed described HIRRP protein molecular HSV1 virus has been had inhibit feature, and it is verified from different levels by following experimental procedure:

(1) E.C. 2.3.1.28 CAT reporter gene analytical method is being transcribed the water discovery: HIRRP has retarding effect to the transcriptional activity of viral important gene promotor;

When the Vero cell in 6 orifice plates grows to 60%--70% and converges, with Lipofectamine 2000 pcDNA3-HIRRP of transfection CAT reporter gene expression plasmids (pCAT-α 4, pCAT-TK, pCAT-gC enhancer) and various dose respectively.Other only establishes that transfection pcDNA3 and CAT reporter gene expression plasmid contrast as background, simultaneously the error that produced as internal reference control transfection efficiency difference of the pSV-β-Galactosidase of every hole transfection equivalent.Carry out CAT activation analysis and β-gal determination of activity behind the transfection 40h.The CAT activity value of background contrast is considered as 100, obtains the CAT relative reactivity value of each experimental group respectively.β-gal the activity value of background contrast is considered as 100, obtains the β-gal relative reactivity value of each experimental group respectively;

(2) the real-time quantitative PCR method detects: the HIRRP molecular energy of high expression level suppresses the expression of HSV1 virus three phase gene mRNAs;

When the L02 cell in 6 orifice plates grows to 80%--90% and converges, with MOI=01 inoculation HSVI virus, the 0h behind virus inoculation, 1h, 2h, 4h, 6h, 8h, 10h, 12h, 24h, 36h receives sample.Extract total RNA of each sample different time points by total RNA extraction reagent box operation instructions.According to reverse transcription test kit operation instructions, it is cDNA that each sample reverses 2ugRNA, frozen in-20 ℃ of refrigerators.Each time point all establish do not infect HSVI cell sample in contrast.With cDNA is template, respectively with the upstream and downstream primer amplification goal gene of ICP0, TK, gC, gB and confidential reference items β-actin.Use Real MasterMix (sybrgreen) PCR system to increase, the amplification parameter: 95 ℃, 3min; 95 ℃, 10sec; 56 ℃, 10sec; 68 ℃, 40sec; 35cycles.The solubility curve condition is: 95 ℃, and 15sec; 60 ℃, 1min; 95 ℃, 15sec; Final data lg2 ^{-Δ Δ CT}Carrying out relative quantification handles.

(3) plaque forming unit PFU method confirms: the HIRRP molecule of high table can produce restraining effect in the live virus integral level to HSV1, shows as the decline of HSV1 virus titer, and the plaque forming unit number reduces; Otherwise the Knock down of HIRRP molecule then can reverse the retarding effect of HIRRP molecule to HSV1 virus, shows as the rising of virus titer.

It is fashionable that Vero cell in 6 orifice plates grows to 60%-70%, with 4 μ g pcDNA3 and 4 μ g pcDNA3-HIRRP plasmids difference transfection Vero cell, after cultivating 24h, HSV-1 is with the MOI=0.01 vero cells infection, collect viral sample (together with cell and nutrient solution) at metainfective 12h, 24h, 36h, 48h under with strict aseptic technique respectively, be used for the plaque forming unit test.The viral sample of being collected should be avoided multigelation.

The proposition of technical solution of the present invention is based on following thinking:

1 current comparison protein group has extensively been applied to tumour, pathogenic bacteria, and chemistry, physics, biotic factor are intervened research fields such as cell activities.Its purpose is to seek differential protein, by the relatively overall dynamics variation of different spaces, different time protein group, obtain the different information of protein expression quantity, expression level and decorating state between the different proteins group, and then the discovery specific protein relevant with pathology.These specific proteins are not only given a clue for the study of disease pathogenesis, and can be used as the biomarker of medical diagnosis on disease.Studies have shown that in a large number, the virus infection host cell can influence the building-up process of cell protein, the variation of a lot of not only appearance amounts of albumen, its decorating state and functional localization all have abnormal change, a lot of differential protein spots appear in the meeting of comparing with Normocellular protein expression profiles, and these differential proteins specific actor of virus infected cell, cytophylaxis virus just seeks these albumen and the mutual relationship explored between them will provide a large amount of research clues to understanding virus infection and prediction cells infected final result.

2 is present, and the comparison protein group is combined with virusology becomes one of interactional important means of understanding virus-host.(Two-dimension Gel Electrophoresis is the core technology of proteomics research with biological mass spectrometry 2-DE) to bidirectional electrophoresis technique.Along with proteomics moves to maturity gradually, its investigative technique is constantly innovation also.Other two kinds of soft ionization mass-spectrometric techniques---electrospray ionization mass spectrometry (Electrospray Ionization Mass Spectrometry, ESI-MS) and ground substance assistant laser desorption ionization flight time mass spectrum (Matrix-Assisted Laser-desorption Ionization Time of FlightMass Spectrometry, MALDI-TOF-MS) appearance has been introduced identification of proteins with mass spectrum again, and especially the utilization of MALDI-TOF-MS technology has really realized protein site high-throughput on the glue, large-scale identification and identified.

3. previous work of the present invention, by technology platform by the comparison protein group, with people's normal liver cell L02 of HSVI virus infection with do not infect the L02 cell and carry out 2-DE respectively and make the protein picture group,, quantitative analysis qualitative to protein site by PDQuest software utilize MALDI-TOF-MS to identify differential protein again.In the differential protein of being found, some is acellular viral protein component; Some expresses the protein molecular that reduces or close for infecting the back; Other has some then is to infect the back to express the protein molecular that raises.Common intracellular biomacromolecule behind virus infection, nearly 90% synthetic closing or down-regulated expression, only small part up-regulated.So one of emphasis of the present invention is expressed the new protein molecular that raises after paying close attention to this small part virus infection.

Compared with prior art, the present invention has following beneficial effect:

The present invention is in the process of research virus and cell interaction, and screening obtains cell inner expression raises behind new, the virus infected cell HIRRP protein molecular and with its successful clone from human liver cell cDNA library from the differential protein express spectra behind the HSV1 virus infection people liver L02 cell.In addition, the present invention finds that first the HIRRP protein molecular has the biological function of clear and definite anti-HSV1 virus, and the effective functional domain of HIRRP albumen is positioned at the N-terminal of this molecule.The above gained result of study of the present invention provides new thinking and target spot for antiviral prevention and treatment research, has a good application prospect.

Description of drawings

From description taken in conjunction accompanying drawing given below, technical characterictic of the present invention will be more clear.

The demonstration figure of the discovery of Fig. 1 HIRRP protein molecular; Wherein, 2-DE differential protein electrophoretic method is found the HIRRP molecule.Figure A and C are cell sample panorama and the local figure before the HSVI virus infection; Figure B and D are cell sample panorama and the local figure behind the virus infection.Make comparisons with C figure, the protein molecular " G " of differential expression as seen on D figure, occurred, should be the HIRRP molecule by " G " point.

The clone and the protein expression of Fig. 2 HIRRP molecule, and the demonstration figure of the preparation of specific antisera; Wherein,

Fig. 2 A: HIRRP molecule total length carrier for expression of eukaryon pcDNA3-HIRRP that is cloned and the enzyme of different truncated segment carrier pcDNA3-HIRRP-N and pcDNA3-HIRRP-C are cut the evaluation collection of illustrative plates.

PcDNA3-HIRRP is the band (lane 4) of 630bp through EcoR I and Xho I double digestion.Lane 1 and lane 2 are respectively the C end (390bp) of HIRRP and the enzyme of N end (420bp) is cut the evaluation collection of illustrative plates.Lane 3 be molecular weight standard (Takara, DL2000).

The expression and purification of Fig. 2 B:HIRRP antigenic peptide.Simultaneously, with GST albumen and aseptic PBS immune mouse in contrast, Fig. 2 B.Lane 1 is the molecular weight of albumen standard, represents 14.3KD from down to up respectively, 20.1KD, 29.0KD, 44.3KD, 66.4KD, the protein band of 972KD molecular weight size; The lane 2 BL21 tropina that preceding pGEX-5X-1 empty carrier transforms for IPTG induces is not seen the proteic expression of GST; Lane3 is the BL21 tropina of pGEX-HIRRP recombinant plasmid transformed before IPTG induces, and does not see Expression of Fusion Protein: lane 4 is for after IPTG induces 3 hours, the BL21 bacterium inclusion body protein that the pGEX-5X-1 empty carrier transforms, the as seen proteic expression of GST; Lane 5 is for after IPTG induces 3 hours, the BL21 bacterium inclusion body protein of pGEX-HIRRP recombinant plasmid transformed, and visible molecular weight size is the Expression of Fusion Protein of 49KD; Lane 6 is the HIRRP fusion rotein behind the purifying, arrow indication place.

Fig. 2 C:Western Blot detects the HIRRP antiserum(antisera).Lane 1 is a control group, is the Vero cell protein lysate of transfection pcDNA3 empty plasmid; Lane 2 is an experimental group, is the Vero cell protein split product of transfection pcDNA3-HIRRP recombinant plasmid.IB adopts the HIRRP mouse resisting anteserum to detect, and found that the HIRRP mouse resisting anteserum can specific recognition HIRRP molecule.The HIRRP albumen of expressing under the specific identification transient transfection condition of HIRRP mouse resisting anteserum energy, Fig. 2 C.

Fig. 3 HIRRP protein molecular has the demonstration figure of antivirus action, wherein,

Fig. 3 AHIRRP protein molecular has the retarding effect of transcribing to each phase important gene promotor of HSV1.

Fig. 3 A-a4:HIRRP is inhibited to the transcriptional activity of the upright early gene a4 promotor of HSVI.With 1ug a4CAT reporter gene expression plasmid respectively with the pcDNA3-HIRRP plasmid co-transfection Vero cell of various dose.N＝5

Fig. 3 A-TK:HIRRP is inhibited to the transcriptional activity of HSVI early gene TK promotor.With 1ug TKCAT reporter gene expression plasmid respectively with the pcDNA3-HIRRP plasmid co-transfection Vero cell of various dose.N＝5

Fig. 3 A-gC:HIRRP is inhibited to the transcriptional activity of HSVI late gene gC promotor.With 1ug gCCAT reporter gene expression plasmid respectively with the pcDNA3-HIRRP plasmid co-transfection Vero cell of various dose.N＝5

The rise of Fig. 3 B:HIRRP molecule can suppress the expression of each phase gene mRNA of HSV1 virus.

The high expression level of Fig. 3 B-ICP0:HIRRP can suppress HSVI α gene--the expression of ICP0mRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of the upright early gene ICP0mRNA of HSVI in the certain hour scope, data are by 2 ^{-Δ Δ Ct}Carrying out relative quantification handles.The peak that suppresses appears at infects back 1-2h, and presents certain time sequence.N＝5

The high expression level of Fig. 3 B-TK:HIRRP can suppress the expression of HSVI β gene-TKmRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of HSVI early gene TK mRNA in the certain hour scope, the peak of inhibition appears at infects back 8h.Data are by 2 ^{-Δ Δ Ct}Carrying out relative quantification handles.N＝5

The high expression level of Fig. 3 B-GC:HIRRP can suppress the expression of HSVI γ gene-gCmRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of HSVI late gene gC mRNA in the certain hour scope, data are by 2 ^{-Δ Δ Ct}Carrying out relative quantification handles.The peak that suppresses appears at infects back 8h.N＝5

The high expression level of Fig. 3 B-GB:HIRRP can suppress the expression of HSV1 γ gene-gBmRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of HSVI late gene gB mRNA in the certain hour scope, data are by 2 ^{-Δ Δ Ct}Carrying out relative quantification handles.The peak that suppresses appears at infects back 8h.N＝5。

The high expression level of Fig. 3 C:HIRRP can reduce the virus titer of HSV1, has antiviral effect.

Fig. 3 C-1:HIRRP raises can reduce the HSV1 virus titer.With pcDNA3 empty plasmid and pcDNA3-HIRRP recombinant plasmid difference transfection Vero cell, 24h after the transfection, experimental group and cellular control unit all infect HSV1 (MOI=0.1) simultaneously.Collect the viral level in all cells and the viral supernatant test sample in metainfective 12h, 24h, 36h, 48h.Compare with control group, descending appears in the HSVI titre level of HIRRP transfection group, and it is the most obvious especially to infect back 24h with HSV1, but along with the growth HIRRP of infection time weakens gradually to the restraining effect of HSVI.

Fig. 3 C-2: the expression of downward modulation HIRRP can reverse the retarding effect of HIRRP to the HSVI virus titer.Compare with control group, the HSV1 infected group of transfection hirrp-miRNA3 can reverse the restraining effect of HIRRP to virus to some extent at the metainfective 24h of HSVI, 36h and three time points of 48h.The titre of virus is represented with PFU/ml among the figure, for the plaque in every milliliter of laboratory sample forms number.

The antivirus action of Fig. 4 HIRRP is mainly brought into play the demonstration figure of effect by the N-terminal of HIRRP molecule;

The different truncated segments of HIRRP molecule are to the influence of HSVI virus titer.Form the unit experiment by the divination by means of the milfoil spot and find to compare with the PCDNA3 control group, the terminal truncated segment of HIRRP-N is inhibited to the HSV1 virus activity, and the terminal restraining effect of HIRRP-C then will be weaker than N end protein molecule.Illustrate that the functional domain of HIRRP may mainly be positioned at the N-terminal of HIRRP protein molecular.

Embodiment

In order to make purpose of the present invention, technical scheme and beneficial effect clearer,, the present invention is described in further detail below in conjunction with embodiment and accompanying drawing.Should be appreciated that specific embodiment described herein is only in order to explain the present invention, not in order to limit the present invention.

Embodiment 1

The acquisition methods of-HIRRP protein molecular:

(2) two-dimensional electrophoresis (Two2dimensioD Gel Electrophoresis, 2-DE).Extract total protein of cell 300 μ g respectively as applied sample amount, aquation sample-loading buffer 350 μ l swelling IPG adhesive tape.The focusing electrophoresis program is: 50V, initiatively aquation 16h; After desalination, the process of boosting, 10000V focuses on 60000 volts hours.After focusing is finished, balance 15min in balance liquid respectively.Adhesive tape is transferred to 12%SDS2PAGE glue upper end, carries out second to protein separation.With low voltage 70V electrophoresis 30min, boosted voltage treats to stop when tetrabromophenol sulfonphthalein reaches bottom margin electrophoresis to 180V afterwards when initial.After electrophoresis is finished, 22DE glue is carried out silver dye.Adopt the projection scan pattern to carry out IMAQ, and utilization PDQuest professional software analyzing proteins differential expression point;

(3) biological mass spectrometry analysis: finish protein site cut and mass spectrum is identified, the MALDI-TOF-MS mass spectrum is identified by last sea base health biotech firm and is finished.The peptide finger printing PMF and the MatrixscicDce database of gained protein site are compared, and finish retrieval by Mascot software;

(4) the HIRRP molecule is HSV1 and infects the differential protein (see figure 1) that cell inner expression raises behind the L02 cell.

Experimental result:

(1) by comparing with database datas such as NCBI, the background information that obtains HIRRP is as follows: Gl numbers 16552881; The information biology prediction result is that HIRRP does not have tangible nuclear localization signal, be not limited to specific cell function district in intracellular distribution, not having significant known function structural domain, may have the phosphorylation site of some signaling molecule etc., is the intracellular protein molecule of Unknown Function at present.

(2) measure the SEQ ID № in the sequence table that has of described HIRRP protein molecular: SEQ ID № in 1 described nucleotide sequence and the sequence table: 2 described aminoacid sequences.

(3) the HIRRP information biology is measured

HIRRP (GI:16552881, Unnamed Protein) encoding sequence CDS:630bp

(4) genome location (Genome version:UCSC Build35)

Know the chromosomal localization of HIRRP gene from the genome database of UCSC.

Chromosome No:chr17 (-), i.e. No. 17 karyomit(e)s

Locus?position：71427465..-71417522

(5) information biology is measured

Argine Monohydrochloride sequence: 209aa

Signal peptide prediction (SignalP): point out behind the utilization SignalP software 30 prediction HIRRP protein sequences: its N-end does not have signal peptide.

Subcellular Localization (TargetP): TargetP software (http://www.cbs dtu.dk/services/TargetP/) to location prediction result in the HIRRP cell as the prompting: this albumen does not have specific localization signal peptide, and the distribution in cell is not limited to special cell function district.

Other mensuration: HIRRP albumen may exist 1 cAMP phosphorylation site, 2 PKC phosphorylation sites and 5 CK2 phosphorylation sites.HIRRP albumen result for retrieval in the NCBI-CDD database is: do not find homology between conserved sequence pattern in HIRRP and the present CDD database or the motif.

Embodiment 2

---the clone of HIRRP protein molecular

Method: the HIRRP molecule does not have expression substantially under the base state of cell or physiological level, thus the present invention to adopt 293 cell samples behind the HSV1 virus infection be that template increases.

(1) structure of pcDNA3-HIRRP: with 293 cell cDNAs is amplification template, HIRRP-F and HIRRP-R are the upstream and downstream primer, PCR obtains the proteic hirrp gene of coding HIRRP, is connected into pcDNA3 after EcoRI and XhoI enzyme are cut, and recombinant plasmid is cut and order-checking is identified through enzyme.

F：aatgaattcatggagcggctccgggagc

R：atagtcgacagcctgctctcagcttttg

(2) structure of pcDNA3-HIRRP-N: with pcDNA3-HIRRP is template, pcDNA3-HIRRP-N end F and R are the upstream and downstream primer, PCR obtains the gene of coding HIRRP 1～140aa, is connected into pcDNA3 behind EcoRI and XhoI double digestion, and recombinant plasmid is cut and order-checking is identified through enzyme.

F：aatgaattcatggagcggctccgggagc

R：atactcgagtcactgctcggcagtcacc

(3) structure of pcDNA3-HIRRP-C: with pcDNA3-HIRRP is template, pcDNA3-HIRRP-C end F and R are the upstream and downstream primer, PCR obtains the gene of coding HIRRP 81～210aa, is connected into pcDNA3 behind EcoRI and XhoI double digestion, and recombinant plasmid is cut and order-checking is identified through enzyme

F：aatgaattcatgctggggatccggcagc

R：atactcgagtcagcctgctctcagcttt

The result

Success makes up the eukaryon expression plasmid of HIRRP total length and different truncated segments, shown in Fig. 2 A:

1. pcDNA3-HIRRP construction of recombinant plasmid: PCR obtains the hirrp gene ORF of coding HIRRP, is connected into the pcDNA3 carrier.Through EcoR I and Xho I double digestion is the band of 630bp, confirms successfully to make up pcDNA3-HIRRP recombinant plasmid (lane 4) through two-way order-checking.

2. pcDNA3-HIRRP-N construction of recombinant plasmid: PCR obtains the CDS sequence of the hirrp gene 1-420bp of coding HIRRP, is connected into the pcDNA3 carrier.Through EcoR I and Xho I double digestion is the band of 420bp, confirms successfully to make up pcDNA3-HIRRP-N recombinant plasmid (lane 2) through two-way order-checking.

3. pcDNA3-HIRRP-C construction of recombinant plasmid: PCR obtains the CDS sequence of the hirrp gene 241bp-630bp of coding HIRRP, is connected into the pcDNA3 carrier.Through EcoRI and Xho I double digestion is the band of 390bp, confirms successfully to make up pcDNA3-HIRRP-recombinant plasmid (lane 1) through two-way order-checking.

Embodiment 3

---the proteic expression of HIRRP

Method:

(1) structure of pGEX-HIRRP and evaluation: with pcDNA3-HIRRP is template, the F of pGEX-HIRRP and R are the upstream and downstream primer, PCR obtains the hirrp gene, is connected into pGEX-5X-1 behind EcoR I and Sal I double digestion, and recombinant plasmid is cut and order-checking is identified through enzyme.

(2) be the band of 630bp through EcoRI and Sal I double digestion, confirm successfully to have made up the pGEX-HIRRP recombinant plasmid through two-way order-checking.

F：aatgaattcatggagcggctccgggagc

R：atagtcgacagcctgctctcagcttttg

(3) expression and the purifying of HIRRP albumen in prokaryotic cell prokaryocyte:

Induce the escherichia coli expression foreign protein that transforms through the pGEX-HIRRP plasmid

1. with plasmid pGEX-5X-1 (bacterium in contrast), pGEX-HIRRP difference transformed competence colibacillus cell BL21 (DE3), transformed bacteria is applied to the LB flat board that contains Amp, is inverted for 37 ℃ and cultivates 16h;

2. picking single colony inoculation of carrying pGEX-5X-1, pGEX-HIRRP plasmid contains in 2 * YT liquid nutrient medium of Amp in 3ml respectively, and 37 ℃, the 200rmp incubated overnight;

3. the above-mentioned engineering bacteria that shakes for a short time is inoculated in the fresh 2 * YT liquid nutrient medium that contains Amp with 1: 100 ratio, 37 ℃, 200rmp cultivates about 3h, and when OD600 reached 0.4～0.6, adding final concentration in bacterium liquid was the IPTG of 0.1mmol/L, inducing culture 3h;

4. get the above-mentioned bacteria culture fluid of 1ml in 4 ℃ of centrifugal 30sec of 12000rpm, precipitate resuspended with 400 μ l PBS (pH7.4), get 15 μ l and add isopyknic 2 * cracking sample-loading buffer, mixing, after placing 10min in the boiling water, carry out 12%SDS-polyacrylamide gel electrophoresis (Polyacrylamide Gel Electrophoresis, PAGE) electrophoresis.

The separation and purification of expressing protein:

Picking carries single colony inoculation of pGEX-HIRRP plasmid in the 2 * YT liquid nutrient medium that contains Amp, and 37 ℃, the 200rmp incubated overnight;

1. will shake engineering bacteria for a short time and be inoculated in 500ml with the ratio of 1: 50 or 1: 100 and contain in fresh 2 * YT liquid nutrient medium of Amp, cultivate about 3h, when OD600 reaches 0.4～0.6, with the IPTG inducing culture 3h of final concentration 1mmol/L;

2. behind the abduction delivering, with 4000rpm, 4 ℃ of centrifugal 15min collect thalline, suspend with 20ml PBS;

3. adding N,O-Diacetylmuramidase in suspension is 01mmol/L to final concentration 05mg/ml and proteinase inhibitor PMSF to final concentration, ice bath 30min;

4. the thalline sample is placed ice bath, with miniature probe ultrasonic generator smudge cells, power 200W, dutycycle 50%, 4s/ time, interval 4s, time 4min, 4 ℃ of centrifugal 10min of ultrasonic back 12500rpm separate supernatant and inclusion body;

5. inclusion body is resuspended in 2ml 6M urea (cracking inclusion body), places 30min for 42 ℃ and make protein dissolution, the centrifugal 10min of 8000rpm, the expressing protein after the sucking-off supernatant obtains dissolving;

6. 10%SDS-PAGE electrophoresis and with after the Coomassie brilliant blue dyeing extracts the protein gel band of corresponding molecular weight;

7. the dialysis tubing of having handled well with deionized water rinsing is packed the gel band that downcuts in the dialysis tubing into, adds Tris-glycine electrophoretic buffer, two ends clamp, 4 ℃, 100V electrophoresis 3h; The reversal voltage positive and negative electrode, 100V, 1min draws protein solution;

8. stir the ice acetone that protein solution slowly adds 5 times of volumes of-20 ℃ of precoolings simultaneously, place 30min for-20 ℃, 4 ℃, remove supernatant behind the centrifugal 20min of 12500rmp, remaining acetone is volatilized naturally;

9. ddH ₂The resuspended precipitation of O, protein solution detects through SDS-PAGE and Lowry method.

The result:

Be connected into prokaryotic expression carrier pGEX-5X-1 and in e. coli bl21 (DE3), pass through the IPTG abduction delivering by hirrp gene, obtained the total length expressed albumen of HIRRP total length.Further go up cleer and peaceful inclusion body in the separating thallus and show that the expression contents of HIRRP in inclusion body is very high.After cutting glue purification, obtain purity higher H IRRP inclusion body protein (Fig. 2 B) and be used for immune mouse and prepare the HIRRP mouse resisting anteserum; Simultaneously, with GST albumen and aseptic PBS immune mouse in contrast.

Embodiment 4

---animal immune and preparation antiserum(antisera)

1. method:

GST albumen behind the purifying, GST-HIRRP fusion rotein is respectively with 1: 1 ratio and Freund's complete adjuvant emulsification mixing (just exempting from), with microsyringe the kunming mice in 6 ages in week carried out the immunity of subcutaneous abdomen multi-point injection, in addition with injection PBS group in contrast.0, each immunity of 2,4 whens week once (the 1st immunity Freund's complete adjuvant, the 2nd, 3 the immune Freund's incomplete adjuvant of using).Immunizing dose is 50 μ g//times, and each point is injected 70ul-100ul approximately; In back 7 days of the 3rd immunity, mouse tail was got blood, collected serum, detected immune effect by the ELISA method, if do not reach the expection immune effect, can the same again method booster immunization once.After the last immunity seven days, collect mice serum with the eyeball excise method.The blood sample of gathering is in 37 ℃ of placement 1h, and 4 ℃ of placements are spent the night, and the centrifugal 5min of 12000rpm collects upper serum, and-20 ℃ of packing are preserved standby.

Western Blot detects antiserum(antisera).When the Vero cell in 6 orifice plates grows to 60%--70% remittance sheet, respectively to every porocyte transfection 4 μ gpcDNA3 and 4 μ g pcDNA3-HIRRP, cultivate 40h after the transfection and extract cell protein with Lipofectamine2000.The mouse anti HIRRP serum that obtains with previous experiments detects the expression of HIRRP albumen in eukaryotic cell; Other establishes the albuminous cell extracting solution of the protein extract of non-transfected cells and transfection pcDNA3 as negative control.

2. result:

By the Vero cell protein split product of Western Blot detection pcDNA3-HIRRP plasmid transfection, can checking HIRRP mouse resisting anteserum specific recognition HIRRP albumen.Western Blot detected result confirms: for the Vero cell of transfection pcDNA3-HIRRP plasmid, and the protein band that the HIRRP mouse resisting anteserum can specific recognition 23KD; And, fail to detect HIRRP protein band (Fig. 2 C) for the cell sample of transfection pcDNA3 empty plasmid only.The control serum of the mouse preparation of GST protein immunization then becomes negative reaction (figure slightly).The HIRRP albumen of expressing under the specific identification transient transfection condition of HIRRP mouse resisting anteserum energy is described.

Embodiment 5

---the function of HIRRP is determined: antiviral activity

Method:

1. transcriptional level---HIRRP is to the active influence of HSV-1 promoter transcription in detection

When the Vero cell in 6 orifice plates grows to 60%--70% and converges, with Lipofectamine 2000 pcDNA3-HIRRP of transfection CAT reporter gene expression plasmids (pCAT-α 4, pCAT-TK, pCAT-gC enhancer) and various dose respectively.The pcDNA3 of every hole transfection various dose so that the DNA total amount of each hole transfection be consistent, other only establishes that transfection pcDNA3 and CAT reporter gene expression plasmid contrast as background, simultaneously the error that produced as internal reference control transfection efficiency difference of the pSV-β-Galactosidase of every hole transfection equivalent.Every group of transfection plasmid prescription is as table 1, shown in table 2 and the table 3.Carry out CAT activation analysis and β-gal determination of activity behind the transfection 40h.The CAT activity value of background contrast is considered as 100, obtains the CAT relative reactivity value of each experimental group respectively.Background is contrasted β-gal activity value be considered as 100, obtain the β-gal relative reactivity value of each experimental group respectively.

Transfection plasmid prescription when table 1 detects HIRRP to active influence of HSVI α 4 promoter transcriptions

Transfection plasmid prescription when table 2 detection HIRRP influences the HSVITK promoter transcription is active

Transfection plasmid prescription when table 3 detection HIRRP influences the HSVIgC promoter transcription is active

2. virus mRNA level.

The HIRRP high expression level is to the influence of HSV-1 α, β, γ gene mRNA expression

When 1. the Vero cell in 6 orifice plates grows to 60%-70% and converges, with 4 μ g pcDNA3 and 4 μ g pcDNA3-HIRRP difference transfection Vero cell, after cultivating 24h, HSV-1 is with the M.O.I=1 vero cells infection, 0h, 1h, 2h, 4h, 6h, 8h, 10h, 12h extract cell total rna after infection respectively, after reverse transcription is cDNA, Real-time pcr amplification ICP0, TK, gC, gB mRNA and confidential reference items β-actin mRNA.

2. basic experiment operation:

Extract cell total rna: extract cell total rna according to sky, Beijing root company total RNA extraction reagent box operation instructions;

The RNA reverse transcription is cDNA: according to the reverse transcription test kit operation instructions operation of sky, Beijing root company, the reverse transcription total amount of each sample RNA is 2ug; Real-time PCR and data processing: with cDNA is template, with ICP0F, ICP0R is primer amplification ICP0mRNA, with TK F, TK R is primer amplification TKmRNA, with gC F, gC R is primer amplification gC mRNA, with gB F, gB R is primer amplification gB mRNA, is that primer amplification β-actinmRNA is as confidential reference items with actin F, actin R.Use RealMasterMix (sybr green) PCR system to increase, the amplification parameter: 95,3min; 95 ℃, 10sec; 56 ℃, 10sec; 68 ℃, 40sec; 35cycles.Data lg2 ^{-Δ Δ CT}Carrying out relative quantification handles.

3. the virus titer level---the titration of virus method detects the high expression level of HIRRP to the active influence of HSV1

1. collecting of HSV-1 viral sample: when the Vero cell in 6 orifice plates grows to 60%-70% and converges, with 4 μ g pcDNA3 and 4 μ g pcDNA3-HIRRP plasmids difference transfection Vero cell, after cultivating 24h, HSV-1 is with the MOI=0.01 vero cells infection, collect viral sample (together with cell and nutrient solution) at metainfective 12h, 24h, 36h, 48h under with strict aseptic technique respectively, be used for follow-up test.The viral sample of being collected should be avoided multigelation.

2. the titration of HSV-1 virus:

The CPE method of titration of virus: operation is seen before and is stated.The plaque forming unit method of titration of virus (PFU method): Vero cell bed board: the every hole of 6 orifice plates kind Veor cell count is about 20 * 10 ¹Treat cell grow to begin when converging more than 95% the experiment.The dilution of viral sample: with the viral sample 1000rpm that collects early stage, RT, centrifugal 10min.Get the 100ul supernatant and do 10 times of dilutions continuously, obtain dilution sample working fluids such as-1 ,-2 ,-3 ,-4 ,-5 with the viral dilution liquid of no FCS.Wash cell twice with PBS, remaining PBS in the exhaustion hole.Every hole adds the good viral working fluid 500ul of dilution, and mixing rocks from side to side.6 orifice plates are put into cell culture incubator, cultivate 1h, rocked once every 30 minutes midway.2% agarose that configures is fully melted in 45-47 ℃ of water-bath.Isopyknic 2% agar and pre-temperature 2 * DMEM mixing are added to the cell surface that has adsorbed virus fast.Viral adsorption liquid this moment reject.Attention should keep the temperature of Agar and DMEM mixture between 37-41 ℃ as far as possible.The every hole of 6 orifice plates adds mixture 2.5-3ml approximately, prevents the generation of bubble in the process that adds.

6 orifice plates are left standstill 20min-30min in RT, agar mixture is fully solidified.6 orifice plates are inverted as for 37 ℃ of incubators and are cultivated, and (about 4-5 days) occur until plaque.Fixing: every hole adds 1.5ml 4% Paraformaldehyde 96, and room temperature is 1h fixedly.Remove Paraformaldehyde 96 and agar layer, every hole adds the Viola crystallina dye liquor of 1ml 05%, the RT 30min-1h that dye, and staining fluid is abandoned in suction, rinses the upper strata loose colour gently well with tap water, and RT dries.6 orifice plates are placed take pictures under the opticmicroscope and preserve.

4.siRNA-hirrp importing to the influence of HSVI virus titer

Experimental design: for every hole L02 cell of 6 orifice plates, organize in contrast with siRNA-n.c., siRNA3-hirrp carries out transfection respectively with after lipo 2000 mixes as experimental group.Transfection method is the same.24h after the transfection inoculates HSVI virus with MOI=0.1, in postvaccinal 24h, and 36h, three times of 48h are checked and accepted sample.The receipts quadrat method of viral sample liquid is with aforementioned.Carry out the mensuration of HSVI virus titer by the PFU method: method is the same.

Experimental result:

1HIRRP has the retarding effect of transcribing to the promotor of HSV1a4, TK, GC.

The present invention adopts E.C. 2.3.1.28 reporter gene pCAT-α 4, the pCAT-TK and the pCAT-gC that comprise HSV1 virus α 4, TK and gC promotor to detect the influence of HIRRP to HSV1 different genes promotor.Experimental result shows, compares with transfection pcDNA3 empty carrier, and the proteic up-regulated of HIRRP all has tangible transcriptional repression activity to the promotor of HSVI virus α 4, TK and Gc gene, and presents good dose-effect relationship to a certain extent.

Fig. 3 A-a4 result shows: with 1ug HSV1 immediate early gene a4CAT reporter gene expression plasmid respectively with the pcDNA3-HIRRP plasmid co-transfection Vero cell of various dose, as seen the HIRRP protein molecular is inhibited to the transcriptional activity of the upright early gene a4 promotor of HSVI, and presents ageing preferably in the certain hour scope; Fig. 3 A-TK found that: with 1ug TK CAT reporter gene expression plasmid respectively with the pcDNA3-HIRRP plasmid co-transfection Vero cell of various dose.The HIRRP protein molecular is inhibited to the transcriptional activity of HSVI early gene TK promotor, has good ageing equally.And for the late gene g C of HSV1, by the experimental result confirmation of Fig. 3 A-gC, the HIRRP protein molecular is also inhibited to the transcriptional activity of HSVI late gene gC promotor in the regular hour scope.

Embodiment 6

The high expression level of-HIRRP can suppress HSV1 virus ICP0, TK, gC, the expression of gB gene RNA.

The present invention organizes in contrast with the pcDNA3 empty plasmid, and pcDNA3-HIRRP is as experimental group transfection Vero cell, 24h after the transfection, and HSVI is inoculated with MOI=1 in every hole, inoculation back 0h, 1h, 2h, 4h, 6h, 8h, 10h and 12h receive sample.Press the test kit operation steps and extract RNA, reverse transcription, and detect each phase of HSVI by Real Time PCR and represent expression of gene.With β-actin as internal reference, experimental data by formula 2 ^{-Δ Δ Ct}Calculate.Found that crossing of HIRRP expressed, to the upright early gene ICP0 (Fig. 3 B-ICP0) of HSV1, early gene TK (Fig. 3 B-TK), the mRNA expression level of late gene gC (Fig. 3 B-gC) and gB (Fig. 3 B-gB) is all inhibited.And HIRRP also presents different rules to α, β, γ genetic expression on restraining effect, have sequential.

Concrete outcome is described as:

The high expression level of Fig. 3 B-ICP0:HIRRP can suppress HSVI α gene--the expression of ICP0mRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of the upright early gene ICP0 mRNA of HSVI in the certain hour scope, the peak of inhibition appears at infects back 1-2h, and presents certain time sequence.The high expression level of Fig. 3 B-TK:HIRRP can suppress the expression of HSVI β gene-TK mRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of HSVI early gene TK mRNA in the certain hour scope, the peak of inhibition appears at infects back 8h.The high expression level of Fig. 3 B-gC:HIRRP can suppress the expression of HSVI γ gene-gC mRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of HSVI late gene gCmRNA in the certain hour scope, and the peak that suppresses appears at infection back 8h.The high expression level of Fig. 3 B-gB:HIRRP can suppress the expression of HSVI γ gene-gB mRNA.Compare with control group, the HSVI infected group of high expression level HIRRP, inhibited to the expression of HSVI late gene gB mRNA in the certain hour scope, the peak of inhibition appears at infects back 8h.Above experimental data is all by 2 ^{-Δ Δ Ct}Carry out relative quantification and handle N=5.

Embodiment 7

---the HIRRP of rise can suppress the propagation of HSVI, and the Knock-down of HIRRP molecule can reverse the restraining effect of HIRRP to HSV1 virus, shows as the rising of virus titer.

The HIRRP of high expression level: organize in contrast with the pcDNA3 empty plasmid, pcDNA3-HIRRP is as experimental group, the 24h behind transfection Vero cell, and every hole Vero cell is inoculated HSVI with MOI=0.1,24h behind virus inoculation, 36h, 48h receives sample.The virus titer detection of HSVI is carried out in operation routinely.Found that (Fig. 3 C-1): HIRRP rise can reduce the HSV1 virus titer.The viral level that infects in back 24h, 36h, the collected cell of 48h and the viral supernatant test sample is compared with control group, descending appears in the HSVI titre level of HIRRP transfection group, especially it is the most obvious to infect back 24h with HSV1, but along with the growth HIRRP of infection time weakens gradually to the restraining effect of HSVI.

The low expression of HIRRP:, promptly under the low state of expressing of HIRRP, observe its restraining effect and can occur how changing to HSVI virus for from verifying the influence of HIRRP in the other direction to HSVI virus.Found that the restraining effect of (Fig. 3 C-2): hirrp-siRNA energy antagonism HIRRP to the HSVI virus titer.With con-siRNA is control group, and hirrp-siRNA is an experimental group, respectively transfection L02 cell.In the ratio inoculation HSVI of MOI=0.1, in postvaccinal 24h, 36h and 48h gather in the crops viral sample, carry out the mensuration of virus titer by the PFU method behind the 24h of transfection siRNA.The result shows, compares with control group, and the HSV1 infected group of transfection hirrp-siRNA can reverse the restraining effect of HIRRP to virus to some extent at the metainfective 24h of HSV1,36h and three time points of 48h, thereby show as the rising of experimental group virus titer.Especially at this time point of 24h, the rising effect of HSVI titre is the most obvious.The titre of virus is represented with PFU/ml among the figure, for the plaque of every milliliter of laboratory sample forms number.

Embodiment 8

---defining of HIRRP molecular function structural domain: functional domain is positioned at N-terminal

1. the different truncated segments of method: HIRRP are to the influence of HSVI virus titer

Collecting of HSV-1 viral sample: when the Vero cell in 6 orifice plates grows to 60%-70% and converges, with 4 μ gpcDNA3-HIRRP, 4 μ g pcDNA3-HIRRP-N and 4 μ g pcDNA3-HIRRP-C plasmids difference transfection Vero cell, after cultivating 24h, HSV-1 is with the MOI=0.01 vero cells infection, under strict aseptic technique, collect viral sample (together with cell and nutrient solution) at metainfective 24h, 36h, 48h respectively, be used for follow-up test.The viral sample of being collected should be avoided multigelation.

The titration of 2HSV-1 virus: PFU method Vero cell bed board;

The every hole of 6 orifice plates kind Veor cell count is about 20 * 10 ⁴Treat cell grow to begin when converging more than 95% the experiment.The dilution of viral sample: with the viral sample 1000rpm that collects early stage, RT, centrifugal 10min.Get the 100ul supernatant and do 10 times of dilutions continuously, obtain dilution sample working fluids such as-1 ,-2 ,-3 ,-4 ,-5 with the viral dilution liquid of no FCS.Wash cell twice with PBS, remaining PBS in the exhaustion hole.Every hole adds the good viral working fluid 500ul of dilution, and mixing rocks from side to side.D) 6 orifice plates are put into cell culture incubator, cultivate 1h, rocked once every 30 minutes midway.2% agarose that e) will configure fully melts in 45-47 ℃ of water-bath.Isopyknic 2% agar and pre-temperature 2 * DMEM mixing are added to the cell surface that has adsorbed virus fast.Viral adsorption liquid this moment reject.Attention should keep the temperature of Agar and DMEM mixture between 37-41 ℃ as far as possible.The every hole of 6 orifice plates adds mixture 2.5-3ml approximately, prevents the generation of bubble in the process that adds.6 orifice plates are left standstill 20min-30min in RT, agar mixture is fully solidified.6 orifice plates are inverted as for 37 ℃ of incubators and are cultivated, and (about 4-5 days) occur until plaque.Fixing: every hole adds 1.5ml 4% Paraformaldehyde 96, and room temperature is 1h fixedly.Remove Paraformaldehyde 96 and agar layer, every hole adds the Viola crystallina dye liquor of 1ml 0.5%, the RT 30min-1h that dye, and staining fluid is abandoned in suction, rinses the upper strata loose colour gently well with tap water, and RT dries.6 orifice plates are placed take pictures under the opticmicroscope and preserve.

Experimental result:

The present invention also detects the function of the different truncated segments of HIRRP in HSV1 virus integral level.With pcDNA3, pcDNA3-HIRRP-N and three kinds of plasmids difference of pcDNA3-HIRRP-C transfection Vero cell, 24h inoculates HSVI (MOI=0.1) after transfection respectively in experiment, and 24h collects sample and detects the HSVI virus titer by the PFU method behind the virus infection.The result is as shown in Figure 4: compare with the pcDNA3 control group, the viral sample group of the terminal truncated segment plasmid of transfection HIRRP-N is inhibited to the HSVI virus activity in 24h, 36h and these three time point scopes of 48h, and the terminal restraining effect of HIRRP-C then will be weaker than N end protein molecule.Illustrate that the functional domain of HIRRP may mainly be positioned at the N-terminal of HIRRP protein molecular.The titre of virus is represented with PFU/ml among the figure, for the plaque in every milliliter of laboratory sample forms number.

It is also to be noted that at last what more than enumerate only is specific embodiments of the invention.Obviously, the present invention is not limited to above embodiment, and many distortion can also be arranged.Protection scope of the present invention is all thought in all distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention.

Claims

1. people source HIRRP protein molecular is characterized in that: its cDNA nucleotide sequence is as SEQ ID №: as described in 1.

2. people source HIRRP protein molecular is characterized in that: its cDNA encoding amino acid sequence is as SEQ ID №: as described in 2.

3. the preparation method of claim 1 or 2 described people source HIRRP protein moleculars is characterized in that adopting following steps:

(1) discovery of HIRRP is by 2-DE differential protein electrophoresis, HSV1 virus infection and do not infect the protein expression profiles of L02 cell relatively, and utilize the MODI-TOF-MS technology and the differential protein molecule that searches out;

(2) clone of HIRRP gene:, from human liver cell cDNA library, clone the gene of HIRRP and make up corresponding carrier for expression of eukaryon by extraction to the total RNA of HSV1 infected cell;

(3) the proteic expression of HIRRP: the HIRRP gene is connected into protein expression vector, and obtains the full-length proteins that HIRRP expresses, prepare the mouse resisting anteserum of HIRRP simultaneously, be used for the detection of HIRRP molecule.

4. definite method of claim 1 or 2 described people source HIRRP protein molecular functional domains is characterized in that, confirms by plaque forming unit experiment (PFU): the functional domain of HIRRP molecule mainly is positioned at the zone of N end 1～80aa; The terminal molecule fragment of the HIRRPN of high expression level can suppress the propagation of HSV1 virus, show as the reduction of HSV1 titre, and the molecularity of C-terminal fragment is very unobvious.

5. claim 1 or 2 described people source HIRRP protein moleculars are to the application of HSV1 virus retarding effect.