CN101970668A - Plants with modified starch metabolism - Google Patents

Abstract

The specification provides methods of obtaining a genetically modified plant which has increased production potential compared to a control plant, the method comprising the steps of i) obtaining a plurality of plants at least one of which comprises in its genome a heterologous polynucleotide, ii) identifying from the plurality of plants a plant which has increased production potential relative to the control plant and comprises the heterologous polynucleotide, and iii) selecting the genetically modified plant, wherein the polynucleotide comprises a transcriptional control sequence operably linked to a nucleic acid sequence which encodes an agent that modifies endogenous starch phosphorylation and/or starch degradation in the plant. In some embodiments, the plant has increased endogenous glycosylase or increased digestibility compared to a control plant. In some specific embodiments, the endogenous starch phosphorylation and/or starch degradation is modified by modifying expression or activity of one or more enzymes selected from the group consisting of alpha-amylase (EC 3.2.1.1), beta-amylase (EC 3.2.1.2), glucoamylase (EC 3.2.1.3), starch phosphorylase (EC2.4.1.1), glycosylase (EC 3.1.33), sucrase-isomaltase (EC 3.2.10), amylomaltase (EC 2.4.1.25), maltase (EC 3.2.1.20), isoamylase, and a-glucan, water dikinase (GWD, EC 2.7.9.4).

Description

The crop of starch metabolism approach through modifying

Technical field

The invention describes the method that improves the biological production potentiality.Especially, the present invention relates to crop starch metabolism approach and provide to have the crop of modifying starch metabolism approach and production potential, comprise gramineous crop such as wheat and barley.The invention describes various breedings and have improved production potential, as the method for the crop of the productive rate that improves, growth, biomass, vigor etc., and by the method for the interested product of crop production of described modification.

Background technology

The detailed bibliography of the publication of author's reference is included in the specification sheets end among the present invention.

Any publication formerly of reference of the present invention (or coming from this information of publication formerly) or any known event the present invention relates to the publication formerly (or coming from this information of publication formerly) of the common practise in field or known event part and should not be admitted or accept or provide any type of suggestion.

Crop is the main source of the reusable energy, and the method that improves given crop productivity potential is that people make earnest efforts exploring.Starch is the main deposit form of carbohydrate in the crop, also is the main energy supply composition of human diet.Starch is functional for the finished product importance of Food Quality for example, is familiar with by people gradually.Starch structure character also is important in industry (non-food product) is used, and for example starch is as gelifying agent, swelling agent, water retention agent or adhesive agent.

In cereal, starch accounts for about 45-65% of ripe grain weight.Starch only is made of glucosides, and finding has two types molecule, and amylose starch and amylopectin can be distinguished based on molecular size or other character.Amylose starch mainly is the linear complex that is made of α-1,4 glucosides unit, and amylopectin is to have the hyperbranched molecule that α-1,6 glycosidic link connects many α-1,4 glucosides unit straight chain.Amylopectin is the macromole composition of ten hundreds of extremely glucose units that have about 5% α-1,6 side chain of hundreds thousand of meters by molecular size.On the other hand, amylose starch is hundreds of molecules that constitute to thousands of glucosides that have less than 1% side chain (referring to Buleon etc., 1998) by molecular size.Typical wild-type cereal starch contains the 20-30% amylose starch, and all the other are amylopectin.

Starch is originally synthetic with the form of transient starch in the chloroplast(id) of crop photosynthesis tissue such as blade.It is to mobilize in the dark phase, with supply carbon be transported to organ and energy metabolism or be housed in organ such as seed or stem tuber in.Synthetic and the Long-term Storage of starch results from storage organ's the amyloplast, and wherein starch exists with the hypocrystalline particle that diameter reaches 100 μ m.Particle comprises amylose starch and amylopectin, and the former is typical amorphous substance in native starch particles, and the latter is the half hitch crystalline state by the accumulation of linear nucleotide chain.

The synthetic of starch is to be realized by the enzyme of four committed steps of one group of catalysis in the high crop endosperm.The first step, the adenosine diphosphate glucose pyrophosphorylase is by Cori's eater Cori and Triphosaden (ATP) synthesizing adenosine diphosphate glucose activation starch monomer precursor.In second step, under the effect of starch synthase, with activatory glucosyl group donor, adenosine diphosphate glucose is transferred to the non-reduced end of α-1,4 key.In the 3rd step, Q-enzyme passes through to introduce tapping point to the separate zones of the dextran of α-1,4 connection, and then the chain transfer that will separate forms new α-1,6 key to receptor chain.Q-enzyme is the unique enzyme that α-1,6 key can be introduced alpha-glucan, therefore plays an important role in the formation of amylopectin.At last, starch debranching enzyme is removed some branch's keys, even but its mechanism of action is unknown.

Clear this four-step reaction at least is synthetic for common starch particle in the high crop to be necessary, in the endosperm of high crop, find many hypotypes of each step reaction, based on mutation analysis or carry out the modification of gene expression dose with transgenic method, special role (the Abel etc. of each hypotype are proposed, 1996, Jobling etc., 1999, Schwall etc., 2000).Yet the accurate effect that biosynthesizing is play to starch even per step is reacted each hypotype is unknown, and it is remarkable that these act on difference between species.In the cereal endosperm, there is the adenosine diphosphate glucose pyrophosphorylase of two kinds of hypotypes, a kind of hypotype is present in the amyloplast, and a kind of hypotype is arranged in tenuigenin (Denyer etc., 1996, Thorbjornsen etc., 1996).Find four kind of starch synthase in the cereal endosperm, a kind of hypotype separately exists in the starch granules, and particle is that amylose starch is synthetic necessary in conjunction with amylosynthease (GBSS), two kinds of forms lay respectively at (SSI, Li etc., 1999a between particle and the soluble part, SSII, Li etc., 1999b), the 4th kind of form is positioned at soluble part fully, (Cao etc. 2000, Li etc., 1999b for SSIII, Li etc., 2000).Sudden change among SSII and the SSIII has proved and has changed amylopectin structure (Gao etc., 1998, Craig etc., 1998).Do not determine the description of SSI active function sudden change.

In the cereal endosperm, express the q enzyme of three kinds of forms, q enzyme I (SBEI), q enzyme IIa (SBEIIa) and q enzyme IIb (SBEIIb) (Hedman and Boyer, 1982, Boyer and Preiss, 1978, Mizuno etc., 1992, Sun etc., 1997).Paddy rice (Nakamura and Yamanouchi, 1992), corn (Baba etc., 1991; Fisher etc., 1993; Gao etc., 1997) and wheat (Repellin etc., 1997; Nair etc., 1997 Rahman etc., 1997) genome and cDNA sequence measure.Sequence alignment on Nucleotide and the amino acid levels demonstrates the sequence similarity of height, and q enzyme is divided into SBEI, SBEIIa and SBEIIb.SBEIIa and SBEIIb generally have the region intermediate of about 80% sequence identity, particularly described gene.

In high crop, there is two types debranching enzyme enzyme, is based on that specificity of its effect substrate determines, isoamylase type debranching enzyme enzyme and Starch debranching enzyme type debranching enzyme enzyme (Myers etc., 2000).Sugar-1 sudden change (Sugary-1 mutations) relevant (James etc. in corn and the paddy rice with the disappearance of two kinds of debranching enzyme enzymes, 1995, Kubo etc., 1999), yet cause and effect mutation map (causal mutation maps) is identical with the position of isoamylase type debranching enzyme enzyme gene.

The starch that extracts from nearly all crop is the starch of phosphorylation to a certain extent.Phosphorylation degree is generally the 0.1-0.4% of nucleosides residue, its be the glucosyl group phosphorylation of carbon 3 or carbon 6 as the phosphoric acid monoester (Blennow etc., 2000a).Typically, about 80% phosphate group is combined in the C-6 position, and about 20% is combined in the C-3 position.Yet, the phosphorylation degree significant difference of Different Crop.Starch in the potato tuber is average 25nmol G-6-P/mg starch, and only is the G-6-P of 1/10th these amounts in the starch of cereal storage.The existence of phosphate group has influence on the water absorbing capacity and the viscosity of starch paste after the gelation in the starch.

Starch phosphorylation is enzymatic by one group that belongs to two kinases families.In potato and Arabidopis thaliana, identify two kinds of enzymes of realizing starch phosphorylation, called after alpha-glucan water two kinases (GWD, EC 2.7.9.4, promptly known R1 albumen or OK1) and phosphoric acid polysaccharide water two kinases (PWD, EC 2.7.9.5).C-3 or the C-6 position of β-phosphoric acid of ATP to glucosyl group shifted in the former catalysis, and γ-phosphoric acid is transferred to water molecules, discharges ortho-phosphoric acid, and latter's catalysis is shifted phosphoric acid to phosphoric acid polysaccharide (having passed through the GWD phosphorylation) and water (Baunsgaard etc., 2005; Kotting etc., 2005).Recently, the phosphorylation in the suggestion starch such as Ritte on 3 or 6 of glucosyl group is by PWD and GWD difference catalytic (Ritte G etc., 2006).

In the potato Antisense Suppression of coding GWD gene make starch content in conjunction with phosphoric acid drop to 80% (

-Nielsen etc., 2001).In addition, specify in the Arabidopis thaliana Sex1 ( STarch EThe xcess phenotype) starch phosphorylation has been removed in the sudden change of gene, shows that GWD is main enzyme (Zeeman and Rees, 1999).In addition, demonstrate the excessive phenotype of starch in the blade of arabidopsis mutant strain and transgenosis antisense potato, show the effect of GWD in transient starch decomposes.Except the phosphorylation inhibition of starch, do not observe the modification of starch structure in those crops.Yet, demonstrate in the GWD antisense potato tuber in " low temperature saccharification " (" the cold sweetening ") of attenuating and the blade and demonstrate the excessive phenotype of starch (Lorberth etc., 1998).The increase that potato crop also demonstrates stem tuber quantity is accompanied by the reduction of each stem tuber weight, but does not demonstrate in the stem tuber other influence to starch accumulation.The affected Arabidopis thaliana Sex1 of transient starch pathways metabolism mutant has also changed the carbohydrate metabolism approach, makes poor growth, the delay of blooming (Yu etc., 2001).

Relation between amylolysis and the starch phosphate content it be unclear that.The starch that the antisense system of potato produces demonstrates the ability that beta-amylase decomposes of resisting of height, shows that starch phosphorylation may be the prerequisite that beta-amylase decomposes.The phosphorylation residue may be the target signal of this enzyme, with at dark phase starch-splitting.Some studies show that, α-Dian Fenmei and R1 albumen (GWD) are with after starch granules combines, and starch begins to decompose.

Sprout the amylolysis in cereal seed such as the wheat and phosphorylation is less is understood, it is to comprise that tissue deterioration and lytic enzyme are induced and amylolytic height Focus system.

Wheat is the main foodstuff products of many countries, and the heat of about 20% kilojoule of food is provided for world's total population.The processing characteristics of wheat has determined it to be used for main converted products based on cereal, as bread, macaroni and noodles, is preferred raw material.Along with the increase of wheat yield, it consumes also worldwide increases.Bread wheat (Triticum aestivum) is the hexaploid with three different genes groups, A, B and D, and most of known has three in the wheat, and each genome contains one.This character of bread wheat genome hexaploid makes in three genomic each genomes and to find and become challenge in conjunction with transgenation.Compare with the sudden change that is easy in the diploid species identify, three genomic existence produce buffering effect by the sudden change of hiding in each genome.Compare with obtainable version in corn or the paddy rice, the known variant form of starch structure is limited in the wheat.Another reason is because the transformation efficiency of wheat lags behind other cereal.Can think, not be studied before gene that comprises in the wheat starch phosphorylation and the influence thereof, to the influence of starch phosphorylation in dicotyledonous crops potato and the Arabidopis thaliana whether to monocot crops such as wheat in similar.

Summary of the invention

The modification that a part of the present invention is based on endogenous starch phosphorylation in the crop and/or decomposition changes that this discovery of crop production ability makes.In certain embodiments; compare with the contrast crop; promoted the raising of production potential, the biomass that is such as but not limited to improve or increase; vigor; sprout; the seedling vigor; growth rate; highly; total leaf area; the photosynthetic rate of unit leaf area; single-strain blade quantity; individual plant corolla quantity; the individual plant tillering quantity; individual plant seed quantity; single corolla seed quantity; average kernel weight; individual plant seed gross weight; the starch content of seed or stem tuber or composition; stem thickness; internode quantity; branch quantity; the quantity of blooming; the size or the shape of flower; pattern; individual plant beanpod quantity; the beanpod size; single beanpod seed quantity; the solid quantity of individual plant; bear fruit; the fruit size; the fruit shape; fruit color; fruit quality; resist disease; the root system quality; the amount of taking root; root length and/or productive rate and/or delay senility.In other embodiments, compare, improved endogenous transglucosylase and/or the digestibility of crop with the contrast crop.

Therefore, in one embodiment, the invention describes, improve the method for crop productivity potential by modifying endogenous starch phosphorylation and/or amylolysis in the crop.In certain embodiments, this method comprises obtaining with contrasting crop to be compared, the crop of the genetic modification that production potential improve.In certain embodiments, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, and ii) evaluation one strain is compared with the contrast crop from a large amount of crops, and production potential improve and contain the crop of allos polynucleotide.In certain embodiments, this method comprises the crop of iii) screening genetic modification, and wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

In another embodiment, the invention describes to obtain and compare, the method for the crop of the genetic modification that endogenous transglucosylase improves with contrasting crop.In certain embodiments, this method comprises that the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) evaluation one strain is compared with the contrast crop from a large amount of crops, and transglucosylase improves and contain the crop of the genetic modification of allos polynucleotide.In certain embodiments, this method comprises the crop of iii) screening genetic modification, and wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

In another embodiment, the invention describes and obtain and contrast crop and compare, the method of the crop of the genetic modification that the digestibility at a certain at least position improves, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) evaluation one strain is compared with the contrast crop from a large amount of crops, and the digestibility at a certain at least position improves and contain the crop of the genetic modification of allos polynucleotide.In certain embodiments, this method comprises the crop of iii) screening genetic modification, and wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

In another related embodiment, the invention describes mensuration compares with the contrast crop, the crop of genetic modification, its production potential, the method whether digestibility at endogenous transglucosylase or a certain at least position improves, the method comprising the steps of i) obtains the crop that a strain or many pnca genes group contain the allos polynucleotide, and ii) measure and contrast crop and compare, a described strain or many strains crop, its production potential, whether the digestibility at endogenous transglucosylase or a certain at least position improves, and wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

Preferably, step I i) directly identifies or measures the production potential that improve, the endogenous transglucosylase activity of raising or the digestibility that improves, comprise and estimate its phenotype, and/or identify crop, it has the starch content of modification or forms as the starch phosphorylation level, compare the endogenous transglucosylase that improves in production potential, at least some cells or the organ of raising or the digestibility of a certain at least position raising with the contrast crop.

The present invention has also described evaluation and has compared with the contrast crop, make the method for the gene of crop productivity potential raising, the method comprising the steps of i) obtains a large amount of crops, every pnca gene group contains the allos polynucleotide, ii) measure and contrast crop and compare, the production potential of every strain and at random the digestibility at its endogenous transglucosylase or a certain at least position whether improve, iii) identify the crop that production potential improve, and iv) identify wherein allos polynucleotide, the transcription regulating nucleotide sequence that thereby identified gene, wherein said polynucleotide contain and the nucleotide sequence of the coding modification endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

The present invention has further described evaluation and has compared with the contrast crop, can improve crop productivity potential, the method of the polynucleotide of the digestibility at raising endogenous transglucosylase of crop or a certain at least position of raising crop, the method comprising the steps of i) obtains one or more polynucleotides, each Nucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, ii) described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop, iii) breed a large amount of above-mentioned crops, iv) measure and contrast crop and compare, whether the crop that at least one strain contains the allos polynucleotide has improved production potential, improve the digestibility at endogenous transglucosylase or a certain at least position, and v) screened described polynucleotide.

In one embodiment, the invention provides breeding and compare the method for the crop of the genetic modification that the digestibility at its production potential, endogenous transglucosylase or a certain at least position improves with the contrast crop.In certain embodiments, the method comprising the steps of i) obtains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, ii) described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop, iii) obtain a large amount of above-mentioned crops, at least the one genome contains described allos polynucleotide, iv) from described a large amount of crops, identify with the contrast crop and compare, its production potential, improve and the crop that contain described allos polynucleotide of the digestibility at endogenous transglucosylase or a certain at least position, and v) screen this crop, thereby breed the crop of this genetic modification.In another embodiment, the method comprising the steps of i) mutagenesis precursor cell, tissue, organ, seed or crop, ii) therefrom obtain a large amount of crops, at least the one genome contains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, and iii) from described a large amount of crops, identify with the contrast crop and compare the crop that the digestibility at its production potential, endogenous transglucosylase or a certain at least position improves.

Can purpose allos polynucleotide be introduced crop by any appropriate means.In certain embodiments, this method comprises the step that described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop and bred described a large amount of crops.In other embodiments, described step comprises conversion and/or the described precursor cell of mutagenesis, tissue, organ, seed or crop.

In certain embodiments, the described purpose factor is reduced expression or its functionally active of the encoding gene of the enzyme that comprises in endogenous starch phosphorylation and/or amylolysis.In certain embodiments, the endogenous starch phosphorylation of described factor downward modulation crop.

In certain embodiments, the inventive method comprises that further detection is from the sudden change with the encoding gene of the polypeptide that obtains comprising of the sample of nucleic acid of crop in amylolysis and/or starch phosphorylation.

In certain embodiments, endogenous starch phosphorylation and/or amylolysis are by change one or more enzymes comprise or the expression or active modification of modulin in amylolysis and/or starch phosphorylation, typical enzyme is selected from following group, described group comprises α-Dian Fenmei (EC3.2.1.1), beta-amylase (EC 3.2.1.2), glucoamylase (EC 3.2.1.3), starch phosphorylase (EC2.4.1.1), transglucosylase (EC 3.1.33), Sucrase-isomaltase (EC3.2.10), amylomaltase (EC 2.4.1.25), maltin (EC 3.2.1.20), isoamylase and alpha-glucan water two kinases (α-glucan, water dikinase, GWD, EC 2.7.9.4).In certain embodiments, endogenous starch phosphorylation and/or amylolysis are by improving the expression activity of α-Dian Fenmei or beta-amylase, and/or reduce that the expression activity of GWD modifies.In certain embodiments, this method further comprises the expression activity that reduces phosphoric acid polysaccharide water two kinases (phosphoglycan, water dikinase, PWD, EC 2.7.9.5).In a preferred embodiment, described modulin is not the albumen of sex1 and/or sex4 genes encoding in Arabidopis thaliana and/or the potato.

In certain embodiments, described purpose factor expression is in the storage organ of crop, in seed, root, stem tuber or the stem of growing.In certain embodiments, described factor expression is in the photosynthetic activity tissue of crop.In other certain embodiments, described endogenous starch phosphorylation and/or amylolysis are transient starches.

In some typically relevant with improving endogenous transglucosylase embodiment, described transglucosylase is α-Dian Fenmei, beta-amylase, glucoamylase or transglucosylase or their combination.

The method that the present invention describes is not limited to specific agrotype.Reference crop comprises and is selected from following crop: grass, vegetables, cereal, beans and the solid or crop that blooms.In certain embodiments, described cereal is wheat, cereal (corn), barley, paddy rice, rye, oat, millet, Chinese sorghum, triticale, buckwheat, Fu Niaomi, Zhu lamb's-quarters, Si Peierte wheat, durum wheat, bread wheat, einkorn, three-coloured amaranth, wild-rice or Herba Eragrostidis pilosae.

In some embodiment of aforesaid method, the crop of described purpose genetic modification further contains the allos polynucleotide, the factor downward modulation α-Dian Fenmei of its coding or the expression or the activity of beta-amylase, or the sudden change of α-Dian Fenmei or beta-amylase encoding gene.In certain embodiments, crop is selected from α-Dian Fenmei or the expression of beta-amylase or the crop of active reduction among at least a crop organ.In certain embodiments, described factor expression in the storage organ or described α-Dian Fenmei or beta-amylase encoding gene be expressed among the storage organ.In other embodiments, the described factor is the RNA molecule of downward modulation two kinase expressions.In certain embodiments, transglucosylase is expressed in conjunction with downward modulation, as α-Dian Fenmei and beta-amylase.

On the other hand, the invention provides crop, crop part and the crop product produced by the inventive method, the processing of their application and crop, crop part and crop product.Arbitrary method that described crop or crop part can be described according to the present invention or their arbitrary combination are modified.Therefore, the invention provides the crop of the genetic modification of that obtain by the inventive method, that produce or evaluation.Reference crop or crop partly comprise seed, blade, stem, root, stem tuber, flower, fruit, beanpod of crop or the cutting part that obtains from crop.

More specifically, the invention describes the crop of genetic modification, its genome contains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, wherein said crop is characterised in that, compare with the contrast crop, it has the starch phosphorylation and/or the amylolysis of modification, and it has the production potential of raising, the endogenous transglucosylase of raising and/or the digestibility that improve at a certain at least position in addition.

Therefore, in certain embodiments, the invention provides the crop of genetic modification, its genome contains the sudden change of introducing, this mutator gene encode endogenous starch phosphorylation polypeptide and/or amylolytic enzyme, wherein said crop is characterised in that, compares with the contrast crop, and it has the production potential of raising, the endogenous transglucosylase of raising and/or the digestibility that improve at a certain at least position.

In other embodiments, the invention provides the crop of genetic modification, its genome contains one or more allos polynucleotides, each polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, wherein said crop is characterised in that, compare with the contrast crop, at least the part of described crop has the starch phosphorylation and/or the amylolysis of reduction, that improve in the crop ripe seed or reduce transglucosylase, be preferably diastatic expression and/or activity, and the production potential that improve.In other embodiments, it demonstrates level that target starch phosphorylation polypeptide and/or amylolytic enzyme reduce and at random at least described crop in first organ of crop, at least demonstrate the level that target starch phosphorylation polypeptide and/or amylolytic enzyme raise in second organ of crop, wherein first or second organ is identical or different organs.In certain embodiments, described target polypeptide or enzyme are selected from the group of being made up of following substances: α-Dian Fenmei, beta-amylase, glucoamylase, starch phosphorylase, transglucosylase, Sucrase-isomaltase, amylomaltase, maltin, isoamylase and alpha-glucan water two kinases.

In typical embodiment, the expression or the functionally active of the enzyme that described factor downward modulation comprises in endogenous starch phosphorylation and/or amylolysis.In certain embodiments, the described factor is reduced two kinase whose level or functionally activies.In certain embodiments, described two kinases are GWD or GWD and PWD.

In certain embodiments, described factor expression is in the storage organ of crop.In other embodiments, described factor expression is in the photosynthetic activity tissue of crop.In typical embodiment, described starch phosphorylation and/or amylolysis are transient starches.

The present invention also provides the grain of the transglucosylase that raises in the starch phosphorylation that reduces in blade and/or the grain and the grain.Except improving crop-producing power, the combination of two features has brought special benefit for the application of grain.Compare with the contrast crop, the combination of the two makes starch phosphorylation drop at least 50%, and preferably at least 70%, at least 80%, at least 90% or at least 95%.Compare with the contrast crop, the combination of the two makes transglucosylase, is preferably α-Dian Fenmei and is increased at least 100%, preferably at least 200%, at least 300% or more preferably 500%.

The crop combination thing of describing among the present invention is not limited to specific agrotype.Reference crop comprises that crop is selected from: the subclass that the arbitrary combination of quilt crop, monocot crops, dicotyledonous crops, grass, vegetables, cereal, beans and solid or bloom crop or these classifications forms.In certain embodiments, the dicotyledonous crops of modification is modified.In certain embodiments, productivity such as Gramineae monocot crops such as cereal crop, sugarcane, beet, Chinese sorghum, rye increase.

In certain embodiments, cereal is wheat, cereal (corn), barley, paddy rice, rye, oat, millet, Chinese sorghum, triticale, buckwheat, Fu Niaomi, Zhu lamb's-quarters, Si Peierte wheat, durum wheat, bread wheat, einkorn, three-coloured amaranth, wild-rice or Herba Eragrostidis pilosae.Wheat can be bread wheat (hexaploid wheat), durum wheat or triticale.Corn is preferably dent corn, can be white maize or Semen Maydis.In certain embodiments, crop is not Arabidopis thaliana and/or corn.

In certain embodiments, described expression regulation sequence is preferentially regulated and control among the storage organ and/or the expression of polynucleotide in the crop photosynthesis active mass.

In other embodiments, described crop further contains polynucleotide, and it is operably connected to the transcription regulating nucleotide sequence of the factor of coding downward modulation amylase activity.

In other embodiments, described crop Partial Feature is partly to compare with contrasting crop, has the starch content or the composition of modification, the production potential of raising, the endogenous transglucosylase of raising or the digestibility of raising.

In certain embodiments, the invention provides amyloid seed, wherein the level of G-6-P is lower than 10ng/mg starch in the seed starch, and the diastatic activity force level is at least 4 units/g powder in the seed powder.

The present invention relates to the product of the crop of genetic modification.

In one embodiment, the invention provides product, it is cereal, flour, whole wheat flour or the partially purified at least starch of processing, and wherein said product is compared with the product of contrast crop, and starch content or total starch with modification are formed.

The invention discloses the method for producing product, comprise the crop that makes plant growth and/or harvesting crops or part genetic modification.In certain embodiments, described method is used for from the cereal of the crop process for processing of genetic modification, flour, whole wheat flour or partially purified at least starch, comprises adding the work piece part as grain.

In other embodiments, the invention provides the method for producing foodstuff products, comprise described crop or part or described product are mixed with another food composition, and any cooking, baking, fry, boiling, boil, push or other processes the method for described mixture.

In another embodiment, described product is a leavened prod, the invention describes the method for leavened prod, described product is cereal, flour, whole wheat flour or the partially purified at least starch of processing, wherein said product is compared with the product of contrast crop, have the starch content of modification or total starch of modification and form, or by from the crop of genetic modification, adding local flour or the starch of producing as grain of work piece.In certain embodiments, described leavened prod is an ethanol.

In another embodiment, the invention provides the method for supplying with the mankind or animal foodstuff, comprise with herein or the crop of above-mentioned genetic modification, crop part, product or the product produced by described method offer the mankind or animal.In certain embodiments, the invention provides by product above-mentioned or that this prescribing method is produced.

On the other hand; the invention discloses the production of application allos polynucleotide compares with the contrast crop; the crop that production potential improve, endogenous transglucosylase improves or at least a portion digestibility of its seed or its organ improves, wherein said polynucleotide contain with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

In another embodiment, the invention provides herein or the amyloid crop of above-mentioned genetic modification or the application of its part, produce foodstuff products or non-foodstuff products, or as growth or the health of animal-feed with the enhancing animal.In certain embodiments, described product is an ethanol.

In another embodiment, the invention discloses and use crop or the human food that consumes of its part producing, wherein crop or its part are carried out genetic modification by introducing at least two allos polynucleotides, wherein crop is characterised in that, its production potential improve, starch phosphorylation in the crop leaf and/or amylolysis reduce, endogenous transglucosylase in the crop kernel reduces, and wherein each allos polynucleotide contains with coding and modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

In another embodiment; the invention provides evaluation or use compares with the contrast crop; the endogenous transglucosylase of crop productivity potential, raising or seed or the molecular marker method that improves of the position digestibility of crop at least; this method comprises the sample of nucleic acid that obtains crop, and the polymorphism of identification code crop GWD gene or its heredity connect.

In another embodiment, the invention provides the method for measuring crop, comprise the sample of nucleic acid that obtains crop, handle the identity of sample, and identify any Nucleotide relevant with crop productivity potential with selection Nucleotide in the mensuration GWD gene.

The invention provides new nucleic acid molecule.In one embodiment, the invention describes contain coding alpha-glucan water two kinase polypeptides or with the isolating or chimeric nucleic acid molecule of its complementary nucleotide sequence, described alpha-glucan water two kinase polypeptides contain just like aminoacid sequence or its biologically-active moiety shown in the SEQ ID NO:3 or the version that has SEQ ID NO:3 sequence 90% homology at least.

In another embodiment, the invention provides and contain and SEQ ID NO:2 or SEQ IDNO:5 or SEQ ID NO:8 or SEQ ID NO:9 or SEQ ID NO:10 (paddy rice GWD) or SEQ ID NO:11,12, nucleotide sequence or its proteins encoded or its biologically-active moiety shown in 13 or 14 (the Chinese sorghum GWD) or with SEQ ID NO:2 (wheat GWD) or SEQ ID NO:5 (wheat GWD) or SEQ ID NO:8,9 or 10 (paddy rice GWD) or SEQ ID NO:11, SEQID NO:12, nucleotide sequence or the version unanimity of its protein-coding region 90% sequence homology or the isolating or chimeric nucleic acid molecule of complementary nucleotide sequence shown in SEQ ID NO:13 or the SEQ ID NO:14 (Chinese sorghum GWD).

In certain embodiments, the invention describes and contain under stringent condition and SEQ IDNO:2 or SEQ ID NO:5 or SEQ ID NO:8, nucleotide sequence shown in 9 or 10 or its proteins encoded or its biologically-active moiety or with SEQ ID NO:2 (wheat GWD) or SEQ IDNO:5 (wheat GWD) or SEQ ID NO:8, the isolating or chimeric nucleic acid molecule of the nucleotide sequence of the version of nucleotide sequence or its protein-coding region 90% sequence homology shown in SEQ ID NO:9 or SEQ ID NO:10 (paddy rice GWD) or SEQ ID NO:11 or SEQ ID NO:12 or SEQ ID NO:13 or the SEQ ID NO:14 (Chinese sorghum GWD) hybridization.

In certain embodiments, the invention provides the chimeric nucleic acid configuration that contains the nucleic acid molecule that can be operatively connected with transcription regulating nucleotide sequence.In certain embodiments, the invention provides the isolating or chimeric nucleic acid molecule of the genetic expression that can reduce encodes in the cereal crop has the active polypeptide of GWD.In certain embodiments, described nucleic acid molecule for or encoding antisense RNA, suppress RNA, double-stranded RNA, hairpin RNA or ribozyme altogether.

In certain embodiments, the invention describes and use isolating or chimeric nucleic acid molecule and reduce that coding has the expression of gene of the active polypeptide of GWD in the cereal crop.

In another embodiment, the invention provides the single stranded nucleic acid probe that contains 20 continuous nucleotides, the nucleotide sequence of wherein said 20 Nucleotide with contain SEQ ID NO:2 or SEQ ID NO:5 or SEQ ID NO:8, nucleotide sequence or its proteins encoded or its biologically-active moiety shown in 9 or 10 (paddy rice PWD) or SEQ ID NO:11 or SEQ ID NO:12 or SEQ ID NO:13 or the SEQ ID NO:14 (Chinese sorghum GWD) or with SEQ ID NO:2 (wheat GWD) or SEQ ID NO:5 (wheat GWD) or SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10 (paddy rice PWD) or SEQ ID NO:11, SEQ ID NO:12, the complement sequence of the nucleic acid molecule of the version of nucleotide sequence or its protein-coding region 90% sequence homology is identical shown in SEQID NO:13 or the SEQ ID NO:14 (Chinese sorghum GWD).

In another embodiment, the invention provides the single stranded nucleic acid probe that contains 20 continuous nucleotides, the nucleotide sequence of wherein said 20 Nucleotide with contain under stringent condition and SEQ ID NO:2 or SEQ ID NO:5 or SEQ ID NO:8, SEQ ID NO:9 or SEQ IDNO:10 (paddy rice PWD) or SEQ ID NO:11, SEQ ID NO:12, nucleotide sequence or its proteins encoded or its biologically-active moiety shown in SEQ ID NO:13 or the SEQ ID NO:14 (Chinese sorghum GWD) or with SEQ ID NO:2 (wheat GWD) or SEQ ID NO:5 (wheat GWD) or SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10 (paddy rice PWD) or SEQ ID NO:11, SEQ ID NO:12, the sequence of nucleic acid molecules of the nucleotide sequence of the hybridization of the version of nucleotide sequence or its protein-coding region 90% sequence homology shown in SEQ ID NO:13 or the SEQ ID NO:14 (Chinese sorghum GWD) is identical.

In another embodiment, the invention provides the single stranded nucleic acid probe that contains 20 continuous nucleotides, the nucleotide sequence of wherein said 20 Nucleotide with contain coding alpha-glucan water two kinase polypeptides contain just like the nucleotide sequence shown in the SEQ ID NO:3 or its biologically-active moiety or the complement sequence of the nucleic acid molecule of the version of 90%SEQ ID NO:3 sequence homology is identical at least.

In another embodiment, the invention provides the arrayed nucleic acid molecule that is attached to solid support, the oligonucleotide that this array contains optionally with contain in the cereal crop making nucleic acid molecular hybridization that coding has the gene of the active polypeptide of GWD.

In another embodiment, the invention provides expression vector, host cell, crop cell, crop part, crop or the seed that contains above-mentioned isolating or chimeric nucleic acid molecule or contain the configuration of the described nucleic acid molecule that can be operatively connected with transcription regulating nucleotide sequence.In certain embodiments, described configuration is expressed in host cell, crop cell, crop, crop part or the seed, the invention provides the method for production cereal GWD polypeptide or its version, or the method for producing bioactive fragment or its version, described method is included in and expresses this configuration in host cell, crop cell, crop, crop part or the seed.

Therefore, in certain embodiments, the invention provides the method for improvement crop, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) evaluation one strain is compared with the contrast crop from a large amount of crops, production potential improve and contain the crop of allos polynucleotide, and the crop of iii) screening genetic modification, wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, the crop of wherein said genetic modification is compared with the contrast crop, has improved production potential.

In another related embodiment, the invention describes the method for improvement crop, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) evaluation one strain is compared with the contrast crop from a large amount of crops, transglucosylase improves and contains the crop of the genetic modification of allos polynucleotide, and the crop of iii) screening genetic modification, wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, the crop of wherein said genetic modification is compared with the contrast crop, has improved endogenous transglucosylase.

In another embodiment, the invention describes the method for improvement crop, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) evaluation one strain is compared with the contrast crop from a large amount of crops, the digestibility at a certain at least position improves and contains the crop of the genetic modification of allos polynucleotide, and the crop of iii) screening genetic modification, wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, the crop of wherein said genetic modification is compared with the contrast crop, has improved the digestibility at a certain at least position.

In a further embodiment, the invention describes the method for improvement crop, the method comprising the steps of i) obtains the crop that a strain or many pnca genes group contain the allos polynucleotide, and ii) measure and contrast crop and compare, a described strain or many strains crop, its production potential, whether the digestibility at endogenous transglucosylase or a certain at least position improves, wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, the crop of wherein said genetic modification is compared with the contrast crop, improved production potential, improved endogenous transglucosylase or improved the digestibility at a certain at least position.

In a further embodiment, the invention describes the method for improvement crop, the method comprising the steps of i) obtains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, ii) described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop, iii) obtain a large amount of above-mentioned crops, at least the one genome contains described allos polynucleotide, iv) from described a large amount of crops, identify with the contrast crop and compare, its production potential, improve and the crop that contain described allos polynucleotide of the digestibility at endogenous transglucosylase or a certain at least position, and v) screen this crop, thereby breed the crop of this genetic modification, the crop of wherein said genetic modification is compared with the contrast crop, improved production potential, improved endogenous transglucosylase or improved the digestibility at a certain at least position.

In a further embodiment, the invention describes the method for improvement crop, the method comprising the steps of i) mutagenesis precursor cell, tissue, organ, seed or crop, ii) therefrom obtain a large amount of crops, at least the one genome contains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, and iii) from described a large amount of crops, identify with the contrast crop and compare, its production potential, improve and the crop that contain described allos polynucleotide of the digestibility at endogenous transglucosylase or a certain at least position, the crop of wherein said genetic modification is compared with the contrast crop, improved production potential, improved endogenous transglucosylase or improved the digestibility at a certain at least position.

Description of drawings

G-6-P G6P content in the cereal starch of Fig. 1 is pictorialization rsGWD transgenic wheat system.

Amylase content in Fig. 2 the is pictorialization cereal starch of rsGWD transgenic wheat.

Fig. 3 chart data has shown the swelling power of the cereal starch of rsGWD transgenic wheat.

Fig. 4 chart data has shown the gelatinization character (starch viscosity) of the cereal starch (or do not contain the whole wheat flour of alpha-amylase inhibitor, or contain the purifying starch of alpha-amylase inhibitor) of rsGWD transgenic wheat.

Fig. 5 data presentation compared with the control, the alpha-amylase activity of the rsGWD transgenic wheat seed of raising.

Fig. 6 picture has shown vigor, biomass and the productive rate that the rsGWD transgenic wheat improves.

Fig. 7 chart data has shown the G6P contents level that reduces in transition (blade) starch of rsGWD transgenic wheat system.

Fig. 8 chart data has shown the spike amount that every strain increases in the transgenic wheat system of different genetic backgrounds.

Fig. 9 chart data has shown compared with the control, the alpha-amylase activity that rsGWD transgenic wheat seed improves.

Explanation of tables

Table 1 provides the explanation of SEQ ID NOs of the present invention.

Table 2 provides the amino acid subclass.

Table 3 provides typical aminoacid replacement.

Table 4 provides the viscosity number of rsGWD transgenic wheat.

Table 5 provides growth analysis (kernel weight, the seed productive rate) result of rsGWD transgenic wheat.

Table 6 provides growth analysis (leaf area, tiller, the corolla) result of rsGWD transgenic wheat.

Table 7 provides with paddy rice GWD and has compared, the extron/intron structure of wheat.

Preferred implementation describes in detail

Hereinafter in all specification sheetss and the claim, unless requirement is arranged in the context, term " comprises (comprise) " and variant, should be understood that to represent to comprise the integer of regulation or the group of step or integer or step as " comprising (comprises) " and " containing (comprising) ", but do not get rid of any other integer or the group of step or integer or step.Though phrase " by ... form (consisting of) " what follow is what, " by ... form (consisting of) " implication all be " comprising (including) " and only limit to.So phrase " by ... form (consisting of) " represent that the composition of listing is necessary or enforceable, and do not have other composition to exist." substantially by ... " expression comprises any composition of listing behind the phrase, and is limited to those and can have the disclosed activity of listing composition or specific function and disturb or other composition of contribution to form (consisting essentially of).Therefore, phrase " substantially by ... form (consisting essentially of) " composition listed of expression be must or enforceable, but other composition is optionally arranged, and whether it can influence activity or the function of listing composition according to them occurs or does not occur.

Unless special stipulation is arranged, otherwise each embodiment in this specification sheets all can become other embodiment by suitable change.

Nucleotide and aminoacid sequence are represented with sequence identifier sign indicating number (SEQ ID NO :).Numeral in the corresponding sequence identifier of SEQ IDNos,＜400〉1 (SEQ ID NO:1),＜400〉2 (SEQ IDNO:2), etc.The table 1 behind the embodiment is seen in the explanation of sequence identifier.The claim postscript has provided sequence list.

Unless define, otherwise the implication of all technology used herein and scientific terminology is identical to the implication of its general understanding that is suitable for inventing with those skilled in the art.Although any method similar or of equal value and material with description herein may be used to implement or test the present invention, this paper has described preferable methods and material.In order to realize purpose of the present invention, hereinafter following term is defined.

Article used herein " one (a) " and " a kind of/one (an) " be meant one or more than the grammar object of the article of (being at least one).For example, " composition " is meant a kind of composition or more than a kind of composition.

Term used herein " (about) approximately " is index amount, level, value, yardstick, length, position, size or content 30% left and right sides range at described quantity, level, value, yardstick, length, position dimension or contents level, about preferred 20% scope, more preferably about 10% scope.

Starch

The present invention is based on following discovery, in the plant particularly in the blade modification of the gene in starch phosphorylation and the starch degradation express output parameter with plant, relevant as the surprising influence of grain yield.Because research before shows that synthetic the or storage of treated starch can cause the reduction of output, so it is surprising.Usually do not expect transient starch phosphorylation or degraded minimizing in the blade, it comprises the other parts that fixed carbon gathered plant, can cause output to increase.

" starch " is defined as in this article: the polysaccharide that is made of α-Glucopyranose basically.Starch is plant, comprises the main carbohydrate of storing in the wheat as cereal.Starch is synthesized for amyloplast and with particle form and forms and be housed in storage organ in the growth, in cereal; This paper middle finger " storage starch ".It comprises amylose starch, the α-1 of substantial linear (＜0.1% branch), and 4-D-Glucopyranose polymer, and amylopectin, it has the short chain unit of α-D-Glucopyranose, and it is to connect branch by α-1,4 key and α-1,6 in advance to connect.Cereal starch from wild-type plant comprises up to the amylose starch of about 20%-30% and the amylopectin of about 70%-80%.The remarkable different polymeric molecular weight that are of another of amylose starch and amylopectin.Amylose starch has spiral helicine structure, has 10 ⁴-10 ⁶Daltonian molecular weight, and amylopectin has about 10 ⁷To 10 ⁸Daltonian molecular weight.Nearest studies show that, may have about 0.1% α-1 in amylose starch, 6-glucosides tapping point, so it is called as " substantial linear "." amylose starch " is defined as comprising the substantially linear molecule in this article, be connected with α-1,4 glucosides (Glucopyranose) unit, and the long-chain amylopectin of amylose starch shape (is also sometimes referred to as " intermediate material " or " amylose starch shape amylopectin " Takeda etc., 1993b; Fergason, 1994).The ratio of amylose starch is based on w/w (w/w) in Ding Yi the starch herein, and promptly amylose starch weight is with respect to the per-cent of cereal starch gross weight.Amylose content can be measured by any means known in the art, comprises HPLC size exclusion method, for example in the DMSO of 90% (w/v), concanavalin A method (Megazyme Int, Ireland), or preferably by iodimetry,iodometry, for example described in the embodiment 1.The HPLC method can comprise taking off (Batey and Curtin, 1996) or not comprising and taking off of starch.

Starch be initial in other chlorenchyma of leaf and plant synthetic and accumulation as photosynthetic product.Starch herein be meant " transient starch " and or analogue, this be because, compare with the starch in seed or the stem tuber, in photosynthesis tissue, accumulate its daytime and degrade at least at night.Therefore, synthetic enzyme and degrading enzyme all can exist in cell simultaneously, and system can regulate every day.At night, transient starch is hydrolyzed saccharogenesis, is sucrose basically, and it is used to plant-growth from being sent to energy storage tissue for source tissue as metabolic energy derive or is stored in the tissue as storage starch.Recent Zeeman equals 2004 and has studied the decomposition of transient starch in the blade.This decomposes by enzyme, as amylase, and debranching factor, the function of alpha-glucan Starch phosphorylase and glucanotransferase realizes.

Nearly all plant amylum all can be changed into the amylopectin with C3 and C6 oh group length by phosphoric acid, but the degree change of phosphorylation depends on the kind of plant.Potato tuber starch has glucose sugar-6-phosphoric acid of 25nmoles usually in every mg starch, scope is at 0.2-0.4% (w/w).Most phosphate groups in the yam starch are connected with amylopectin, and considerably less being connected with amylose starch only arranged.Compare with yam starch, cereal starch only contains the phosphoric acid salt of 0.02-0.04%." phosphorylated starch " used herein is meant that those C-3 and/or C-6 positions in glucose sugar unit are connected with the starch of phosphate group as monoesters.The level of phosphate group can be measured by methods known in the art in the starch sample, preferably measures by the Victoria Green WPB method described in the embodiment 1, and it is typically expressed as the mmole number in every milligram of starch.Glucosyl-6-phosphoric acid salt residual in the starch sample can be measured by the Polyglucosidase assay method described in the embodiment 1.

The degraded of starch

The initial step of the starch degradation in all blades and the chitting piece comprises: and endo-amylase (α-Dian Fenmei, EC3.2.1.1), it is by the aleurone layer excretory in chitting piece, but it exists in the chloroplast(id) in blade.This enzyme is attacked the starch granules of starch and is made the particle surface depression at specified point.Alpha-glucan Starch phosphorylase (EC2.4.1.1) is passed through in further attack to starch molecule, it is by α-1, the non reducing end of 4 dextran chains produces Cori ester salt, and debranching factor, carry out as isoamylase (EC3.2.1.68) and Starch debranching enzyme (EC3.2.2.142), they remove α-1,6 fulcrum.Comprising other enzyme have, circumscribed-type amylase, beta-amylase (EC3.2.1.2), its non reducing end from dextran chain discharges maltose, dismutase (D-enzyme, EC2.4.1.25) and alpha-glucosidase (maltin, EC3.2.1.20) or maltose phosphorylase (EC2.4.1.8), it can be as straight chain.In Arabidopis thaliana and other dicotyledons, the activity of beta-amylase surpasses the about order of magnitude of other dextran-metabolic enzyme, and all occurs the inside and outside of chloroplast(id).Dextran, (GWD EC2.7.9.4) can regulate the degree that other enzyme is attacked starch granules to water two kinases.GWD transfers to the C6 or the C3 position of glycosyl units in the amylopectin with β-phosphoric acid of ATP, and the existence of this phosphoric acid may be the signal that degraded takes place.We think: the existence of phosphate group may change between the dextran chain or and protein between electrostatic interaction, and this process is begun.During starch degradation, GWD is and blade starch granules bonded (Ritte etc., 2000), and it has higher activity in this stage.At least as if in some plants, the activity of the circulation GWD self by daytime/night also is adjusted to pattern round the clock.

Reduce GWD (also being called R1 albumen or OK1) expresses in the potato antisense experiment reduced up to 90% starch that combines phosphoric acid ( -Nielsen etc., 2001).Homogenic sudden change among the Arabidopsis thaliana (be called starch and cross phenotype sex1) is relevant with the restraining effect of starch phosphate content, and confirms to comprise in the phosphorylation of starch GWD (Zeeman and Rees, 1999).In addition, arabidopsis mutant body and potato suppress the phenotype that system all shows " starch is excessive ", and wherein cumulative starch has surpassed the common level in the blade, have confirmed the effect of GWD in the transient starch degraded.In these researchs, do not observe the variation of starch structure in these plants.In the potato tuber reduction of starch phosphate content be accompanied by potato tuber " low temperature saccharification " minimizing (Lorberth etc., 1998), this activity that shows amylase or other lytic enzyme has reduced.Arabidopis thaliana sex1 mutant influences the wherein metabolism of transient starch, also can change the metabolism of carbohydrate, makes its poor growth and late blooming (Yu etc., 2001).

2005, Baunsgaard etc. defined a kind of water two kinases of novel type, glucose 1-phosphate1-water two kinases (PWD).But this enzyme was both similar different with GWD, its can after the phosphorylation of pre-phosphorylated starch in be activated (Kotting etc., 2005).Propositions such as Ritte, the phosphorylation of the glucosyl residue of C3 or C6 position can be by PWD and GWD catalysis (Ritte G. etc., 2006) respectively in the starch.

The degraded of starch and phosphorylation part are known in the germinated ceral seed, but it is to comprise tissue deterioration and the special system of lytic enzyme inductive height.

In some embodiments, the invention provides by changing in the plant starch phosphorylation and/or Degradation and improved productivity or the availability of plant, and it is based on the observed result of both contacts.The modification of starch phosphorylation and/or degraded can be present in the transient starch, for example, in plant leaf, or in the storage starch of such as grain, perhaps is present among both.According to the present invention, the modification of plant, particularly cereal crop comprise but being not limited in blade and/or the endosperm one or more to starch phosphorylation and/or the activity of degraded (decomposition) enzyme or the change of content.

" modification " used herein expression, variation to material or its function, it can be product amount, activity, ratio, deactivation rate, the increase of rate of decomposition or minimizing begin to postpone, begin in advance, material increases or removes, and sudden change or their arbitrary combination are as long as finally be change on the function." to the adjusting of functional level " used herein or similar terms are represented the increase of interested gene or proteinic functional level or reduction." functional level " should be understood to mean the level of activated protein, and in casu albumen can carry out the level of starch phosphorylation or starch degradation.This functional level be with host cell in the proteinic real standard that exists relevant with proteinic given activity.Therefore, for example functional level can change by the actual protein concentration that increases or reduce in the host cell, and it can easily be realized by the expression that changes gene coded protein.Functional level can also change by regulating proteic given activity.The increase of given activity or reduction can obtain by expressing with higher or lower given activity or replacing the native gene of associated protein encode by the allelotrope coding with this variable.The increase of given activity or reduction can also activate by the expression of effector molecule.In certain embodiment, the suitable coded sequence of enzyme or the expression level of activity or content are through selection, and its expression level than reference exceeds at least about 10%, 20% at least, at least 30%, at least 40%, at least 50%, at least 60%, at least 80% or even at least about 100%, at least 200%, at least 500%, or at least 1000%; Or it is lower at least about 10%, at least 20%, at least 30%, at least 40%, at least 50% than it, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98% or at least 99%, or be reduced to the level that can't detect.

Term used herein " modification ", " change ", " increase ", " minimizing ", " reduction ", " reducing ", " inhibition ", " sudden change " or similar vocabulary are considered to the term of relativity, promptly compare with wild-type or not change type.Wild-type plant herein also is meant " control plant ", and this term can be changed." protein level " is meant the amount of specific protein, and as GWD, it can record by any method known in the art, for example Western engram analysis method or other immunological method." enzyme activity level " is meant the amount of the certain enzyme of measuring in the enzyme check.If produced more or less activated protein, but but be not the expression level (amount) of albumen self, then to be changed in mutant be exactly that we are desired to enzyme activity level.On the contrary, proteic amount can be changed, and active (per unit albumen) remains unchanged.Content and active all the minimizing also are possible, for example, and when the genes encoding of enzyme is expressed in when being lowered after transcribing or transcribing.In certain embodiment, with the cereal of blade or unmodified, compare as the protein level or the activity in wheat Ruzhong, for example the protein level of GWD or activity have reduced at least 40%, or at least 60%, or at least 75%, at least 90% or at least 95%.The minimizing of protein level or enzyme activity level or gene expression dose can take place in any stage of the growth of blade, seed or cereal, particularly by day, when photosynthesis takes place, or in the cereal filling stage, at this moment starch can be synthetic in the endosperm of growth, or all stages in the corn growing ripening process take place.Term used herein " wild-type " has its its ordinary meaning in the genetics field, and it comprises plant, particularly cereal, raise crop or genotype, and it is not by modified in the instruction of this paper.Preferred " wild-type " kind that the public obtains easily has: bread wheat (breadwheat), kind Bob White; Corn (Zea mays), Roundup Ready Corn 2; Paddy rice, Nipponbare; Chinese sorghum (Sorghum bicolor), kind Sumac.

In one embodiment, the change in plant leaf or the endosperm comprises GWD amount and/or active minimizing, and it can cause at blade and/or mature seed, as the reduction of the phosphorus acid content in the starch of grain.In another embodiment, modification comprises PWD and the active reduction of GWD.In other embodiments, modification comprises the minimizing of the GWD in the grain and the rising of amylase activity, especially α-Dian Fenmei.Other above-mentioned relevant starch degrading enzyme also may change, and comprises beta-amylase, Starch phosphorylase or starch-debranching enzyme, as isoamylase or Starch debranching enzyme.Change can be that for example, activity increases, the active reduction, the position of active function or time change.Join together when the change of these enzymes, the character of the starch except that phosphorus acid content also can change.In one embodiment, improved plant, especially cereal grass are included in the active change of multiple starch degrading enzyme in the endosperm, have particularly comprised the active reduction of GWD, have caused the reduction of phosphorus acid content in the cereal starch.In another embodiment, the activity of the starch degrading enzyme of one or more in the plant tissue except that endosperm or blade can change, activity as GWD in the endosperm might increase, it is for the main GWD that expresses in blade that compensates by transgenes encoding suppresses the loss of activity that molecule causes, or in the endosperm amylase especially the activity of α-Dian Fenmei can reduce.The change of enzymic activity may the amount of being increase or minimizing, also may be the change of expression time.The synthetic of starch can be expressed and the reduction of associating GWD further improves by one or more crossing of starch biosynthesis enzymes.The gene of encoding such enzymes can come from various source as known in the art, as derives from bacterium, cereal or other source, and it is transformed to change catalysis characteristics, as changing the relation (example is seen WO 94/09144) of enzyme and temperature.

Can be by partially or completely suppressing the GWD gene, or GWD and PWD expression of gene obtain the phenotype through modifying.The phenotype of " the low starch phosphate content " that herein uses etc. refers to the whole starch that obtain from plant or plant part (as blade or grain) has and is less than 0.02% starch phosphate content, or control starch relatively accordingly, is reduced by at least 50%.The repressed degree of gene has determined the characteristic of starch in the wheat to a certain extent.The proteic gel electrophoresis result who extracts from the wheat Ruzhong of transforming demonstrates the essence and the degree of GWD and/or PWD activity change.Change can be the active reduction of GWD, or the completely losing of enzymic activity, or changes the GWD in blade or endosperm or the distribution of other enzyme.For example, can the distribution of enzyme reduce GWD or other activity in the endosperm by influencing, such as the enzyme level that reduces particle mating type starch.For implementing to detect, extract starch and analysis albumen (Rahman etc., 1995) wherein from the wheat Ruzhong.Adopt technology known in the art such as SDS-PAGE and immunoblotting that Zulkovsky starch particle fragment is analyzed, its result is used for determining the position that GWD in plant or the cereal or other enzyme change.

Can especially import the active change that starch phosphorylation or degrading enzyme are obtained in one or more heritable variations in the wheat plant by to cereal.That is, heritable variation has caused the change of plant part in vegetative period or budding enzymic activity directly or indirectly, has finally formed above-mentioned treated starch.Heritable variation can be by in the mode introduced plant or progenitor cell as conversion or mutagenesis with the allos polynucleotide.Heritable variation is introduced different genetic background by hybridization subsequently, and this is known plant breeding technology.

GWD in tissue or the plant part or diastatic amount or activity can adopt any known method in this area to measure; for example; by the enzyme analysis; immunologic detection method; Western trace or elisa assay, or relevant mRNA level can be by measuring as Northern blot hybridization technique or reverse transcription-polymerase chain reaction (RT-PCR).In the starch building-up process, also can show the level of enzyme by the level of measuring phosphorylated starch.Having the special protein level of change or the cereal crop or the grain of enzymic activity in its endosperm can screen by protein level or the enzyme level (directly detecting) that reduces, also can screen as the phosphoric acid level that raises or reduce or the visual phenotype of plant or plant part based on the phenotype of the grain of wheat plant, wherein visual phenotype is for example for the grain that dwindles or starch granules character changes or plant forms is learned and changed.The wheat plant of the starch property with change of Shi Yonging can be differentiated by any method known in the art herein, directly detects the wherein character of starch, or indirectly, for example, detects the existence of heritable variation in plant or the grain.Plant can be the strain in the numerous wheat crop family, for example, and the strain in the wheat breeding family.

Production potential

The invention provides the plant that strengthens production characteristic.The production characteristic that can improve include but not limited to, characteristic such as growth, productive rate, biomass and the vigor etc. useful to the grower also have relevant characteristic, as resistance to compression, drought resisting, anti-insect or disease or the flower of improvement or the aesthetic quality of leaf; To the human consumer useful characteristic of results from the agricultural-food of plant, as raising nutritive substance or flavour substances content in human food prods or drink or animal-feed, or to grocery trade or the useful characteristic of processing industry, as improving processing characteristics.In these purposes, plant normally grows for the purposes of its cereal, fruit and other plant part, other plant part comprise leaf, stem, shell, vegetables part and in the mankind or animal foodstuff or beverage as the part animal feed applications or be used for the ornamental plant purposes.In one embodiment, vegetable material of the present invention has the new purposes as the ensiling animal-feed, is that it is incorporated herein as a reference described in the U.S. Patent application of US2006/0150278 at publication number for example.In this embodiment, preferred allos polynucleotide is expressed by transcription regulating nucleotide sequence, it is preferably expressed in the nutrition of plant part, preferred leaf or stem, and more preferably the allos polynucleotide in plant seed with low-level or non-detectable horizontal expression.

According to parameters of interest, can adopt any method known in the art to measure the production potential that increase.

As be shown in the examples, the crop that starch phosphorylation descends causes the output of downstream regulation and control GWD also to show the enhancing of α-Dian Fenmei level.Therefore, in some embodiments, specification sheets provides a kind of production to compare with control plant, reduce the starch phosphorylation level and improved the method for the genetic modification crop of endogenous saccharifying enzyme level, this method comprises, from a large amount of crops, select a strain, wherein the genome a large amount of crops contains the allos polynucleotide that can be operatively connected with transcription regulating nucleotide sequence, endogenous starch phosphorylation is regulated and control in its coding factor downstream, this plant downstream is regulated and control the active of starch phosphorylation and is compared with adjoining tree, and wherein endogenous saccharifying enzyme level increases.Randomly, endogenous polynucleotide can be a mutator gene, for example comprises mutagenesis, and corresponding wild type genes encoding is contained in the enzyme in the starch phosphorylation or regulates albumen, and wherein results of mutation is to reduce starch phosphorylation." a large amount of crop " used herein are meant, at least two kinds of crops, preferred at least 10 kinds of things, more preferably at least 50,100 or 200 kind of crop.Usually, each in a large amount of crops all comprises transgenosis or mutagenesis, but not all shows same degree of modification, but shows the scope in the certain influence degree.Therefore, method of the present invention can comprise a step of selecting or differentiating, wherein discriminated union is selected the plant with best modification level.

In some embodiments, the level of the enzyme that comprises in starch degradation or the starch degradation or functionally active, or starch phosphorylation is lowered to than corresponding control plant low about 80%, 70%, 60%, 50%, 40%, 30%, 20% or 15% level, preferably being lowered to hangs down about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% level, and the raising of acquisition production potential.In a concrete embodiment, the level of the enzyme that comprises in starch degradation or the starch degradation or the reduction of functionally active or starch phosphorylation downstream regulation and control photosynthesis is organized blade for example and is obtained the raising of production potential, or optionally be the starch storage organ, preferred seed.More preferably, in this embodiment, above-mentioned minimizing can make production potential fully increase, compare with the control plant of growing under same envrionment conditions accordingly, these production potential can have usually at least about 20%, 25% or 30%, but particularly at least about 40%, 45%, 50% or 55%, more especially at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or higher increase.Other factors may be also depended in the amount that starch degradation reduces or the minimizing of required starch phosphorylation, for example the level of plant variety or strain and starch degradation, position or opportunity or starch phosphorylation enzymic activity and/or its substrate in the starch degradation approach and/or the level or the activity of accessory molecule or cofactor.But, can think that any optimization that may need in the method is to comprise that described ordinary method obtains herein with those.

Starch degradation reduces and can realize in the tissue of whole plants, for example drives the expression of allos polynucleotide with the degraded of regulation and control starch downstream with constitutive promoter.Optionally, it can be realized with tissue specificity or growth regulating promotor in source tissue's (blade), conveying tissue or energy storage tissue (endosperm)." energy storage cell " used herein and " energy storage tissue " are meant those cells that comprise the organic carbon net inflow, tissue or organ, the organic carbon that flows into is with except the fixed of for example carbonic acid gas, enters cell as the form of sugar or other carbohydrate.In plant, energy storage tissue comprises all non-photosynthesis tissues and has by the organic carbon net inflow of other photosynthesis cell fixation, otherwise perhaps, the photosynthesis tissue of acquisition organic carbon by the mode outside removing carbon dioxide directly fixing and from surrounding medium or environment.

In another embodiment, endogenous starch phosphorylation level is regulated by using the active starch phosphorylase of difference in functionality.This may be to be caused by the difference of the given activity of the enzyme in the Cytology Lab of finishing starch degradation therein or stability.In some embodiment, the activity of the starch degrading enzyme of the endogenous starch that is used for degrading is compared with the level of the corresponding enzyme of control plant and has been improved at least about 10%, 20% 30%, 40%, 50%, 60%, 70%, 80% or 90%, or improve at least about 100%, 200% 300%, 400%, 500%, 600%, 700%, 800%, 900% or 1000%, or be reduced by at least about 10%, 20%, 30%40%, 50%, 60%, 70%, 80%, 90%, 92%, 94%, 96%, 97%, 98% or 99%, or even at least about 99.5%, or 99.9%.The different activities of starch degrading enzyme can be abiogenous, also can obtain by the method for synthetic or reorganization, for example by modifying relevant enzyme or pre-enzyme catalytic site or any other site (as substrate binding site, the cofactor binding site).Usually, modification is by with known in the art, and for example rational or definite mutafacient system or the chemical process of combination replace on the pre-enzyme sequence, increases or deletes at least one amino acid.Different starch degrading enzymes can comprise conservative aminoacid replacement." conservative aminoacid replacement " is that the amino-acid residue that wherein amino-acid residue is had a similar side chain replaces.The existing in the art definition of amino-acid residue family with similar side chain.These families comprise: the amino acid (as Methionin, arginine, Histidine) with basic side chain, have the amino acid (as acid, aspartic, L-glutamic acid) of acid side-chain, the amino acid with uncharged polar side chain is (as glycine, Radix Asparagi vinegar amino acid, glutamine, Serine, Threonine, tyrosine, halfcystine), have non-polar sidechain amino acid (as L-Ala, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane), have β-branched building block amino acid (as Threonine, Xie Ansuan, Isoleucine) and the amino acid with aromatic side chain (as tyrosine, phenylalanine, tryptophane, Histidine).Therefore, the another kind of amino-acid residue that derived from identical side chain family aptly of the amino-acid residue in the pre-enzyme replaces.Optionally, in another embodiment, sudden change can along all or part encode relevant enzyme polynucleotide and introduced at random, for example by saturation mutation, and the enzyme work of the mutant that obtains can be by screening to determine that mutant have the activity different with pre-enzyme.

In another embodiment, the level of endogenous starch degradation and position are to regulate by the ubcellular chamber that directly enters difference in functionality with starch degrading enzyme.In illustrative embodiment, activity is changed in blade and/or seed.It can be finished by the expression of nuclear gene, causes forming in enchylema a kind of enzyme of form, and it does not have the signal sequence that passes to other Cytology Lab.In another illustrative embodiment, the active storeroom that directly refers to as amyloplast or vacuole, or refers to storage and conveying chamber, and for example outer (plasmic) space of born of the same parents is transported to enzyme the Cytology Lab of expectation by comprise signal in enzyme sequence inside from cytosol.Some signal sequence can cause enzymic activity to be distributed between two or more Cytology Labs.

These methods comprise with electrophoretic technique for example, and chromatographic technique (comprising paper chromatography, tlc, vapor-phase chromatography, gas-liquid chromatography and high performance liquid chromatography) is to the plant or the analysis of planting seedlings.Isolating composition normally the standard by will separating curve and known definite thing to recently confirming, or by confirming as the analytical technology of mass spectroscopy and nuclear magnetic resonance spectroscopy.For example, the document that embodiment 9 can reference has: Robinson, The Organic Constituents of Higher Plants, Cordus Press, North Amherst, USA, 1980; Adams etc., Anal.Biochem., 266:77-84,1999; Veronese etc., Enz.Microbial Tech., 24:263-269,1999; Hendrix etc., J.Insect Physiol., 47:423-432,2001; Thompson etc., Carbohydrate Res., 331:149-161,2001; And their reference of quoting.Carbohydrate can be measured with standard scheme well known by persons skilled in the art.

Gene

The present invention includes the modification of gene activity and the structure and the use of mosaic gene." " comprise any deoxynucleoside acid sequence, it comprises that the encoding histone zone of structure gene or its are transcribed rather than are translated to gene to term used herein in cell, and relevant non-coding region and control region.This in conjunction with the territory be usually located at 5 ' and 3 ' terminal coding region near, the about 2kb of the every end of distance.In this respect, gene can comprise control signal, as promotor, enhanser, terminator and/or poly-adenosine signal, its natively with given gene, or allos control signal combination, in this case, gene be meant " mosaic gene ".Be positioned at coding region 5 ' locate, and the sequence that appears on the mRNA is meant 5 ' non-translated sequence.Be positioned at 3 ' or the coding region downstream, and the sequence that appears on the mRNA is meant 3 ' non-translated sequence.Term " gene " comprises the genome form of cDNA and gene.

" wheat GWD gene " used herein or its analogue are meant the nucleotide sequence of coding GWD in the wheat, and those skilled in the art can easily distinguish it with PWD or other albumen mutually.Wheat GWD gene comprises the variation of the natural generation that exists in the wheat, and it comprises those A by bread wheat, the variation of B and D genome encoding, and the variation that takes place of non-natural, and it can be carried out genetic modification and produced by those skilled in the art.In a preferred embodiment, wheat GWD gene is meant nucleic acid molecule, it may reside in or separates from the wheat or derivatives thereof, and it comprises the Nucleotide with at least 80% sequence identical with the GWD gene coding region that provides among the SEQID NO:2.

In a similar fashion, " wheat PWD gene " used herein or its analogue are meant the nucleotide sequence of coding PWD in the wheat, and those skilled in the art can easily distinguish it with other two kinases or other albumen mutually.It comprises the variation of the natural generation that exists in the wheat cdna, and it comprises those A by bread wheat, the variation of B and D genome encoding, and those can carry out genetic modification and variation that the non-natural that produces takes place by those skilled in the art.

The genome form or the clone that contain the gene of coding region can be interrupted by non-coding sequence, and this non-coding sequence is called as " intron " or " transcribed spacer " or " intervening sequence "." intron " used herein is a gene fragment, and it but is not present in the sophisticated mRNA molecule as the part of elementary rna transcription and transcribed.Intron can be removed or " cutting " from nuclear or primary transcription; Therefore intron is not present in the messenger RNA(mRNA) (mRNA).Intron can contain the adjusting composition, as enhanser." exon " used herein is meant and the RNA sequence corresponding D NA district that is present among the ripe mRNA or in the mature rna molecule that RNA molecule there is not translated.MRNA does in translation process in order to determine aminoacid sequence or the order in the newborn polypeptide.Term " gene " comprises the coding of synthetic or fusion all or part of proteic molecule described in the present invention and above-mentioned arbitrary complementary nucleotide sequences.For in the external reservation of cell dyeing or in order to be integrated in the host genome, gene can be introduced in the suitable carrier.

" mosaic gene " used herein is meant that those are at its natural place and non-existent gene.Usually, mosaic gene comprises natural non-existent adjusting and transcribe or albumen coded sequence.Therefore, mosaic gene can comprise the regulating and controlling sequence and the encoding sequence of different sources, or the regulating and controlling sequence in identical source and encoding sequence, but to arrange with the different mode of natural discovery.Term used herein " endogenous " is meant the material that those produce with the research plant isometric growth stage usually in not improving plant." native gene " is meant the natural gene at the genomic natural place of organism." recombinant nucleic acid molecules " used herein is meant by the DNA recombinant technology and makes up or improved nucleic acid molecule.Term " external polynucleotide " or " external source polynucleotide " or " allos polynucleotide " and analogue thereof are meant that operation by experiment is introduced into any nucleic acid of cellular genome.It comprises the gene order of finding in the cell, comprises some and the improvement of the gene-correlation of natural generation (for example suddenly change, selected marker's appearance, etc.) as long as introduce gene.External or foreign gene can be the gene of finding at nature that is inserted into the non-natural organism, is incorporated into the natural gene of new location in the natural host, or mosaic gene." transgenosis " is meant by step of converting and is introduced in gene in the genome.Term " genetic modification " comprises introduces cell with gene, and the regulation and control that make transgenation in the cell and change or regulate gene in cell or the organism make itself or its offspring finish these processes.

Polynucleotide

The present invention relates to various polynucleotides.The implication of " polynucleotide " used herein or " nucleic acid " or " nucleic acid molecule " is the nucleosides polymer, and it can be DNA or RNA or their combination, and comprises mRNA, cRNA, cDNA, tRNA, siRNA, shRNA and hpRNA.It can be a cell, genome or synthetic source, for example DNA or the RNA of automatic DNA synthesizer DNA preparation, and its can with carbohydrate, lipid, albumen or other material combination, can be with fluorescence or other group mark, or depend on solid carrier and have the sp act of definition herein.The polymer of nucleosides can be modified according to methods known in the art, for example, the chain analogue of phosphodiester comprises: thiophosphatephosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, but polynucleotide preferably unmodified or modify and only to occur over just in the cell.Polymer can be a strand, and is basic double-stranded or partially double stranded.An example of partially double stranded RNA molecule is hairpin RNA (hpRNA), short-movie section hairpin RNA (shRNA) or self complementary RNA, it comprises the stem and the covalently bound ring-shaped sequence to nucleotide sequence and complementary sequence thereof of the two strands that is formed by base pairing by nucleotide sequence and complementary sequence thereof.Base pairing used herein is meant the standard base pairing between the nucleosides, comprises the G:U base pair.Two kinds of polynucleotides of " complementary " expression are along their partial-length, or can form base pairing along one or both whole length.Term " polynucleotide " can be replaced with term " nucleic acid " and use herein.

" isolating " is meant that material is dissociated out fully or basically from the composition of following it usually under its native state." isolating polynucleotide " used herein or " isolated nucleic acid molecule " refer to small part, preferred fully or the polynucleotide of from the polymerized nucleoside acid sequence of same type, separating basically, its under native state its be with the polynucleotide of this same type in conjunction with or be connected.For example, " isolating polynucleotide " comprises and being purified or from connecting the polynucleotide of separating its sequence, for example isolated dna fragmentation from common contiguous fragments sequence from both sides in native state.Preferably, isolating polynucleotide at least 90% is free on other composition, as albumen, and carbohydrate, lipid etc.Term used herein " reorganization polynucleotide " is meant by making nucleic acid form the common form of finding of non-natural at the polynucleotide of external formation.For example, recombinant nucleotide can be the expression vector form.Usually, this expression vector comprises exercisable the transcribing and translational control Nucleotide of nucleotide sequence that be connected in.

The invention still further relates to the purposes of oligonucleotide." oligonucleotide " used herein is the polynucleotide that length reaches 50 nucleosides.It can be RNA, DNA or its combination or wherein arbitrary derivative.Oligonucleotide is generally the single chain molecule of 10 to 30 nucleosides of weak point relatively, and normal length is a 15-25 nucleosides.When being used as probe or being used as primer in the amplification test, the minimum size of this oligonucleotide is to form between oligonucleotide and the complementary sequence to stablize the needed size of heterozygote on target nucleic acid molecule.Preferably, oligonucleotide has at least 15 nucleosides, more preferably at least 18 nucleosides, and more preferably at least 19 nucleosides, more preferably at least 20 nucleosides more preferably have the length of 25 nucleosides at least.

As the polynucleotide of probe normally with detectable label, for example radio isotope, enzyme, vitamin H, fluorescence molecule or chemiluminescent molecule conjugated.Oligonucleotide among the present invention is used to detect GWD or other and allelotrope interested proterties (for example starch of modification) genes involved.This method is for example used nucleic acid hybridization, and comprises under many circumstances by suitable polysaccharase Oligonucleolide primers extension (as using among the PCR).

Different oligonucleotide comprises molecules different sizes and/or that can hybridize among the present invention, for example can make wheat cdna group and the close molecule of defined specific oligonucleotides molecule herein.For example, different sizes can comprise extra nucleosides (as 1,2,3,4 or more), or still less nucleosides as long as its still can hybridize with target region.In addition, some nucleosides can be substituted and can not influence oligonucleotide and target region hybridization ability.And, different sizes can easily be designed so that hybridization be adjacent to (such as but not limited to, within 50 nucleosides) the Plant Genome zone of the specific oligonucleotides hybridization of this paper definition.

Term " polynucleotide version " and " version " and similar terms are meant polynucleotide or their complementary type, and its sequence is with identical with reference to the polymerized nucleoside acid sequence.These terms comprise that also those are by adding, delete or replacing at least one nucleosides and the polynucleotide different with the reference polynucleotide.Therefore, term " polynucleotide version " and " version " comprise that one or more nucleosides is increased or deletes, or by the displaced polynucleotide of different nucleosides.Based on this viewpoint, this area is well understood that, can make the reference polynucleotide comprising sudden change, increases, and deletion and some change of alternate thus, make biological function or the activity of the polynucleotide maintenance of change with reference to Nucleotide.Therefore, these terms comprise that those show enzymic activity or other regulates the polynucleotide of active coded polypeptide, or can be as the polynucleotide of selecting probe or other hybridization factor.Term " polynucleotide version " and " version " also comprise the allelotrope version of natural appearance.

With the following polynucleotide of " equate " or " accordingly " expression: (a) have and just the same or to its all or part of complementary nucleotide sequence with reference to the polymerized nucleoside acid sequence; (b) encoding amino acid sequence is identical with aminoacid sequence in peptide or the albumen.This phrase also comprises peptide or the polypeptide that has with reference to the identical aminoacid sequence of aminoacid sequence in peptide or the albumen in its scope.Be used for describing the term that concerns between two or more polynucleotides or the polypeptide and comprise " canonical sequence ", " contrast window ", " sequence identity ", " sequence identity per-cent ", " basic identity " and " same ", and it defines with the minimum of nucleosides or amino-acid residue or above whole length.But the term " sequence identity " of phase trans-substitution use and " identity " are meant based on nucleosides and to nucleosides or based on amino acid amino acid based window are compared in this article, are same sequence scopes.Therefore, " sequence identity per-cent " calculates by following method: two kinds of optimal arrangement sequences in the contrast window, determine that same nucleic acid base is (as A on this position, T, C, G, U) or same amino-acid residue (as Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) appear at the number of matched position in the two sequences, remove the number of the position that matches with position sum (as window size) in the contrast window, multiply by this result with 100 again, obtain sequence identity per-cent.

The identity per-cent of polynucleotide can pass through GAP (Needleman and Wunsch, 1970) analytical method (GCG program) in gap penalty=5, and measures under the condition of gap penalty=0.3.Unless otherwise provide, search sequence is at least the length of 45 nucleosides, the zone of at least 45 nucleosides of two sequences and GAP has analysed and compared.Preferably, search sequence has the length of 150 nucleosides at least, the zone of at least 150 nucleosides of two sequences and GAP has analysed and compared.More preferably, search sequence has the length of at least 300 nucleosides, and the GAP analytical method is than the zone of at least 300 nucleosides of right two sequences, or under every kind of situation at least 400,500 or 600 nucleosides.Can also reference example as by Altschul etc. at Nucl.Acids Res.25:3389, the program of disclosed BLAST family in 1997.Going through of sequential analysis is found in " Current Protocols in Molecular Biology " John Wiley ﹠amp of Ausubel etc.; Sons company, 1994-1998,19.3 parts of the 15th chapter.

When this sequence has at least about 75%, particularly at least about 80%, more especially at least about 85%, the most about 90%, about especially sequence identity of 95%, about more especially 100%, when the most identical, nucleosides or aminoacid sequence are called as " similar substantially ".Be clear that very when the RNA sequence was described to similar in essence to dna sequence dna or have to a certain degree sequence identity, it is identical with uridylic (U) in the RNA sequence that the thymus pyrimidine in the dna sequence dna (T) just is considered to.

The polynucleotide of relevant definition, the identity per-cent of then wishing to occur is than the height in the above preferred embodiment.Therefore, can use the minimum value of the identity per-cent of appearance, its preferred polynucleotide comprises at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, in addition more preferably at least 99.9% with the same polymerized nucleoside acid sequence of described corresponding SEQ ID NO.

Preferably, the polynucleotide with the active polypeptide of GWD of encoding among the present invention has more than 400, more preferably more than 500, more preferably more than 600, more preferably more than 700, more preferably more than 800, more preferably more than 900, even more preferably more than the length of 1000 nucleosides.

Polynucleotide among the present invention is compared with naturally occurring molecule, has one or more sudden changes, and its nucleosides residue is deleted, inserts, or substitutes.Mutant can naturally occurring (promptly separating from natural source), or synthetic (for example, by nucleic acid is carried out determinate variation).

The strict degree that the present invention quotes hybridization conditions defines the complementary scope of two polynucleotides." strict degree " used herein is meant temperature and ionic strength conditions, or during hybridizing the existence or the disappearance of certain organic solvent.Strict degree is high more, and the complementary degree between target nucleus glycosides sequence and the mark polymerized nucleoside sequence is just big more." strict condition " is meant temperature and ion condition, and under this condition, the nucleotide sequence that only has the height base complementrity just can be hybridized.As used in this article term " at low strict degree, in strict degree, high strict degree, or the hybridization under the very high strict degree condition " condition of hybridization and washing described.The guide of implementing hybridization is found in " the general handbook of molecular biology) ", John Wiley ﹠amp; Sons, N.Y. (1989), 6.3.1-6.3.6.Water-based of describing in this bibliography or non-aqueous method all can be used.Term used herein " at low strict degree, in strict degree, high strict degree, or the hybridization under the very high strict degree condition " condition of hybridization and washing described.The characteristics hybridization conditions of indication is as follows herein: 1) low strict degree hybridization conditions is: about 45 ℃, in 6X sodium chloride/sodium citrate (SSC), follow under 50-55 ℃ 0.2XSSC, washed twice among the 0.1%SDS; 2) strict degree hybridization conditions is in: about 45 ℃, and in 6XSSC, then at 60 ℃ of following 0.2XSSC, washing one or repeatedly among the 0.1%SDS; 3) high strict degree hybridization conditions is: about 45 ℃, and in 6XSSC, then at 65 ℃ of following 0.2XSSC, washing one or repeatedly among the 0.1%SDS; With 4) high strict degree hybridization conditions is: 65 ℃, the 0.5M sodium phosphate, 7%SDS, then at 65 ℃ of following 0.2XSSC, 1%SDS washing one or repeatedly.

Polypeptide

The common replaceable use of term " polypeptide " and " albumen ".Term used herein " albumen " and " polypeptide " also comprise the version of polypeptide described in the present invention, and mutant is modified body, similar nothing and/or derivative.The polypeptide of purifying " fully " used herein be meant from its native state bonded lipid, nucleic acid, the polypeptide of separating in other polypeptide and the molecule.Preferably, fully the polypeptide of purifying be meant from its native state bonded composition free at least 60%, more preferably at least 75%, more preferably at least 90% polypeptide." recombinant polypeptide " refers to the polypeptide that makes with recombinant technology, promptly by express recombinant polynucleotide in cell, cell preferred plant cell, more preferably cereal crop cell.

One peptide species can pass through GAP (Needleman and Wunsch, 1970) analytical method (GCG program) mensuration with respect to the identity per-cent of another kind of polypeptide, and condition is gap penalty=5, and gap penalty=0.3.Search sequence has at least 15 amino acid whose length, and at least 15 amino acid whose zones of GAP analytical method comparison two sequences.More preferably, search sequence has at least 50 amino acid whose length, and the GAP analytical method makes it be arranged at least 50 amino acid whose two sequences.More preferably, search sequence has at least 100 amino acid whose length, and at least 100 amino acid whose zones of GAP analytical method comparison two sequences.Even more preferably, search sequence has at least 250 amino acid whose length, and at least 250 amino acid whose zones of GAP analytical method comparison two sequences.

" biological activity " used herein fragment is the part of polypeptide among the present invention, and it has kept the activity of full-length polypeptide definition.In a particularly preferred embodiment, bioactive fragment can be with starch phosphorylation to produce the C6 phosphorylated starch.Bioactive fragment can be an arbitrary dimension, as long as they have kept the activity of definition, but preferably has the length of at least 100 or 200 amino-acid residues.

The polypeptide of relevant definition, hope be: the above-mentioned identity percentage that comprises preferred embodiment that provides will be provided identity per-cent.Therefore, the minimum value that is used for identity per-cent, preferably this polypeptide comprises and provides the corresponding identity of SEQ ID NO and be at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% aminoacid sequence.

The amino acid sequence of polypeptide mutant can prepare by introducing the nucleic acid that suitable nucleosides becomes among the present invention among the present invention, or the polypeptide by external synthetic expectation.This mutant comprises, for example deletion, the residue in insertion or the replacement aminoacid sequence.In order to make final peptide product have desired characteristics, can be used in combination deletion, insert and substitute to obtain final structure.

Sudden change (change) peptide can prepare with any technology known in the art, and polynucleotide for example of the present invention can form through vitro mutagenesis.This vitro mutagenesis technology comprises the polynucleotide subclone to suitable carrier; This carrier is converted into " sudden change " bacterial strain, for example E.coli XL-1 redness (Stratagene), and breeding transform bacteria becomes the filial generation of suitable number again.In another embodiment, the polynucleotide among the present invention is through the technology of shuttling back and forth as broadly described DNA among the Harayama (1998).These DNA technology of shuttling back and forth can comprise and those relevant genes of the present invention, for example derive from the GWD gene of the plant variety except wheat or barley, and/or comprise the different genes (for example wheat GWD gene) that comes from identical plant code albuminoid.Whether the product that comes from sudden change/change DNA can easily come out to have with definite its with the technology of describing herein is screened, as the GWD activity.

In the aminoacid sequence mutant of design, the position in mutant site and the person's character of mutant depend on the characteristic of change.The site of mutant can be modified separately or be modified in groups, for example at first select to replace with conservative amino acid by (1), replace with more radical selection then, this depends on the result that will obtain, (2) deletion target residue, or (3) insert other residue in contiguous site.

The common scope of the deletion of aminoacid sequence at about 1 to 15 residue, is more selected about 1 to 10 residue, and is typically about 1 to 5 contiguous residue.

Mutant alternative is that at least one amino-acid residue in the peptide molecule is removed, and another residue is inserted into its position.The best insertion site that substitutes sudden change comprises the site that is confirmed as avtive spot.Other favourable site is those specific residues that are obtained from the unanimity of different strains or same species.These positions may be very important for biological activity.These sites, particularly those fall into the sequence at least three other identical conservative sites, preferably are substituted in conservative relatively mode.The title that should conservative replacement sees below is the table 3 in " typical case replaces ".

Also be included in the scope of the invention is that polypeptide of the present invention is between synthesis phase or passes through different improved afterwards; the biological example elementization; phenmethylization; glycosylation, acetylize, phosphorylation; amination; by the derivatize of known protection/obstruction group, proteolysis is connected to antibody molecule or other cell ligand is first-class.These improvement can improve the stability and/or the biological activity of polypeptide among the present invention, or help to connect another kind of molecule as part.

Polypeptide of the present invention can prepare in every way, comprises the preparation and the recovery of natural polypeptides, the preparation of recombinant polypeptide and recovery, and chemically synthesized polypeptide.In an embodiment, the isolated polypeptide among the present invention be by cultivate can be under the condition that effectively produces polypeptide can express polypeptide cell, and reclaim that the method for polypeptide makes.Preferred culturing cell is a reconstitution cell of the present invention.Effectively gripping culture condition includes, but are not limited to: what allow that polypeptide produces has effective culture medium, bio-reactor, temperature, pH and an oxygen condition.There is effective culture medium to be meant that cell can cultivate therein to produce any substratum of polypeptide among the present invention.This substratum generally includes, and has the aqueous culture medium and the suitable salt that can absorb carbon, nitrogen and phosphate source, mineral substance, and other nutritive ingredient of can is as VITAMIN.Cell of the present invention can shake bottle at traditional fermenting organism device, and test tube is cultivated in microtiter plates and the culture dish.Cultivation can be carried out under pH and the oxygen condition in the temperature of suitable reconstitution cell.These culture condition are all within persons skilled in the art professional skill scope.

The present invention is meant that those are key elements of exercisable connection or link." exercisable connection " or " exercisable link " and similar statement are meant the connection of polypeptide elemental function.Usually, the nucleotide sequence that can be operatively connected is to connect continuously, and its must be in reading frame in conjunction with the encoding histone zone of two vicinities.When RNA polymerase was transcribed into single RNA with these two encoding sequences, if its translation, it can be translated into the single amino acid whose polypeptide that has from two encoding sequences at that time, and encoding sequence " can be operationally connected to " another encode series.It is located adjacent one another that encoding sequence needs not be, as long as expressed sequence finally produces desirable protein.

Term " cis acting sequence " as used in this article, to be expression be set at when suiting for the expressible gene sequence when it for " the cis acting factor " or " cis regulation and control zone " or " regulation and control zone " or similar terms, can regulate, to any nucleotide sequences of the expression of small part regulatory gene sequence.Those skilled in the art understand cis regulation and control zone and may be able to activate, and silence strengthens, suppress or change expression levels and/or cellular type specificity level and/or gene order transcribe or post-transcriptional level on the expression specificity.In some embodiments of the present invention, this cis acting sequence is the activated gene that strengthens or stimulate the expressible gene sequence to express.

Transcribe " can be operatively connected " promotor of polypeptide or enhanser and be meant that can transcribe polypeptide (for example encoding histone polynucleotide or other transcribe) places under the regulation and control of promotor, it can control transcribing of this polynucleotide then.In allogeneic promoter/structure gene bonded structure, promotor or its version usually preferably are set transcribe the beginning site what transcribe polynucleotide, its approximately with promotor and the gene in its natural setting, controlled between distance identical; Be that those are from wherein deriving the gene of promotor.As known in the art, can be conditioned in some variations of this distance but can loss of function.Equally, in its natural setting, define by key element is set relating to being provided with preferably of the regulating and controlling sequence factor (as operon, enhanser etc.) that is set at the transcribed polynucleotide under its control; Be those deutero-genes.

" promotor " or " promoter sequence " used with its broad sense in this article, and comprises gene region, normally the upstream of RNA coding region (5 '), the initial and transcriptional level that its control is transcribed." promotor " comprises the transcriptional regulatory sequences of classical genomic gene, comprise TATA box and CCAAT box sequence, and other regulatory factor is (as the upstream activation sequence, enhanser and silencer), it is grown and/or environmental stimulus to adapt to, or changes genetic expression with tissue specificity or the special mode of cellular type.Promotor usually but be not must (for example, some PolIII promotor) be positioned at the upstream of structure gene of the expression of its adjusting.And regulatory factor comprises that the initiation site 2kb that is usually located at genetic transcription is with interior promotor.Promotor can contain other the particular adjustments factor, and the more tip that is arranged in initiation site is sentenced the expression of further enhancing at cell, and/or changes the opportunity or the inducibility that can be operatively connected the expression of structural gene on it.

" constitutive promoter " is meant that those guidances can be operationally connected to the transcription sequence expression promoter of some or all tissue of plant.Term composing type used herein is not to be illustrated in the gene of expressing with par in all cells type, and this gene is expressed with the wide region of cell type, although some variation in this level usually is detectable." selective expression " used herein be meant in the plant certain organs and express almost single-mindedly, for example, and endosperm, plumule, blade, fruit, stem tuber or root.In a concrete embodiment, promotor is expressed in all photosynthesis tissues, and all over-ground parts that it is equivalent to plant for example are included in the promotor that is used for the gene that photosynthesis expresses, as oxygenase small subunit promotor.This term can also refer to the expression of specific etap in the organ, as early stage or the late period or the sophisticated different steps of plumule formation; Or by some envrionment conditions or processing abduction delivering.Therefore, the selective expression can form contrast with constitutive expression, and it is meant in some or all tissue of plant, in the great majority of plant experience or the expression under all conditions.

The selective expression also may cause the specified plant tissue, organ or the differentiation of gene expression product in the etap.Specific subcellular location, as endochylema, vacuole or apoplast spatial are distinguished can be by being included in the gene product structure, the suitable signal that can transfer in the cell compartment that needs is realized, or under the situation of semi-autonomous cell organelle (plastid and plastosome), make suitable adjusting sequence enter the cell organelle genome by genetically modified combination.

" organizing specific promotor " or " organ specific promoter " be in a tissue or organ with respect to other tissue or the promotor of preferred expression wherein, preferred great majority rather than all other plant tissue or organs.Usually, in particular organization or the organ promotor with than 10 times the horizontal expression of exceeding in other tissue or the organ.Exemplary tissue-specific promoter is the promotor of high molecular (HMW) glutenin gene Bx17." energy storage tissue specificity promoter " is to compare with other tissue of plant, preferably instruct the plant energy storage tissue (as endosperm, fruit tissue, root tissue, the stem tuber tissue, seed tissue, stem tissue or the energy are stored leaf tissue) in can be operatively connected the expression promoter of transcription sequence, comprise the expression in source tissue's (as blade).

Promotor by the present invention's expection can be the promotor of the natural process conversion of host plant or the promotor that stems from the selectivity source, and its zone in host plant is functional.Other source comprises Agrobacterium T-DNA gene, and biological example synthesizes nopaline, octapine, the promotor of mannosaminic acid gene, or other opine promotor; Derive from the promotor of plant,, as derive from the Ubi promotor of corn ubi-1 gene, Christensen etc., (1996) (for example referring to, U.S.Patent No.4,962,028), or actin promoter as ubiquitin promoter; Tissue-specific promoter is (for example referring to U.S.Patent No.5,459,252, Conkling etc.; WO 91/13992 to Advanced Technologies); From the promotor of virus (comprising host specificity virus), or part or all of synthetic promotor.In list or dicotyledons, many functional promotors be known in the art (for example referring to Greve, (1983), Salomon etc., (1984), Garfinkel etc., (1983); Barker etc., (1983); It comprises various from plant and virus promotors, as cauliflower mosaic virus promoter (CaMV 35S, 19S).Some tissue-specific promoter zones are known, oxygenase small subunit promotor for example, and it is preferentially expressed in leaf tissue.Some the tissue in or other transcription initiation zone of transcribing preferentially is provided under some growth conditions, comprise coming from napin seed or blade ACP, zein and analogue.Fruit-specific promoter also is known, and one of this promotor is the E8 promotor, is described by (1989) such as (1988) such as Deikman and DellaPenna.The non-limiting method of estimating promoter activity is by (1992,1993) such as Medberry, and (U.S.Patent No.5,164,316) such as Sambrook etc. 1989 and McPherson are open.

Interchangeable or other, promotor can be inducible promoter or grow and regulate promotor, it can promote the expression of the polynucleotide that imports in the suitable growth period of plant.In next embodiment, transcriptional regulator is that the growth adjusting promotor on opportunity is expressed in the control that is fit to.The selection of promotor can allow fluctuating of the polymerized nucleoside acid-utilising starch level that imports, in time expresses specially.Promoter sequence can comprise regulates the cis acting sequence of transcribing, adjusting wherein comprises, as, chemistry the inhibition of physics or induce (as, based on metabolic adjusting, light, or other physicochemical factor) or based on the adjusting of different cells (as the similar structures in relevant leaf, root, seed or the plant, referring to U.S. Patent No. 5,459, disclosed root-specific promoter in 252).Like this, promoter region, or this regional regulator site are available from the suitable gene that is conditioned.For example, 1,5-carboxydismutase gene is photoinduced, what can be used to transcribe be initial.Other also is known as the institute's inductive genes such as influence by pressure, temperature, wound and pathogenic agent.

Other cis acting sequence can comprise transcribes and/or translational enhancer.The enhanser zone is well-known to those skilled in the art, can comprise ATG translation initiation codon and contiguous sequence.Initiator codon comprises the reading frame of the sequence of relevant external source of coding or endogenous polynucleotide, to guarantee the translation of complete sequence.The source of translation control signal and initiator codon has a lot, can be natural and synthetic.Translation initiation region can come from the transcription initiation zone, or comes from external source or endogenous polynucleotide.Sequence can also come from the promotor that promotion is transcribed, can be by special transformation to improve the translation of mRNA.

The example of transcriptional enhancer includes, but not limited to the parts and octopine synthetic enzyme (octopine synthase) gene of CaMV 35S promoter, described in (U.S. Patent No.s 5,290,924, incorporated by reference) such as Last.

Nucleotide structure of the present invention comprises 3 ' non-translated sequence usually, and approximately the 50-1000 nucleoside base is right, and it comprises transcription termination sequence.3 ' non-translated sequence comprises Transcription Termination and/or polyadenylation signal, and other can influence the conditioning signal of mRNA effect or genetic expression.The feature of polyadenylation signal is to influence polyadenylic acid and be added into 3 of mRNA precursor ' end.Polyadenylation signal usually can be by discerning with the homology of the form 5 ' AATAAA-3 ' of standard, although version is common.The example of the 3 ' non-translated sequence that is fit to is 3 ' transcribe the untranslated zone, the terminator of T7 transcription product that comprises the octopine synthase gene of the polyadenylation signal (Bevan etc., (1983)) of rouge alkali synthetase (no) gene that comes from Agrobacterium tumefaciens (Agrobacterium tumefaciens) and Agrobacterium tumefaciens.Selectively, 3 ' the non-translated sequence that is fit to can be from plant gene, as come from 3 of the proteinase inhibitor I of potato or tomato or II gene ' end, soybean storage protein gene and 1, the small subunit of 5-carboxydismutase (ssRUBISCO) gene is although other 3 ' factor well known by persons skilled in the art also can be used.Selectively, 3 ' untranslated is regulated sequence and can be obtained by new synthesizing, as, Enzymology, 153:292, the method described in 1987, it is herewith incorporated by reference.

When dna sequence dna inserts between transcription initiation site and encoding sequence section start, for example, 5 ' primer sequence of untranslated (5 ' UTR), can influence genetic expression, can also a kind of special leader sequence.The leader sequence that is fit to comprises that those are selected from the sequence that instructs external source or endogenous dna sequence dna optimum expression.For example, such leader sequence comprises the consensus sequence of a first-selection, and it can improve or keep the stability of mRNA, and stops the initial of unsuitable translation, as described in the Joshi (1987).In addition, the target sequence can be used for the enzyme of target location external source or endogenous polymerized nucleoside acid encoding to the intracellular region chamber, for example, and to the vegetable cell in the chloroplast(id), or to born of the same parents' external environment.For example, the nucleotide sequence of coding transhipment or signal peptide can be operably connected with the sequence of the enzyme of coding selection of the present invention, and when serving as interpreter, transhipment or signal peptide can be transported enzyme to special born of the same parents or the outer point of destination of born of the same parents, can optionally remove after translation.Transhipment or signal peptide act on the proteic transhipment on intracellular membrane, for example, and endoplasmic reticulum, vacuole, capsule, plastid, plastosome and plasma membrane film.For example, the target sequence can instruct required albumen to be transported to special cell organelle, as vacuole or plasmid (as chloroplast(id)), rather than in the cytosol.Like this, nucleotide structure of the present invention further comprises plasmid transit peptides coding nucleotide sequence, and it is connected between promoter region and external source or the endogenous polynucleotide.

Carrier

The present invention uses carrier to carry out the operation or the transfer of gene structure." carrier " refers to nucleic acid molecule, particularly dna molecular, separate certainly, as, plasmid, phage, or plant virus wherein can insert or clone nucleotide sequence.Carrier preferably comprises one or more unique restriction endonuclease sites, and can self-replacation in the host cell of determining, described host cell comprises target cell or tissue or progenitor cell or its tissue, or accumulates the host's who determines genome so that clone's sequence regeneration.In view of the above, carrier can be the self-replacation carrier,, is present in the outer carrier of karyomit(e) integral body that is, and it duplicates with THE REPLICATION OF CHROMOSOME irrelevant, for example, and linear or closed plasmid, extrachromosomal element, minichromosomes, or artificial chromosome.But carrier comprises the mode of any self-replacation.Selectively, carrier can be, when in its transfered cell, genome that can the repeat replication recipient cell, and and complete genome duplicate together.Carrier system can comprise independent carrier or plasmid, two kinds of carriers or plasmid, and it comprises whole DNA together, and it will be imported into the genome of host cell or transposon.The selection of carrier preferably depends on carrier and imports the compatibility of the cell of carrier.Carrier can comprise a selection markers, for example is used to screen the resistant gene of suitable transformant.This resistant gene is known in the art.

Nucleotide structure of the present invention can be directed in carrier such as the plasmid.Plasmid vector generally includes extra nucleotide sequence, its be easy to the screening, the amplification and in protokaryon and eukaryotic expression cassette, transform, for example, pUC carrier, pSK carrier, pGEM carrier, pSP carrier, or pBS carrier.Extra nucleotide sequence comprises replication orgin, and it provides the self-replacation of carrier; The marker gene that can screen, optimized encoding microbiotic or Herbicid resistant; Unique multiple clone site, it provides the multidigit point that inserts nucleotide sequence or the encoding gene in nucleic acid construct; And sequence can improve the conversion of protokaryon or eukaryotic cell (especially plant).

" marker gene " refers to the gene that different phenotypes is passed to the cell of presentation markup gene, makes cell transformed to come with the cell difference that does not have mark.The selected marker has the characteristic with the resistance of selective reagent (for example, weedicide, microbiotic, radiation, heat, or other can destroy the processing that does not have cell transformed).Selection markers gene (or reporter gene) has can be by observing or detect the characteristic of identifying, that is, by screening (as, beta-glucuronidase, luciferase, GFP or other non-existent organized enzyme in unconverted cell).Marker gene and interested nucleotide sequence not necessarily link together.

In order to identify transformant, required nucleotide structure should comprise to be selected or the selection markers gene, perhaps, and the polynucleotide of external or external source.The actual selection of mark is not most important, as long as it has with the selection function of vegetable cell and combines (promptly selecting pool property).Marker gene of the present invention and interested external or external source polynucleotide not necessarily link together, because the cotransformation of the gene of Lian Jieing not, as, in U.S. Patent No. 4,399, to describe in 216, it is effective way in Plant Transformation.

The example of the selected marker of bacterium is resistance marker such as penbritin, kantlex, erythromycin, paraxin or tetracyclin resistance.The selection markers that typically is used to screen Plant Transformation include, but not limited to the to encode hyg gene of hygromycin B resistance; Neomycin phosphotransferase (npt) gene, it has kantlex, paromycin, G418 and analogue resistance, and for example, Potrykus etc. (Mol.Gen.Genet., 199:183,1985) are described; From the hepatocellular glutathione-s-transferase gene of mouse the gsh of weedicide had resistance, described in EP-A 256 223.The glutamine synthetase gene has the resistance of glutamine synthetase inhibitor excessively when expressing, for example careless fourth phosphorus (phosphinothricin) is described in the WO87/05327; The acetyltransferase gene that comes from dark green streptomycete has selective reagent grass fourth phosphorus (phosphinothricin) resistance, described in EP-A 275 957; The gene of coding 5-enol shikimic acid-3-phosphoric acid salt synthetic enzyme (EPSPS) has the tolerance of N-(phosphonomethyl) glycine, described in Hinchee etc. (Biotech., 6:915,1988); Bar gene with bialaphos resistance is described in WO91/02071; Nitrilase gene such as bxn from Klebsiella ozaenae have bromoxynil resistance (Stalker etc., Science, 242:419,1988); Tetrahydrofolate dehydrogenase (DHFR) gene has first Antifolic Acid resistance (Thillet etc., J.Biol.Chem., 263:12500,1988); The acetolactate synthase gene (ALS) of sudden change has imidazolone, sulfonylurea or other ALS-inhibitory substance resistance (EP-A-154 204); The anthranilic acid synthase gene of sudden change has the 5-methyl tryptophan resistance; Or dalapon dehalogenase gene has Herbicid resistant.

Preferred selection markers comprises, but be not limited to, the uidA gene of coding beta-glucuronidase (GUS), wherein various chromogenic substrates are known, coding is used for the β-nougat gene of the enzyme of known chromogenic substrate, aequorin gene (Prasher etc., 1985) may be used to the bioluminescent detection of calcium-sensitivity; Green fluorescent protein gene (Niedz etc., 1995); Luciferase (luc) gene (Ow etc., 1986), it is used for luminous detection and other detection known in the art." reporter molecules " that use in the specification sheets of the present invention refers to those molecules, by its chemical property, can the Analysis and Identification signal, and be used to detect the activity of promotor and associated protein product.

The method that modifying gene is expressed

In certain embodiments, the level of endogenous starch phosphorylation and/or regulate degraded by the expression level that improves nucleotide sequence, the activity of polypeptide in the described sequence encoding vegetable cell, or the expression of gene level of reduction proteins encoded, described albumen is included in the activity of plant.In example, this can obtain in the level of transcribing, and by promotor or the inducible promoter that uses obstructed length, it can control the transcriptional expression level of encoding sequence.In certain embodiments, the heterologous sequence that can adjust or improve the encoding transcription factor of gene expression amount is imported into, and its product reduces has regulated starch phosphorylation.The expression of gene level can be regulated by the copy number that changes in every cell, the structure of described cell comprise encoding sequence and with its transcriptional regulator that can be operatively connected, it is functional in cell.Selectively, can filter out a large amount of transformants, and filter out the characteristic of gratifying level and/or transgene expression, it has influenced endogenous sequence near transgenic insert locus.The gratifying level of transgene expression and pattern can cause the stable raising of plant production potentiality, as the significant reduction of starch degradation in productive rate or biomass or the vegetable cell.This can detect by the simple test at the transformant of different developmental phases.

The reduction of genetic expression can be by importing " gene-reticent mosaic gene " in the host cell importing and transcribing obtain.The silencer mosaic gene can stably import in the genome of host cell, preferred nuclear gene group, or it can import momently, for example in virus vector." the gene silencing factor " of Shi Yonging refers to the expression amount that reduces target nucleotide in host cell herein, the preferred plant cell, and it can obtain by importing reticent RNA.Such reduction can cause the reduction of transcribing, comprises by chromatinic the methylating of recombinating, or the transformation of the RNA molecule after transcribing, comprise degraded by RNA, or the two.Gene-silence needn't be interpreted as the inhibition of target nucleotide or genetic expression.The target nucleotide expression levels is lower under non-existent situation than it under the situation that the RNA of silence exists.Expression levels can reduce at least about 10%, or at least about 15%, or at least about 20%, or at least about 25%, or at least about 30%, or at least about 35%, or at least about 40%, or at least about 45%, or at least about 50%, or at least about 55%, or at least about 60%, or at least about 65%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 100%.Target nucleotide can comprise native gene, transgenosis or virogene or the gene that imports by virus vector.Target nucleotide may further include can stablize the gene that imports, the nuclear gene group of preferred host cell in the host cell genome.

Antisense rna molecule

According to the present invention, use antisense technology to reduce gene expression amount.Term " sense-rna " expression and RNA molecule to the special mRNA complementary element of small part, it can reduce coding mRNA expression of gene amount.This reduction exists in the mode that sequence relies on usually, is considered to transcribe the back incident by interference and produces, and transports to tenuigenin as mRNA from consideration convey, and mRNA stability or translation suppress.The method of use antisense known in the art (as referring to, G.Hartmann and S.Endres, Manual of Antisense Methodology, Kluwer (1999)).In plant, use the technology existing disclosed (Bourque (1995) and Senior (1998)) of antisense.Nineteen ninety-five, Bourque has listed a large amount of antisense sequences that how to use as the example that makes the means of inactivation of gene in families of plant.She even 100% the inhibition that has obtained that any one enzyme lives, it may suppress rather than essential as local, but obtain in system measurable change.Strictly speaking, the antisense method of definition in 1998 still is very definite technology in the genetic expression operation till now.

Use herein, term " the antisense polynucleotide of hybridizing under physiological condition " refers to polynucleotide (all or part of for strand) can form double-stranded polynucleotide to the RNA product of the gene that suppresses at least, the proteic mRNA in the cell under normal operation of normally encoding.Antisense molecule can comprise the sequence that maybe can influence the control of genetic expression or splicing with the corresponding sequence of structure gene.For example, the sequence of antisense can be corresponding with the target gene in coding zone of the present invention, or be 5 '-untranslated zone (UTR) or 3 '-UTR or its combination.Its may with the complementation of part intron sequences, it is spliced when transcribing or after transcribing, and is preferred only at the exon sequence of target gene.Owing to the difference of UTRs is arranged usually, locatees the specificity that these target regions provide better gene inhibition.

The length of antisense sequences is at least 19 successive Nucleotide, is preferably at least 50 Nucleotide, most preferably is at least 100,200,500 or 1000 Nucleotide, and it is with respect to the maximum overall length of the gene of need inhibition.Can use and whole genetic transcription thing complementary full length sequence.Length most preferably is 100-2000 Nucleotide.The degree of the identity of the antisense sequences of target transcript is at least 90%, more preferably 95-100%.Antisense rna molecule certainly comprises incoherent sequence, and it can be used for stable molecule.

The genetic construction of antisence RNA can prepare by being connected promoter sequence in " antisense " direction with the zone of target gene, its refer to herein with respect to the transcribing and translating of the sequence of the target gene in vegetable cell (if any) direction be opposite direction.

Ribozyme

Term " ribozyme " refers to the RNA molecule that can discern special substrate RNA and its fracture of catalysis especially.Normally, ribozyme comprises the antisense sequences and the enzyme zone that is called " catalysis region " of energy specific identification target nucleic acid.The type of the ribozyme of particularly suitable of the present invention is hammerhead ribozyme (hammerhead ribozyme) (Haseloff and Gerlach, 1988, Perriman etc., 1992) and hair clip shape ribozyme (hairpin ribozyme) (Shippy etc., 1999).The DNA of encoding ribozyme can adopt the methods known in the art chemosynthesis.Therefore, the present invention also provides the nucleic acid molecule of the ribozyme of the present invention of encoding.Normally, the DNA of encoding ribozyme can insert expression cassette or transcribe box.In the special ribozyme broken site of any potential target RNA, by the special ribozyme broken site of scanning target molecule, it comprises following sequence GUA, GUU and GUC.In case determine that the short rna sequence that contains broken site between 15-20 the ribonucleotide in corresponding target gene zone comprises the feature that can be used for predict such as secondary structure, and oligonucleotide sequence is not suitable for.When using, ribozyme can be selected from the group of being made up of following: hammerhead ribozyme (hammerhead ribozymes), axehead ribozyme (axehead ribozymes), the special satellite ribozyme (newt satellite ribozymes) of knob, thermophilas ribozyme (Tetrahymena ribozymes) and RNAse P, its be according to methods known in the art based on the sequences Design of target gene (referring to United States Patent (USP) 5,741,679).Suitable candidate's target can be selected by the cross performance that detects they and complementary oligonucleotide, utilizes the ribonuclease protecting test.

Antisense polynucleotide of the present invention, ribozyme under physiological condition, can hybridize with target nucleic acid molecule (as, the mRNA of the polypeptide shown in coding SEQ ID NO:2, the SEQ ID NO:5), these condition called afters in cell are as the special conditions in the vegetable cells such as wheat or barley cell.

RNA interference/double-stranded RNA

Use herein, " manually import the dsRNA molecule " and refer to the dsRNA molecule of direct importing, it may take place by seedbed in transcribing from the mosaic gene of this dsRNA molecule of encoding, do not refer to eukaryotic cell or vegetable cell in the single stranded RNA molecular conversion become dsRNA.RNA disturbs (RNAi) particularly useful to the generation that reduces expression of gene or inhibition specific proteins.Do not obtain restriction although do not wish it theoretically, Waterhouse etc. (1998) provide a kind of model mechanism that is used for reducing protein output by dsRNA.This technology depends on the existence of dsRNA, and it contains the consistent basically sequence with the mRNA of interested gene or its part.Easily, dsRNA can produce from single promotor in recombinant vectors or host cell, justice wherein or antisense sequences are transcribed the back and are produced hairpin RNA, justice wherein and antisense sequences hybridization form the dsRNA zone, form ring texture together with sequence independently, so hair clip shape RNA comprises loop-stem structure.The dsRNA that is fit among the present invention is by those skilled in the art's design and produce, particularly Waterhouse etc. (1998); Smith etc. (2000); WO 99/32619; WO 99/53050; WO 99/49029; And WO01/34815.

In an example, the DNA of importing instruct be blended into small part with the target gene homologous double-stranded RNA product that will be inactivated.Therefore DNA comprises justice and antisense sequences, when it is transcribed into RNA, can hybridize formation double-stranded RNA zone.In a preferred embodiment, justice and antisense sequences separate by the transcribed spacer that comprises intron, are removed when it is transcribed into RNA.Such scheme can cause the efficient of higher gene silencing.Double-stranded region can comprise from one or two next RNA molecule of one or two DNA regional transcription.DsRNA can be divided into long hpRNA, has long, justice and antisense zone, and it can be most of complementary, but not exclusively complementary (being longer than about 200bp usually, in the 200-1000bp scope).HpRNA also can be littler two strands, and approximately 30-42bp is long, but no longer than 94bp (seeing WO04/073390, incorporated herein by reference).The existence in double-stranded RNA zone is considered to excite the reaction from the endogenous plant system, has destroyed the double-stranded RNA and the cognate rna transcript of target plant gene, and it effectively reduces or weakened the activity of target gene.

The justice of hybridization and the length of antisense sequences are the Nucleotide that is at least 19 vicinities, preferably at least 30 or 50 Nucleotide, more preferably at least 100,200,500 or 1000 Nucleotide.Use is equivalent to the full length sequence of whole genetic transcription thing.Length is preferably 100-2000 Nucleotide.The degree consistent with justice of transcribing the target thing and antisense sequences is at least 85%, is preferably at least 90%, and optimum is 95-100%.Sequence is long more, and is more not strict to the conforming requirement of complete sequence.The RNA molecule can comprise incoherently can make the stable sequence of molecule.Promotor is used to express dsRNA-and forms structure, if the dsRNA that produces is for being special in the gene product that is used for destructive cell lineage, it can be various types of promotors.Selectively, promotor can be special pedigree, and it only is expressed in the pedigree of special growth in the cell.This may be favourable for observed and the overlapping of dna homolog that be expressed in the non-target cell pedigree.Promotor can also be by the external source regulatory factor, or environmental factor is induced in the born of the same parents.Normally, the RNA molecule is expressed under the regulation and control of rna plymerase ii or rna plymerase iii promotor, and the latter's example comprises tRNA or snRNA promotor.

The example of dsRNA molecule is for what provide in embodiment 7 and 10, and it can be used for regulating and control the generation that the downstream has the active polypeptide of GWD.

The RNA of other silence can be " not by the RNA of polyadenylation ", it comprises at least 20 successive Nucleotide, has the sequence identity with the sequence at least 95% of the nucleic acid array complementation of target gene rna transcription thing, described in WO01/12824 or US6423885 (draw be with reference to).Also having another kind of reticent RNA is the RNA molecule that (draws and be reference) described in WO03/076619, it comprises at least 20 successive Nucleotide, it has the sequence identity with target nucleic acid sequence or its complementary sequence at least 95%, further comprise most double-stranded region, described in WO03/076619.Reticent RNA can be the double-stranded RNA that comprises justice and antisense strand, and described justice and the mutual base pairing of antisense strand energy are to form double-stranded RNA zone (at least 20 successive Nucleotide of preferred described justice and sense-rna are complimentary to one another).Justice and antisense zone may be present in the RNA molecule simultaneously, as when just and antisense zone form the double-stranded RNA zone, can form hairpin RNA (hpRNA).HpRNA is (as WO99/53050, draw be with reference to) well known by persons skilled in the art.

Little RNA regulation and control are the clearly special branches in the reticent path of gene regulating RNA, and they are different with traditional RNAi/PTGS.Little RNAs is special little RNAs class, and its coding is formed at the distinctive similar factor of gene in oppositely repeating.When transcribing, little rna gene causes stem-ring precursor RNA s, continues to produce little RNAs from it then.The length of little RNAs is about 21 Nucleotide usually.Its miRNAs that discharges merges into the similar mixture of RISC, described mixture comprise the special Argonaute protein protomer that can exercise the special sequence gene inhibition (referring to, for example, Millar and Waterhouse, 2005; Pasquinelli etc., 2005; Almeida and Allshire, 2005).

Suppress altogether

Operable another molecular biological method is common inhibition.The mechanism that suppresses is not very clear that still it is believed to comprise PTGS (PTGS) altogether, and this point may be similar with the example of many Antisense Suppression.It is included in plant " just direction " quiding gene or segmental copy utilizes promotor to express, and it uses herein and refers to the equidirectional (if generation) of transcribing and translating with respect to the sequence of the sequence of target gene.The segmental size of justice, it is consistent with the target gene zone, and it is with respect to the homology degree of target gene such as above-mentioned antisense sequences.In some cases, the additional copy of gene order has hindered the expression of target plant gene.Can referenced patent specification sheets WO 97/20936 and European patent specification 0465572 in implement the method that suppresses altogether.Antisense, common inhibition or double-stranded RNA may comprise a large amount of double-stranded RNA zones simultaneously, preferably comprise nuclear localization signal, described in WO 03/076619.

The method of any reduction genetic expression can be used for coordinating to reduce the activity of many times of genes.For example, the RNA molecule can target the family of corresponding genes involved, by the target region on the total gene.Selectively, incoherent gene can carry out the target location by a plurality of zones of containing in the RNA molecule, each different gene in area target location.This can finish by merge a plurality of zones under the control of single promotor.

Nucleic acid is imported method/conversion in the vegetable cell

Many technology can be used for nucleic acid molecule is imported the plant host cell, and this is well known to those skilled in the art.Term " conversion " means the genotype that changes organism, for example, and by in bacterium or plant, importing the nucleic acid of external or external source." transformant " refers to the organism that changes.The term of Shi Yonging " transgenosis " refers to the plant of genetic modification herein, and its native gene group is added or modifies, and by at random or directional integration, or keeps so that reproducible nonconformity form is stable, imports external or foreign gene or sequence." transgenosis " means that the gene of external or external source or sequence import in the plant.Nucleic acid molecule may be incorporated in the genome of plant securely, also may be replicated as nuclear exosome composition.The hereditable hereditary complement of all of " genome " phalangeal cell, plant or plant part, and comprise chromosomal DNA, plasmid DNA, Mitochondrial DNA and nuclear exosome dna molecular.The term " regeneration " relevant with plant material of Shi Yonging refers to from a vegetable cell, one group of vegetable cell or plant part herein, as seed, or, grow into the whole different plant of strain from the plant part of embryo, scutellum, protoplastis, callus or other tissue.

The special selection of transformation technology is determined by the efficient of the specified plant kind of its conversion and experience and the preference of implementing the selected ad hoc approach of personnel of the present invention.To those skilled in the art is conspicuous, if reached acceptable nucleic acid level of conversion, selects special conversion system that nucleic acid construct is imported in the vegetable cell, not necessarily or limited by the present invention.The transformation system of actual use instructs to some extent at Birch (1997) when being used for plant transformation.

In principle, dicotyledons and monocotyledons all can be improved by conversion, can import nucleic acid construct to recipient cell, grow newborn plant, and described plant contains and expresses polynucleotide of the present invention.

Can in dicotyledons, import and express external or the external source polynucleotide, as, tobacco, potato, leguminous plants, for example alfalfa has been proved to be the T-DNA of tumor inducing (Ti) plasmid that can use Agrobacterium tumefaciens (Agrobacterium tumefaciens) (for example, referring to, Umbeck, U.S. Patent No. 5,004,863, and International Application PCT/US93/02480).Structure of the present invention can be to utilize to contain in the Ti-plasmids Agrobacterium tumefaciens importing vegetable cell.When using the Agrobacterium tumefaciens culture as conversion carrier, the non-carcinogenic strain of preferably using Agrobacterium (Agrobacterium) as carrier so that the differentiation of the normal non-carcinogenic of transforming tissue becomes possibility.Best described Agrobacterium (Agrobacterium) contains double T i plasmid system.Such binary system comprises (1) to have for transfering DNA (T-DNA) being imported first Ti-plasmids and (2) chimeric plasmid in necessary pathogenic zone in the plant.Described chimeric plasmid comprises the fringe region of both sides with the T-DNA of the Ti-plasmids of the wild-type of transformed nucleic acid at least.Double T i plasmid system is highly effective to transformed plant cells, for example, and described in (Nature, 303:179,1983) such as De Framond (Biotechnology, 1:262,1983) and Hoekema.Such binary system is more preferred because it does not need to be integrated into Ti-plasmids in Agrobacterium (Agrobacterium).

Use the method for Agrobacterium (Agrobacterium) to include, but are not limited to: (a) with the protoplastis and edaphic bacillus (Agrobacterium) mixed culture of separation and Culture; (b) with edaphic bacillus (Agrobacterium) transformed plant cells or tissue; (c) with edaphic bacillus (Agrobacterium) transformed the seed, bud point or meristematic tissue; Or (d) breed plant, for example (1993) described colored dip method (floral-dip method) such as Bechtold.This method is based on that the vacuum of the edaphic bacillus cell of suspension invades, and in other words, can use root induction (Ri) plasmid of edaphic bacillus to import chimeric structure as carrier.

Transform cereal grass such as wheat and barley, or the method for other monocotyledons such as sugarcane, it imports heritable variation in the plant by importing exogenous nucleic acid, is used for plant from protoplastis or the regeneration of immature embryo, knows in the art.For example, Wan and Lemaux (1994), Tingay etc., (1997), Canadian patent application No.2,092,588, Australian patent application No 61781/94, Australian Patent No 667939, U.S. Patent No. 6,100,447, International Patent Application PCT/US97/10621, U.S. Patent No. 5,589,617, U.S. Patent No. 6,541,257 and patent specification WO99/14314 in other method of describing.Preferably, produce genetically modified wheat or barley plants by the method for transformation of Agrobacterium tumefaciens mediation.The carrier that is loaded with required nucleic acid construct can import in the regenerated wheat cell of the plant of tissue culture or explant, or in the suitable families of plant as protoplastis.The regenerated wheat cell preferably comes from the scutellum of immature embryo, and sophisticated embryo derives from this callus or meristematic tissue.

Genetic construction can also transform import in the vegetable cell by electricity, as Fromm etc. described (Proc.Natl.Acad.Sci., U.S.A, 82:5824,1985) and Shimamoto etc.(Nature?338：274-276，1989)。In this technology, electricity transforms plant protoplast under the situation of carrier that contains associated nucleic acid sequences or nucleic acid existence.The reverse saturatingization film (reversibly permeabilize membranes) of the high magnetic energy of electricimpulse has caused the importing of nucleic acid.Electricity plant transformed protoplastis has formed cell walls, division again and has formed plant callus.

Another method that nucleic acid construct is imported in the vegetable cell is small-particle high speed trajectory infiltration (high velocity ballistic penetration by small particles) (being also referred to as particle bombardment or particle bombardment), the nucleic acid that is imported into is included in globule or particle matrix inside, or its surface, as described in (Nature 327:70,1987) such as Klein.Although general only the needs imports a kind of new nucleotide sequence separately, this method is particularly useful for many times of importings.

Selectively, can handle vegetable cell so that nucleic acid construct is imported vegetable cell, for example, can utilize micro-pipette directly nucleic acid mechanically to be transferred in the vegetable cell by micro-injection by using machinery or chemical method.In addition, can utilize polyoxyethylene glycol that Nucleotide is transferred in the vegetable cell, its formation has the sediment composite of genetic material, is absorbed by cell.

Existing known multiple monocotyledonous method for transformation.At present, the method for transforming monocots is the particle bombardment of explant or suspension cell, and agrobacterium-mediated gene transformation and dna direct extract or electricity transforms, as, Shimamoto etc. (1989) are described.Streptomyces hygroscopicus bar gene has been imported in the maize suspension culture of cells thing and obtained genetically modified maize plant (Gordon-Kamm, 1990) by particle bombardment.Wheat plant is regenerated from the suspension culture that embryo takes place, and the suspension culture that embryo wherein takes place is by selecting aging (Vasil, 1990) that obtain with callus nodular compacting.Uniting of the transformation system of these farm crop uses acquisition the present invention to be applied to monocotyledons.Genetically modified sugarcane plants is regenerated from the callus that embryo takes place, described in (1996) such as Bower.

Selectively, can improve the efficient of conversion process, for example form wound and mix cultivation (EP-A-486233) altogether again with edaphic bacillus with edaphic bacillus bombardment that is surrounded by micropartical (EP-A-486234) or particle bombardment in conjunction with different technology.

The preferred plant of the present invention is that those are the kind of its valuable product growth or results, and wherein valuable product comprises starch, and it can be used for food, feed, all the other purposes such as fermentation or industrial raw material.

Mutagenesis

Plant of the present invention can be planted and be identified after mutagenesis.Not genetically modified plant can be provided in some market.

(that is to say, sieve from natural source) both can naturally take place in sudden change, also can be artificially (as, by the nucleic acid rite-directed mutagenesis) or induce.Common, former vegetable cell, tissue, seed or plant are easy to mutagenesis to produce the sudden change of monoploid or polyploid, and for example Nucleotide replacement, disappearance, interpolation and/or codon are modified.In this application, " induced mutation " is artificial induction's heritable variation, its may be based on chemistry, radiating or biological mutagenesis, for example transposon or insert T-DNA.Preferred sudden change is invalid sudden change, and as nonsense mutation, phase shift mutation, insertion sudden change or cleavage site mutant, it makes gene completely lose activity.The derivative that inserts Nucleotide comprises 5 ' and 3 ' terminal merge and sequence in insert the Nucleotide of monoploid or polyploid.The mutant that inserts nucleotide sequence is to import one or more Nucleotide in the nucleotide sequence of predetermined point, obtains suitable result product although insert at random also might sieve.The mutant of disappearance is defined as and removes one or more Nucleotide from sequence.Preferably, mutator gene has single sequence and inserts or lack with respect to wild type gene.The coding mutation body that replaces is for having at least one Nucleotide to remove in sequence or inserting different Nucleotide in this position.With respect to wild type gene, the quantity of the substituted Nucleotide of mutant gene mostly is 10 Nucleotide most, more preferably mostly is most 9,8,7,6,5,4,3 or 2, most preferably only has one.Such replacement may be " silence ", because it does not change the amino acid that codon is determined.Selectively, conservative substituent purpose is to change amino acid to be another kind of similar active amino acid." substituting group example " is corresponding in typical conservative substituting group and the above-mentioned table.

Term used herein " sudden change " does not comprise that not influencing active " silence " of gene Nucleotide replaces, and therefore comprises the change of the gene order that influences gene activity.Term " polymorphism " refers to and comprises that " silence " Nucleotide is substituted in the change of any interior nucleotide sequence.

In preferred embodiment, plant comprises the excalation at least of GWD gene.This area is understandable that, contains three genomes as the hexaploid wheat of bread wheat, and it generally is defined as A, B and D genome, and contain two genomes as the tetraploid of durum wheat, it generally is defined as A and B chromosome group.Each genome contains 7 pairs of karyomit(e)s, and it can observe and adopt methods known in the art to identify by cytological method when reduction division.

Can by chemistry or the radiating method obtain mutagenesis, for example handle seed, or gammairradiation with EMS or sodiumazide (Zwar and Chandler, 1995), all be known in the art.Separate the acquisition mutant by the method for screening mutagenesis plant or seed.For example, the wheat of a large amount of mutagenesis sieves by the lower phosphorus acid content of starch in its blade or the grain, detects the mutant of GWD gene by PCR or based on the test of heteroduplex, or detects the GWD protein delation by ELISA.In polyploid plant, preferably sieve the genotype of the active disappearance of one or two group of GWD, for example, in three genomes of wheat plant, two GWD transgenations are arranged, so that seek the active mutant of disappearance repertoire.Selectively, mutant can use as the technology of " tilling " and differentiate come out (Slade etc., 2005) from the mutagenesis body of the reagent mutagenesis of a large amount of usefulness such as EMS.This mutant can be fed in the suitable genetic background, and by the plant hybridization with mutant strain and required genetic background, and the reciprocal cross of implementing suitable number of times is to remove original unwanted parent's background.

Use the peptide of any technology preparation sudden change known in the art (change).For example, polynucleotide of the present invention can be at vitro mutagenesis.The vitro mutagenesis technology comprises goes into the polynucleotide subclone in the suitable carriers, and conversion carrier is to " sudden change " bacterial strain such as E.coli XL-1red (Stratagene) and be fit to the going down to posterity of transform bacteria of algebraically.In another example, polynucleotide of the present invention is with the technical finesse of shuttling back and forth of broadly described DNA among the Harayama (1998).This DNA technology of shuttling back and forth can relate to gene related to the present invention, as the GWD gene in the plant variety except wheat or barley, and/or relates to the different gene of the coding albuminoid in the identical plant.The product of the DNA of sudden change/change can use above-mentioned technology screening to obtain, and determines whether it has, as the GWD activity.

Can directly mutant be imported plant by mutagenesis, or by two kinds of mother plant hybridization are imported indirectly, wherein a kind of parent is contained the mutant of importing.The plant of improvement for example wheat plant can be genetically modified or not genetically modified.Adopt mutagenesis, can obtain lacking the non-transgenic plant of interested function.The present invention also provides grain or other plant part that produces from plant, and the plant arbitrarily that can be used for producing the plant with desired characteristic go down to posterity material, for example tissue of Pei Yanging or cell.The present invention clearly provides the method for the grain of producing or identifying such plant or produced by such plant.

Can adopt known technology TILLING (point mutation detects, Targeting Induced Local Lesions IN Genomes) to produce plant of the present invention.The first step will import in a large amount of plants as the sudden change of new independent base pair change by handle seed (or pollen) with chemical mutagen, and breeding plant can be stably hereditary until sudden change from generation to generation then.Extract DNA, and store seed, create the storehouse, so that can repeat to take in the future from all colonies.

For the TILLING test, need design PCR primer, with the independent interested target gene of specific amplified.If target is a member or the genomic part of polyploid of gene family, specificity is crucial.Then, can adopt the dye marker primer from polyploid DNA of individual storehouse, to amplify the PCR product.These PCR product sex change and annealing are right to form base mismatch.The single nucleotide polymorphism (SNPs) (be in the colony some plants may have identical polymorphism) of Lock-in and the SNPs (promptly only the indivedual plant of minority demonstrate sudden change) that imports are represented in mispairing, or heteroduplex.After forming heteroduplex, utilize endonuclease, as Cel I, discern and the DNA that removes mispairing is a key of finding SNPs new in the TILLING colony.

Utilize this method, can from thousands of plants, sieve identify have that single base pair changes and gene or genomic Special Areas arbitrarily insert or disappearance than the individuality of small segment (1-30bp).0.3-1.6kb the gene fragment in the magnitude range can detect and obtain.In 8 times of storehouses, the fragment of 1.4kb (owing to disturbing the SNP detection difficult that causes that the fragment end is weakened) and every test 96 swimming lanes, this combination makes test each time can sieve out 1,000,000 base pairs of genomic dna, has reached the TILLING high-throughput techniques.

TILLING is at Slade and Knauf (2005), and further describes among the Henikoff etc. (2004).

For more efficient detection sudden change, high-throughput TILLING technology is more satisfactory for detecting the nature polymorphism.So, according to the unknown homologous dna of known array inquiry, demonstrate the quantity and the position of pleomorphism site by heteroduplex.The change of Nucleotide and small insertion and disappearance can be differentiated, comprise the polymorphism of at least some number of iterations.This has been called as Ecotilling (Comai etc., 2004)

Various SNP can note by its Position Approximate in Nucleotide.Therefore, monoploid can be preserved by Gui Ku based on its movability.The DNA part that utilization is used for the identical amplification of mismatch cleavage test can obtain little sequence data increment.Select to be used for the left side or the right side sequencing primer of single reaction by the similarity of itself and polymorphism.The variation of base is compared and found to order-checking software in a large number, and it can be confirmed in gel band.

Ecotilling detects more cheap than complete sequence, be used to find most SNP at present.Can from the plate that contains the ecotypic DNA that sequences, screen, rather than from the dna library of mutagenesis plant, screen.Because gel detection has close base pair resolving power and background mode is unified intersection swimming lane, the band of identical size can match, so find in a step and the genotype of definite SNPs.Like this, the final order-checking of SNP is simple and effective, and the fact is that the part of the identical PCR product that is used to screen is easy to carry out dna sequencing.

The term of Shi Yonging " genetic linkage " refers to the marker gene seat and the position of second locus on karyomit(e) is very approaching herein, and it will common heredity in the reduction division more than 50%, and is for example also nonrandom.This definition comprises that the marker gene seat and second locus form the site of the part of homologous genes.In addition, also comprise the site of the marker gene seat that contains polymorphism, this polymorphism is interested characteristic (in other words, the marker gene seat is a direct and phenotype " chain ").So, can the reorganization per-cent between the observed locus (centimorgan (cM)) will be less than 50 in per generation.In a preferred embodiment of the invention, the genetic linkage locus may be respectively 45,35,25,15,10,5,4,3,2 on the karyomit(e), or 1 or cM still less.Preferably, marker most preferably is about 0cM respectively less than 5cM or 2cM.

Employed, " other genetic marker " can be can be chain with the desired characteristic of cereal crop such as wheat any molecule.Known these marks of those skilled in the art, it comprises and the molecule marker of decision as the gene linkage of characteristics such as gibberic acid content, plant height, flour color in disease resistance, productive rate, phytomorph, grain quality, other potential characteristic such as grain color, the seed.The example of such gene is stem rust resistance gene Sr2 or Sr38 in the wheat, Stripe Rust Resistance Gene Yr10 or Yr17, nematicide gene C re1 and Cre3, decision dough/pasta flexible allelotrope such as Ax, Bx, Dx, Ay, By and Dy on the aleuronat locus, the gene of decision semidwarf habit, therefore have lodging resistance Rht (Eagles etc., 2001; Langridge etc., 2001; Sharp etc., 2001).

The aid mark screening is the method for generally acknowledging, in the standard breeding system, selects required heterozygous plant when backcrossing with backcross parent.Whenever backcross from generation to generation plant population is a heterozygosis, is used for gene of interest, is generally 1: 1 of backcross population, and molecule marker can be used for distinguishing two allelotrope of gene.For example, by from spray, extracting DNA, the characteristic that adopts the required gene of special marker detection to infiltrate, the plant of early screening further hybridizes makes energy and resource concentrate on the minority plant.

The present invention can use any molecular biotechnology that can detect GWD allelotrope or other gene known in the art.These methods include but not limited to, adopt nucleic acid amplification, nucleic acid sequencing adopts suitable label probe to carry out nucleic acid hybridization, single stranded conformational is analyzed (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduple analysis (HET), chemical cracking analysis (CCM), catalytic nucleic acid cracking or their combination (referring to, as, Lemieux, 2000; Langridge etc., 2001).The present invention also comprises the allelic chain polymorphism of using molecular marking technique to detect GWD, and it causes the starch phosphorylation and/or the degraded that change.These methods comprise polymorphism restriction fragment length polymorphism (RFLP), RAPD, and (simple sequence repeats, SSR) detection of polymorphism or analysis for amplified fragment length polymorphism (AFLP) and little satellite.Can easily obtain close linked marker by methods known in the art, as the fractional analysis method, at Langridge etc., described in 2001.

Polymerase chain reaction (PCR) is to adopt " primer to " or " primer sets " contain " upstream " and " downstream " primer, polymerizing catalyst such as archaeal dna polymerase and common heat-staple polysaccharase, in reaction, generate the target polynucleotide repeat copy.The method of PCR is known in the art, as instruction to some extent in " PCR " (Ed.M.J.McPherson and S.G Moller (2000) BIOS Scientific Publishers Ltd, Oxford University).Can pass through the cDNA that reverse transcription mRNA obtains by PCR, described mRNA separates from the vegetable cell of expressing ABA 8 '-'-hydroxylase gene.Yet, usually use from plant isolating genomic dna to carry out that PCR is easier to carry out.

Primer is the oligonucleotide sequence that can hybridize with sequence specific mode and target sequence, and extends in the PCR process.Amplicon or PCR product or PCR fragment or amplified production are the extension products that contains primer and new synthetic target sequence copy.Many PCR system comprises many group primers, can produce the product more than an amplicon simultaneously.Primer can extremely match with target sequence, also can contain interior base mismatch, can introduce restriction enzyme or catalytic nucleic acid identification/shearing site in specially sequence.Primer can also contain extra sequence and/or contain Nucleotide modification or mark so that catch or detect amplicon.The recirculation of DNA thermally denature, the annealing of primer and its complementary sequence and make the target sequence index increase with the polymerase extension annealing primer.Term " target " or " target sequence " or " template " refer to the nucleotide sequence of amplification.

The method of the direct order-checking of nucleotide sequence is that those skilled in the art is known, also can find as among Ausubel etc. and Sambrook etc.Adopt the method that is fit to check order, for example dideoxy method order-checking, chemistry order-checking or their version.Directly order-checking can be determined the arbitrary variation to base pair in the special sequence.

Plant

Vocabulary of terms of the present invention " plant " refers to whole strain plant as noun, but also is used for adjective, refer to be present in, from its acquisition, isolating or relevant, for example with plant from it, plant organ (as, leaf, stem, root, flower), unicellular (as pollen), seed, vegetable cell etc.The meaning of " plant " also comprises the plant seedlings that root and seedling have occurred and the seed of rudiment.Term herein " plant part " refers to one or more plant tissues or organ, and it derives from the whole strain plant that contains starch.Plant part comprises trophic structure (as leaf, stem), root, and floral organ/structure, seed (comprising plumule, endosperm and kind skin), plant tissue (as, vascular tissue, standard weave etc.), cell and its offspring.Term herein " vegetable cell " refers to the cell that derives from plant or this plant, it comprise protoplastis or from plant isolating other cell, gamete produces cell, renewable cell for whole strain plant.Vegetable cell can be cultured cells.Described " plant tissue " means derive from differentiated tissue plant or that obtain from plant (" explant "), or indifferent tissue, it derives from prematurity or sophisticated embryo, seed, root, seedling, fruit, stem tuber, pollen, as the aggregate form of the vegetable cell of tumor tissues such as crown gall and various cultivations, as callus.Typical plant tissue in the seed is endosperm, scutellum, aleurone layer and embryo.

Use, that term " grain " is commonly referred to as is sophisticated, the plant seed after the results herein, but also can refer to grain after imbibition or the rudiment according to context.Sophisticated cereal-granules such as wheat have the moisture content less than about 18-20% usually.

" transgenic plant " herein refer to the plant of the gene that contains structure, its agnate, be non-existent in kind or wild-type plant with strain.That is, transgenic plant (plant transformed) contain the genetic material that did not have before transforming." transgenosis " herein has the ordinary meaning of biological technical field, refers to the gene order that is imported into vegetable cell that produces or change by recombinant DNA or RNA technology.The gene that changes over to can comprise and derives from or separate from vegetable cell, or other vegetable cell, or the non-plant source, or the gene order of composition sequence.Usually, import the gene that transforms by manual operation, as, by any methods that can use such as conversions known to those skilled in the art.In the genome that is integrated into plant that genetic material preferably can be stable.The genetic material that imports can comprise agnate in naturally occurring sequence, but reset antisense sequences for example through sequence reorganization or sequence.The plant that contains this type of sequence includes in " transgenic plant "." non-transgenic plant " is the plant that does not pass through genetic modification that does not import genetic material by recombinant DNA technology.In a preferred embodiment, each transgenic plant of examining each quiding gene (transgenosis) is isozygotied, and separates so that proterties can not appear in its offspring.

Used herein, term " corresponding non-transgenic plant " refers to respect to transfer-gen plant to be the homologous plant but not to change interested gene over to.Preferably, corresponding non-transgenic plant is kind or the kind identical with interested transgenic plant precursor, or the congener pedigree that lacks for structure, is commonly referred to " segregant ", or the plant of " empty carrier " structure being arranged with the conversion of kind or kind, it may be non-transgenic plant." wild-type " herein refers to cell, tissue or the plant of not transforming according to the present invention.Wild-type cell, tissue or plant can be used as blank, with transformation degree and the character of cell, tissue or the plant of contrast expression level of exogenous nucleic acid or transformation of the present invention.

Transgenic plant in the context of the invention comprise and utilize recombinant technology to carry out the plant offspring of genetic modification that wherein the offspring is contained interested transgene.The mode of mode that can be by initial transgenic plant selfing or the plant hybridization similar with other obtains such offspring.This can be used for usually regulating at least a at needs plant or plant organ in the production of albumen/enzyme.Transgenic plant partly comprise described all parts and the whole cell that contains transgenic plant, as tissue, callus and the protoplastis of cultivating.

Can use several method and go to determine genetically modified existence in the plant after conversion.For example, can use the unique sequences in polymerase chain reaction (PCR) the amplification conversion plant, utilize gel electrophoresis or other method to detect amplified production.Can utilize ordinary method to extract DNA, adopt primer to carry out the PCR reaction with the special DNA that increases, its existence is used for distinguishing and transforms and non-plant transformed.For example, primer is designed to increase and reads in dna fragmentation in the conversion carrier structure, and reverse primer designs according to interested gene.These primers are the fragment of the successful plant transformed of amplification only.The Southern blot hybridization technique that a kind of replacement method of definite positive transformant is known in the art.Plant transformed can also be distinguished by the phenotype of itself and non-conversion or wild-type plant, but whether as the existence by the comparison selectable marker gene, or the phenotype of the minimizing of the phosphorus acid content of the starch by plant seed, or by relevant phenotype, as the increase of production potential.

As used herein, " rudiment " tip of a root occurs after referring to kind of skin imbibition, and " percentage of germination " referred in the certain period has germinate after imbibition in as 7 days or 10 days for how many seeds, and a large amount of seeds are carried out evaluation every day to determine percentage of germination in these periods.

About seed of the present invention, the term of Shi Yonging " percentage of germination is basic identical " is meant with homologous non-transgenic seed germination rate and is at least 90% of homologous non-transgenic rate of emergence herein.Percentage of germination can be by technique computes known in the art.

Plant provided by the invention or that expection is used comprises angiosperm and gymnosperm, in angiosperm, comprises monocotyledons and dicotyledons.In a preferred embodiment, plant of the present invention be cereal crop (as, cereal class and beans, corn, wheat, potato, cassava, rice, Chinese sorghum, grain, sweet cassava, barley, or pea), or be other legume crop.The crop that plant can be to be planted because of its edible root, stem tuber, leaf, stem, flower or fruit.

In certain embodiments, transgenic plant are cereal crops.The example of cereal crop includes but not limited to, wheat, barley, rice, corn, Chinese sorghum, oat and rye.Preferred, cereal crop is wheat, barley, corn or Chinese sorghum.Example comprises wheat, rice and Chinese sorghum.

Term herein " wheat " refers to any kind of Triticum plant, comprises its precursor, also comprises the offspring that itself and other mixing breed produces.Wheat comprises that genome is configured as AABBDD " hexaploid wheat ", and it comprises " tetraploid " that 42 karyomit(e)s and genome are configured as AABB, and it comprises 28 karyomit(e)s.Hexaploid wheat comprises T.aestivum, T.spelta, T.macha, T.compactum, T.sphaerococcum, T.vavilovii, and the species hybridization kind between them.Tetraploid comprises T.durum (also referring to flint wheat or Triticum turgidum ssp.durum herein), T.dicoccoides, T.dicoccum, T.polonicum, and the species hybridization kind between them.In addition, term " wheat " comprises hexaploid or tetraploid potential precursor, and wherein the A chromosome group derives from Triticum sp. such as T.uartu, T.monococcum or T.boeoticum; The B chromosome group derives from Aegilops speltoides; The D genome derives from T.tauschii (being also referred to as Aegilops squarrosa or Aegilops tauschii).The wheat breed that the present invention uses can belong to, but is not limited to, above listed any.Also comprise the plant of adopting routine techniques to cultivate, it adopts Triticum sp. to belong to (as rye [Secale cereale], including but not limited to Triticale) sexual hybridization acquisition as parent and non-Triticum.Preferably, described wheat plant is suitable for commercial plantation results grain, for example the commercialization kind or the durum wheat of hexaploid wheat, and known its of those skilled in the art has suitable agriculture characteristic.

The term of Shi Yonging " barley " refers to any kind of Hordeum herein, comprises its ancestors and the offspring who produces with other mixing breed.Preferably, plant is the commercial barley variety of cultivating, as, the strain of Hordeum vulgare or Cultivar or subspecies or be suitable for the kind of commercial production grain.

Foodstuff production

The invention provides the plant of improving the improvement of producing potential.In certain embodiments, it is edible that it can be used for the results back.

Conspicuous, food plant comprises fruit, nut or has gathered in the crops the vegetables of leaf, stem, fruit, stem tuber, seed and beanpod.

On the other hand, the invention provides cereal grass and grain, preferably wheat, it is used for food or fodder production, and wherein said grain contains the starch of the phosphorus acid content that changes and the amylolysis enzyme level of change.The grain that obtains from plant is preferably in the GWD activity level that has reduction in the endosperm of growth.Plant of the present invention is used for food, is preferably used in the commodity foods prods.Described foodstuff production can comprise to be made flour, dough/pasta or can be used as the other products that commercial food product is produced composition.At an embodiment who is used for foodstuff production, the relative wild-type plant of the phosphorus acid content that seed of plant or grain have, basic identical, or raise; The level of lytic enzyme, especially one or more amylase as α-Dian Fenmei or beta-amylase, reduce because of the sudden change of transgenosis or introducing; The sudden change of described transgenosis or introducing is the expression of gene amount that has reduced this lytic enzyme in the coding grain.Flour or dough/pasta available from this grain have the quality that can think when curing or making other foods prods, it is based on the viscosity of starch change and/or the amylase level of reduction.In an alternative embodiment, being used for the seed of the plant that animal-feed or industrial use such as bio-ethanol produce or the phosphorus acid content of grain reduces with respect to wild-type plant, the activity level of lytic enzyme, one or more amylase particularly, as α-Dian Fenmei or beta-amylase, owing to the phosphate content that reduces raises, as above shown in the example.Thus obtained grain or starch product have the digestibility of raising when it is used for feed; When it is used for alcohol production, has the transformation efficiency of raising.

The genetic background of plant expection also will be considered agriculture productive rate and other characteristic.These characteristics comprise whether expect to have winter type and spring type, agriculture performance, disease resistance and resisting abiotic pressure.For Australian use, can make the wheat plant and wheat breed hybridization, wherein wheat breed such as Baxter, Kennedy, Janz, Frame, Rosella, Cadoux, Diamondbird or other kind commonly used that change starch property.Other kind may be appropriate to other growth district.Plant, especially wheat, kind of the present invention provides 105% the productive rate of being not less than with respect to wild-type at some growth districts, or even is not less than 110%, is more preferably and is not less than 115%.Productive rate can easily be measured by the test of contrast field.

In another embodiment, the starch content of grain is at least 25%, 35%, 45%, or 55%-65% (w/w), increases with respect to wild-type.Commercial wild wheat generally has the starch content of 55-65%, according to different growth kinds and difference.Relative, seed of the present invention or grain contain at least 90% starch content with respect to the grain of wild plant, and preferably at least 95%, 100%, 102% or 105%.The characteristic of all the other hope comprises the hardness of the ability that grinds grain, particularly grain.Another makes wheat plant have the aspect of Peak output, is the degree of extracting starch from grain, and high more extraction yield is favourable more.The form of grain is the another kind of aspect that influences the plant commercial use, and whether the form of grain can have influence on grain and can be ground.

Can adopt method separating starch from the grain of grain of the present invention such as wheat of standard, as adopting the method (1991) of Schulman etc.On industrial production, can use wet-milling or dry grinding.The size of starch granules is crucial during for A particle that will be bigger in the starch processing industry and less B particle separation.

Foods prods

The present invention also comprises food, drink or the pharmaceutical preparation with this products production, and particularly those comprise the starch that obtains from plant of the present invention or grain.These foods prodss can comprise flour, dough/pasta or other products, and it is the composition of commercial food product product.The product that contains starch of grain of the present invention or acquisition can be used for many food compositions for people's consumption, and " people " refer to modern humans (Homo sapiens) herein.

Isolating grain can easily be used for the food-processing program from the wheat plant of improvement, therefore the present invention includes ground, pulverizing, corase grind, grain pearl or backing, or the product of processing acquisition, or the Wholegrain of plant of the present invention, comprise flour.These products can be used for various foods prodss, as bread, cake, biscuit and similar amyloid product, or foodstuff additive such as thickening material or tackiness agent, or be used to make beverage, noodles, pasta or instant soup.Separation is from the grain of grain of the present invention or product is preferably used in breakfast cereal food or as extruded product.Starch of the present invention can also be used to form high-intensity gel, and it can be used for the candy industry or reduces mold and set time.It can also be used as dressing, for example, can reduce the pick up the oil of fried potato or other food.This starch can also use together with fat or oil production, for example oleomargarine or shortening, the salad seasonings, egg-products such as mayonnaise, milk-product such as ice-creams, sour milk or cheese, grain products such as corn or wheat-flour, fruit juice, other food or foodstuff raw material, or the starch that changes can be processed into beverage or food, as bread, cake, biscuit, breakfast cereal food, pasta, noodles or sauce.

In bread, the starch product of flour or semolina form can be replaced 10% (w/w) or more not improved flour or semolina, preferably replaces at least 30% even more, at least 50% unaltered flour or semolina.Therefore fill a prescription can be, as, 90 parts of flour, 10 portions of improved wheat starches, 2 parts of fat, 2 portions of salt, 1 part of modifying agent, 2.5 parts of yeast.Can make bread product by other technology of the known quick dough/pasta technical profession of those skilled in the art.

Selectively, starch product of the present invention can mix in the starch of batter products.The amount of the starch product of using in batter composition of the present invention can be in the scope based on the 10-100% on the basis of starch material total amount (w/w), preferably in the scope of 10-80%.Those of skill in the art in this area can easily select other starch material of being fit to.Can also in composition, add other raw material, as dehydration or liquid egg (yolk, albumen or shell egg) or high protein material, as milk-protein or fish-protein.Can also add VITAMIN, mineral substance, calcium salt, amino acid, buffer reagent such as Sodium phosphate dibasic, seasonings, gel, seitan or glyceryl monostearate etc.

Other edible part of plant of the present invention can be used for human consumption's food or be used for animal-feed.For example, from the blade that contains cell of the present invention, stem, root, stem tuber, fruit, beanpod, or extract or their part can be used for the consumer's goods of the mankind or animal.Use as the plants of the fruit of fresh or processing or vegetables is well known in the art, and these application include in the present invention.Plant of having improved digestibility of the present invention and its part can be used for the raw material of animal-feed, as, pig feed, ox feed, and horse feed, bird feed such as chicken and other animal-feed etc.Particularly, the benefit that can reckon with is the product that is used for transformation efficiency and the raising starch digestion rate growth rate that improves subsequently of animal-feed.

Food or drink or pharmaceutical preparation can package to sell or to be the large volume form.The present invention also provides the preparation method based on food of the present invention, drink or pharmaceutical preparation, and the prescription and the usage that prepare these food or drink.Method can comprise the step of results plant or plant part, isolates grain from other plant part, and pulverizing is extracted, and grinds cotton ginning, culinary art, system jar, packing, or other existing known procedure of processing.Method or prescription or usage can comprise the step of handling plant prod of the present invention and/or they are mixed with other food ingredient, such as heating or baking mixture or product extremely, and for example at least 100 ℃.Method can comprise the step of wrapped product to sell.

Feed and animal purposes

The product of plant of the present invention and acquisition or industrial goods, especially Shou Huo product, for example grain can be used for animal-feed.Be not limited thereto, be understandable that owing to increased the digestibility and the bioavailability of starch in the product.In a preferred embodiment, this is relevant with the raising of amylase level in the product.Although the minimizing of starch phosphate content may cause that digestibility reduces in the product, the amylase level that raises the especially level of α-Dian Fenmei can be offset these, and last result has increased digestibility.Become the transformation efficiency of animal product for feed conversion, this also has special advantage, and it can increase at least 2% with respect to the corresponding wild type product that does not have to change, and preferably at least 5% or at least 7%.This advantage both can be embodied in as on one's body the animalcule of chicken, calf, this class of lamb, was also embodied on one's body some adult animals.The transformation efficiency of feed can adopt existing known method to measure.

Industrial applicibility

Plant prod, especially grain have special advantage in Industrial products such as alcoholic acid production.The output parameter that increases, as the above-mentioned increase of mentioning starch to the transformation efficiency of sugar, special benefit is provided.For example, the product that starch can be converted into sugar of the present invention is used for fermentative production, it has reduced the diastatic amount of external source that needs interpolation, and reaction can be carried out under the temperature that reduces, so reduced energy expenditure.The present invention further describes by following embodiment, and it does not have the qualification effect.

Embodiment 1 material and method

The extraction of starch in the cereal

Micromill with Metefem (prototype) is pulverized ripe seed, and crushed material is crossed the 0.5mm sieve.The semolina that obtains is weighed, and the water that adds 50% weight is with softening gains.By mechanically mixing water and flour obtain dough.Add excessive water, from gluten, extract starch, then described starch suspension is passed through 100 μ m filter paper filterings to remove residue.Repeat to extract 4 times or in dough no starch residual.By centrifugal with starch granulate (5,000rpm, 10 minutes, 4 ℃).Remove the albumen of covering, starch is resuspended in the excessive water.Repeated washing 3 times.The starch that extracts is carried out lyophilize in FTS freeze drier (Model No.FD-3-55D-MP).Adopt this method, 10g cereal approximately produces 6g flour and 3g starch.

The extraction of starch in the blade

Adopt method of (2005) middle descriptions such as Delvalle from crop leaf, to extract starch.The blade sample is carried out lyophilize, sample is placed to extract in the damping fluid (MOPS 100mM, pH7.2, EDTA 5mM, ethylene glycol 10% (w/v)) in 15-25ml with the Polytron agitator on ice then and pulverize.This mixture is filtered and centrifugal by two-layer magical filter cloth (Miracloth), keep amyloid particle.Then in 4 ℃ by 90%Percoll gradient 4, centrifugal 40 minutes of 000rpm is with purifying starch.

The mensuration of phosphoric acid salt and G-6-P level in the starch sample

The total phosphate Determination on content adopts and selects from Ekman and Jager, the Victoria Green WPB of (1993) (Malachite Green) method in the starch.By dissolving in the DMSO solution that the 10mg dry starch is resuspended in 500 μ l 10%, boiled this mixture 10 minutes.With 200 μ l solution and 200 μ l Clark and Lub damping fluid (0.054M KCl, 0.145M HCl); 120 μ l H ₂O; 80 μ L 4M HCl and 3: 1 (0.2% malachite green solutions: (NH among the 4M HCl of 200 μ L Victoria Green WPBs ₄) ₆Mo ₇O ₂₄(4H ₂O) 10% solution) mix.The phosphate group of acid hydrolysis C6 and C3 is by Victoria Green WPB test determination free phosphoric acid.Optical density (OD) with spectrophotometric determination 660nm place.G1P solution standard substance with 0.01-5mM are drawn the typical curve that is used to measure the starch sample.Usually with the content of 3 this mensuration of increment phosphoric acid, average expression amount is in every mg starch mmole.

Delrue etc. is selected from employing, amyloglucosidase test determination G-6-P (G6P) level of (1992).As described below, glucose-6-phosphate dehydrogenase (G6PD) is specifically designed to this test.The 5mg dry starch is dissolved in the DMSO aqueous solution of 500 μ l10%, boils 10 minutes with dissolving starch.Dilution double sample.Starch in each sample is by the effect of 70 μ l amyloglucosidase solution (AGS, the starch detection kit of Enzytec), in 55 ℃ of degradeds 2 hours.By adding 350 μ l water and 350 μ l solution 1 (TEA pH of buffer 7.6, NADP, ATP (the starch detection kit of Enzytec)) termination reaction.The OD value (being set at ODo) that adds the preceding 340nm of mensuration of following reagent place.First series is used to measure amount of starch, adds 5 μ l solution mixtures (Hexokinase and G6PdH (the every 0.7ml of 200U/100U, the starch detection kit of Enzytec).Second series is used to measure G6P amount, adds G6PdH (G7877-2KU, Sigma, 18 units/ml) that 5 μ l do not contain hexokinase.This mixture was hatched the OD value at measurement 340nm place 15 minutes in 25 ℃.Every replicate measurement in 10 minutes until OD value stabilization (being set at ODf).

Measure with Equation for Calculating amount of starch or G6P:

[starch or G6P] [mg.ml ^-1The x1.069/ of]=(ODf-ODo) dilution factor

First series is measured starch concentration and the amount of starch in each sample, and second series is measured the G6P amount that exists in the starch.

The starch small grain size distribution

The particle size dispersion of isolating starch sample is prepared into water-soluble starch slurry, and (Malvern UK) measures for 2600c Droplet and Particle Sizer type, Malvern instrument to adopt the laser diffraction particle analyser." A particle " is defined as by the analysis-e/or determining diameter greater than 10 μ m, and " B particle " is that diameter is less than 10 μ m.The frequency that particle size dispersion described herein is expressed for the B particle accounts for the per-cent (Stoddard, 1999) of starch granules cumulative volume.

Starch property

The glycosidic linkage that discharges amylopectin in the sample with isoamylase to starch sample debranching enzyme after, analyze the distribution of starch medium chain length.Carry out the auxiliary carbohydrate electrophoresis of fluorophor (FACE), adopt P/ACE 5510 electrocapillary phoresis systems (Beckman) to detect with argon-LIF as description such as O ' Shea (1998).

At Pyris 1 difference scanning calorimeter (Perkin Elmer, Norwalk CT, USA) the middle gelling temp of measuring each starch sample.This is analyzed and directly measures the required energy of starch gel gel.The preparation of starch be by with starch and water with 1: 2 (dry starch: ratio pre-mixing water).This mixture is full of DSC dish and sealing.Contrast is blank panel.(gelation and amylose starch-fat decomposes) per 2 temperature measurings 4 times: initial (initially) temperature, peak temperature, whole last temperature and enthalpy.

(Warriewood Sydney) measures the viscosity of starch solution, for example adopts Batey etc., the conditions of 1997 reports for RVA, Newport Scientific Pty Ltd with quick viscosity analyser.The parameter of measuring comprises peak viscosity (maximum heat slurry viscosity), maintenance intensity, whole last viscosity and gelatinization point.

Measure the expanding volume of flour or starch according to the method for (2001) such as Konik-Rose.Be by under 90 ℃, weigh flour or starch with before water mixes and with the mixed sample of water, measure the water that absorbs, collect the material of gelation then.

By gel permeation chromatography fractional separation starch

Sepharose infiltration column chromatography is used for separating amylopectin (macromolecule) part and amylose starch (small molecular weight) part from starch, with the 1-2.5mg starch dissolution in 500 μ l 10mMNaOH, be used for agarose CL2B post (0.5cm internal diameter x65cm is long), also carry out chromatography with this solution with 10mMNaOH balance chromatography column.The collection rate of 250-300 μ l part is 1 part/1.5min.According to (Starch/die such as Banks

23:118-124,1971) iodo-polysaccharide interacts or measures the dextran of every part by glucose test (Enzytec).

Adopt the colorimetry (iodometric titration) of Morrison and Laignelet (1983) to carry out following improvement slightly, measure the amylose content of starch sample.Accurately the about 2mg starch of weighing (being accurate to 0.1mg) has to the lid in the 2ml screw capped tube of squeegee of suitable size.Remove fat, 1ml 85% (v/v) methyl alcohol is mixed with starch, this test tube of heating also shook in 1 hour frequently in 65 ℃ of water-baths.13,000g carefully removes the upper strata suspended substance after centrifugal 5 minutes, repeats extraction step.Then in 65 ℃ of dry starch 1 hour and be dissolved in urea methyl-sulphoxide (UDMSO; 9 volume methyl-sulphoxides are than 1 volume 6M urea), every 2mg starch (above-mentioned weighing) is with 1ml UDMSO dissolving.Acutely shake this mixture immediately, in 95 ℃ of water-baths, hatched 1 hour and shook by phased manner to dissolve starch fully.Starch-UDMSO solution (50 μ l) is partly with the 20 μ lI that contain 2mg iodine and 20mg potassiumiodide in every ml water ₂-KI agent treated.Described mixture water is complemented to 1ml.The described mixture of 200 μ l is transferred to small plate, and (molecular device USA) is measured the absorption value of described mixture at the 650nm place with the accurate small plate reader of Emax.The standard samples that contains 0-100% amylose starch and 100%-0% amylopectin that obtains from potato amylose starch and corn (or potato) amylopectin (Sigma) is as test sample.Use the absorption value in the regression equation that obtains by standard samples to measure amylose content (amylose starch per-cent).

The α-Dian Fenmei test

Adopt the Ceralph amylase detection kit of Megazyme International Ireland Ltd to measure α-Dian Fenmei in flour or the semolina sample according to suggestion operations.Based on the hydrolysis of α-Dian Fenmei to oligose, alpha-glucosidase excessive in the mixture is hydrolyzed to produce glucose and free p-nitrophenol to this oligose.Necessarily, cereal extract part and substrate mixture were hatched termination reaction, the colour developing of adding weak caustic solution 20 minutes in 40 ℃.Measure the absorption value at 400nm place, directly related with the level of α-Dian Fenmei in the sample.The result is with every g flour or extract C U (ceralpha unit) expression.

Carrying out wheat by particle bombardment wheat prematurity plumule transforms

Bag is by the goldc grains of two kinds of plasmid pure dnas: the plasmid DNA of 2 μ g coding selectable marker genes (npt), in the present embodiment pCMneoSTLS2 (Maas etc., Mol Breeding, 3:15-28,1997) and the plasmid DNA of 2 μ g coding gene of interest, in the present embodiment pBx17-GWD_IR, by (Plant Cell Reporter, 11:586-591, the 1992) CaCl such as Cao that describe before ₂/ spermidine precipitation.Described goldc grains/DNA mixture contains the 30mg/ml goldc grains that mean size is 1.5-3.0 μ m.50 immature plumules that are used to bombard, 12 days about 1.5-2mm length is separated and removes plumular axis after flowering period.They are placed contain the agar plate center that height oozes the MSM substratum, it is the MS substratum that contains 150g/l maltose and 0.1g/l meso-inositol, to form the target area of about 3cm diameter.As (Plant Cell Reporter such as Vain, 12:84-88,1993) to describe, the target plumule is cultivated (pre-treatment) 4 hours on the MSM flat board, (about 85kPa) adopts the biological transfer system of PDS-1000/He under partial vacuum then, bombarded by the mixture of goldc grains with 5 μ l bag.Distance between load DNA and the target plumule is 9cm, used pressure position 900kPa.

Regeneration/the screening of transformant

With the bombardment of described plasmid mixture after 24 hours, plumule is transferred on the MSR substratum (MSR substratum, pH5.9 contain 30g/l sucrose, 0.1g/l meso-inositol and 2.5mg/l2,4-D) in the dark place 24 ℃ cultivate and carried out the plumule somatic induction in 14 days.Then culture is transferred to and selects as selective reagents, to place 16h illumination (about 25 μ E m with 50mg/l Geneticin (G418) on the substratum MSWG50 (MS substratum, pH5.9 contain 30g/l sucrose, 0.1g/l meso-inositol) ^-2s ^-1) and the 8h dark in.Then every 3 weeks they being transferred on the new flat board of selecting substratum MSWG50.The little crop that forms places to be commissioned to train again and again on the fresh MSWG50 and supports with further growth.The little crop that about 10-15cm is high migrates to 2 weeks in the soil of misting platform, and being transferred to temperature then is in the greenhouse at 24 ℃ (daytimes) and 18 ℃ (nights).By from tissue samples, extracting DNA and carrying out PCR with the transgenosis primer special and react the genetically modified existence of determining in the regeneration crop.

The extraction of crop sample rna and quantitative RT-PCR

Technical specification according to supplier adopts the mini test kit of Rneasy crop (QIAGEN, Hilden, Germany) the total RNA in the extraction blade sample.With oligodT is primer, adopts the synthetic cDNA of Invitrogen article one chain synthetic agent box.Detect single-minded amplification with Brilliant SYBR Green QPCR MasterMix (STRATAGENE).Detect special fluorescence in the 520nm place, with the MX4000 analysis software by analyzing with the particular criteria curve ratio.(QIAGEN, Hilden Germany) carry out an one step RT-PCR s to adopt Qiagen one one step RT-PCR test kit.

The evaluation of GWD and PWD gene in embodiment 2 wheats and other cereal

Be used for the aminoacid sequence (Accession No.AAK11735) of potato R1 protein sequence and Arabidopis thaliana PWD albumen (NP_194176) as the query sequence at ncbi database, adopt the BLASTN program, inquiry wheat est sequence.Identify 17 ESTs (being listed below), lining up is combined into 2273 base-pair sequences (SEQ ID NO:1).

dbj|CJ626658.1|CJ626658?Y.Ogihara?unpublished?cDNA?library.

gb|CV773056.1|FGAS067452?Triticum?aestivum?FGAS?library.

dbj|CJ694861.1|CJ694861?Y.Ogihara?unpublished?cDNA?library.

gb|CA743865.1|wrils.pk006.k23?wrils?Triticum?aestivum?cDNA.

gb|BQ240991.1|TaE05010D07R?Ta05?Triticum?aestivum?cDNA.

dbj|CJ696711.1|CJ696711?Y.Ogihara?unpublished?cDNA?library.

dbj|CJ730334.1|CJ730334?Y.Ogihara?unpublished?cDNA?library.

gb|BQ237936.1|Ta05010D07F?TaE05?Triticum?aestivum?cDNA.

gb|CK197520.1|FGAS005996?Triticum?aestivum?FGAS?library.

dbj|CJ650741.1|CJ650741?Y.Ogihara?unpublished?cDNA?library.

dbj|CJ542660.1|CJ542660?Y.Ogihara?unpublished?cDNA?library.

gb|CK197837.1|FGAS006317?Triticum?aestivum?FGAS?library.

dbj|CJ590517.1|CJ590517?Y.Ogihara?unpublished?cDNA?library.

gb|BE516396.1|WHE609_A08_A15ZA?Wheat?ABA-treated?embryo.

gb|DY742247.1|EST0817Cold?treated?wheat?cDNA?library.

dbj|CJ673389.1|CJ673389?Y.Ogihara?unpublished?cDNA?library.

dbj|CJ566400.1|CJ566400?Y.Ogihara?unpublished?cDNA?library.

This sequence is used in TIGr database (http://www.tigr.org/tdb/e2k1/tae1/) inquiry wheat sequence.Produce 3677 base pair cDNA sequences (SEQ ID NO:2) (TIGrAccession No.TA53350_4565) and covered 3677 base-pair sequences.The coverage area of these two sequences demonstrates 99% consistence.When comparing with the protein sequence in the NCBI albumen database of prediction, can see that it has the sequence similar to the R1 protein sequence height of potato and Arabidopis thaliana (being respectively 71% and 67% consistence) by these 3677 nucleotide sequence coded aminoacid sequences (SEQ ID NO:3).The wheat sequence also demonstrates and the highly similar sequence of rice genome (Os06g0498400), infers and the paddy rice homology.Wheat cDNA sequence and paddy rice nucleotides sequence are shown 87% sequence identity, and aminoacid sequence is 88% sequence identity.Wheat GWD sequence hypothesis is SEQ ID NO:2, and aminoacid sequence is assumed to be SEQ IDNO:3.

Compare with paddy rice (Os06g0498400) genome sequence when wheat cDNA sequence, can determine the exon of paddy gene, the wheat cDNA exons structure of supposing is determined (table 8).

Barley est sequence detected result is that the GWD sequence that the barley EST BU993423 of 663 Nucleotide (SEQ ID NO:4) demonstrates with wheat and paddy rice exon 23 and 3 ' district has similarity, and this is considered to and the barley dna homolog.4302 Nucleotide of another wheat cDNA (SEQ ID NO:5) are identified, and its encoded protein has the starch binding domain with potato R1 protein similar.

Described 3677bp wheat cDNA sequence contains the 3027bp open reading frame (ORF) from 382-3409; When described cDNA and rice cDNA were carried out the total length comparison, the similar area of two sequences had covered the paddy rice full-length cDNA.1009 aminoacid sequences of this ORF coding, molecular weight is 112.8kD.This protein sequence contains 3 should guard the territory, has the function of inferring: about 100-200 amino acid whose starch binding domain, the amino acid whose PEP/ pyruvate salt of about 200-300 amino acid whose phosphorus acceptor site and about 740-C end is in conjunction with the territory, and this is considered to the conversion of reversible catalysis ATP to AMP in conjunction with the territory.

Two other wheat ESTs, CA484881 and CO347457 are identified and the arabidopsis thaliana sequence of the PWD that encodes has homology.They and 2273bp sequence do not match, but the PWD albumen that encoded polypeptides demonstrates with starch binding domain and Arabidopis thaliana has homology.Especially, these two PWD est sequences demonstrate respectively that (NP_194176) the amino acid 973-1153 of gene (82% consistence) and amino acid/11 172-1196 (88% consistence) have similarity with ATGWD2/GWD3/PWD (phosphoric acid polysaccharide water two kinases) [Arabidopis thaliana].They also demonstrate with paddy rice (Os12g0297500) PWD has homology.Based on primer or other method known in the art of est sequence, by 5 '-and 3 '-RACE technology isolate wheat PWD full length gene sequence.

Further search four Chinese sorghum ESTs, itself and wheat GWD cDNA sequence (SEQ IDNO:2) have homology, therefore are shown as part Chinese sorghum GWD gene.They are: accession number: BI245998 (SEQ ID NO:11), and the 2057-2542 position Nucleotide (SEQ ID NO:2) of its nucleotide sequence and wheat GWD sequence has 83% consistence; Accession number: CF074015, it has with wheat GWD 874-1559 position Nucleotide and has 89% sequence identity; Accession number: EH406623, it has with wheat GWD 1323-1885 position Nucleotide and has 89% sequence identity; And accession number: CD423248, it has with wheat GWD 2517-3434 position Nucleotide and has 85% sequence identity.Based on primer or other method known in the art of est sequence, by 5 '-and 3 '-RACE technology is separable goes out Chinese sorghum GWD full length gene sequence.

Embodiment 3 contains the production of the conversion crop of the structure that suppresses GWD genetic expression

Suppress for detecting the influence of GWD genetic expression, design can be expressed the gene structure of the double stranded rna molecule that is used to suppress wheat GWD portion homologous gene, and target is and the corresponding to conserved regions of starch binding domain.

This structure contains wheat Bx17 HMW glutenin gene promoter to express dsRNA, and this promotor is as organizing special promotor, and preferred expression is in the cereal endosperm.Therefore, the inhibition of predicted gene expression can mainly result from endosperm.

This suppressor gene structural group is loaded in the following pBx17IRcasNOT cloning vector.This carrier contains following composition in order: from wheat HMWG Bx17 gene, report as (1993) such as Reddy, the special promotor of endosperm that comprises first 1897 Nucleotide of Bx17 genome sequence, 5 ' the end of its forward sequence attR (1447bp comprises the negative gene of selecting of ccdB) has the BamHI site, 3 ' end has the EcoRI site, the rice fecula q enzyme I intron 4 (accession number .D10838 from the 507bp Nucleotide of 6201-6674 position) reverse with described promotor, the paddy rice q enzyme I intron 9 (accession number .D10838 is from the 429bp Nucleotide of 9112-9605 position) of forward, 5 ' end has the SpeI site, 3 ' end has the attR reverse sequence (1435bp comprises second copy of ccdB) in KpnI site, and nos3 ' transcription termination sequence (267bp, from pEmu, Chamberlain etc., 1994).This carrier does not contain selectable marker gene, does not comprise second plasmid that contains the npt gene that is used to select transformant of cotransformation yet.The nucleotide sequence of above-mentioned accession number is incorporated into this by reference.

Under standard conditions, adopt primer GWDF:5 '-AAAAGGATCCGGTACCGCCTTCTGGCTCAACAGTTC-3 ' (SEQ ID NO:6) and GWDR:5 '-AAAAGAATTCACTAGTATCACCTTCACCTCCACGAC-3 ' (SEQ ID NO:7), 62 ℃ of annealing temperatures, amplification and the corresponding to PCR fragment of part wheat GWD gene from wheat endosperm cDNA.The PCR reaction amplifies the 597bp nucleotide fragments of wheat GWD cDNAs from the SEQ ID NO:2 of 581-1020 position GWD.This wheat cdna district, with respect to 5 ' end of transcription sequence, consistent with the part of the amino acid 470-670 of potato gene coding accession number AAK11735 (this accession number is incorporated into therewith by reference).It is consistent with starch GWD protein binding domain height that this district in the potato polypeptide is considered to.

Described PCR fragment is cut with SpeI and KpnI enzyme, is connected with carrier pIRBx17casNOT DNA after cutting with same restrictions enzyme enzyme, thereby forms intermediate pBx17-GWD_R structure.Further, the segmental DNA of PCR cuts with BamI and EcoRI enzyme, is connected with pBx17-GWD R_DNA after cutting with the same enzyme enzyme, to form pBx17-GWD_IR.

The goldc grains that uses embodiment 1 to describe, the DNA of this structure is used for the conversion of the biological mediation of wheat prematurity plumule (Bob White kind).About 1100 plumules are handled with this biological method, wherein 25 little crop regeneration.18 strains grow to maturation in the greenhouse.When they are used to test resistance to Geneticin, show the existence of selectable marker gene, or, identify 13 the positive wheat transgenic crops (being appointed as T0 generation, rsGWD system) that contain pBx17-GWD_IR by the PCR screening.Carry out described PCR screening with the DNA that goes out from the blade sample separation, use the primer ZLBx17pro that is positioned at this structural priming and described GWDR primer 5 '-AAAAGAATTCACTAGTATCACCTTCACCTCCACGAC-3 ' (SEQ IDNO:7).From the conversion crop that contains pBx17-GWD_IR, go out the 713bp fragment by pcr amplification.

The analysis of regulation and control of embodiment 4 two kinase gene downstreams and transformed wheat crop

The T0 crop-planting allows selfing to produce the T1 seed in the greenhouse.The T1 seed of each transgenic lines is sowed to produce T1 offspring crop.Determine to exist genetically modified positive T1 crop, carry out selfing to produce the T2 seed.This is used for genetically modified T1 crop is homozygote or heterozygote; Can distinguish by analyzing each T2 offspring who is.Keep and have genetically modified negative T1 crop (segregant), and allow selfing to lack genetically modified T2 offspring crop to provide, it can be used as contrast (wild-type) and is used for the comparison phenotypic characteristic.

Separating starch in the dry T2 cereal of the transgenic lines of from embodiment 1, describing.The starch content of this transgenosis cereal is similar to wild-type cereal, does not observe the obvious difference of starch content.According to the operation of the Enzytec starch detection kit of describing among the embodiment 1, analyze G-6-P (G6P) content of T2 starch sample.Detect the starch sample of 12rsGWD T1 system.The RNAi structure is contained in these 8 systems in being, 3 is that invalid segregant is as (wild-type) contrast.In the rsGWD system of 8 conversions, compare with their wild-type segregant with wild-type parent (Bob White kind), the cereal starch level of 7 systems demonstrates obvious decline.(see figure 1).Compare with Bob White, 1 is the G6P level that (GWD5-9X) demonstrates decline, but with invalid segregant (rsGWD5-9A). compare, the G6P level does not obviously descend.These data show that target gene shows the functional GWD of wheat.

Starch structure and analysis of molecules

The chain length of also having analyzed the starch sample of these transgenic lines distributes amylose content and particle size dispersion.The chain length distribution curve is to obtain by the capillary electrophoresis behind the isoamylase branch starch of describing among the embodiment 1.12 systems that are used to analyze do not observe the obvious modification that chain length distributes.The position of the main peaks of each sample results from the identical polymerization degree (DP), and when curves overlapped, in fact curve is consistent.When relatively particle size dispersion or grains B particulate frequency (%), do not observe in transgenic lines and the non-transgenic system and have obvious variation.The amylose content of most of transgenic lines starch sample (being expressed as the percent of total that extracts starch in the cereal) comparison according to or Bob White parent be lower slightly (low 2-3%) (Fig. 2).The amylose content of transgenic lines rsGWD5-9X does not have difference compared with the control statistically.

The plysiochemical character of starch

The plysiochemical character of research transgenic lines starch sample comprises gelatinization character, viscosity and the coefficient of expansion.

The expansion gesture of transgenic lines starch detects as embodiment 1 and describes, and data and check sample data are compared (Fig. 3).The starch content that contains G6P in the transgenosis cereal starch obviously descends, i.e. maximum gene silencing on the phenotypic level shows as at 95 ℃ of coefficients of expansion and obviously descends (at least 20%), does not observe the remarkable modification that other is.

Adopt 9% (w/v) starch suspension, by 3g starch and the preparation of 25ml water, at the alpha-amylase inhibitor final concentration be 4 μ g/ml Silver Nitrate in the presence of or do not add under the situation of inhibitor, with quick viscosity analyser (Newport Scientific, Sydney, Australia) the gelatinization character of analysis starch.Representational data presentation is in Fig. 4 and table 4, and it lists the starch viscosity parameter of separation from 5 transgenic lines and contrast Bob White.What G6P at utmost descended is also to demonstrate its decline of cereal starch gelatinization value maximum, particularly peak viscosity number and time to peak.Yet, the transgenic lines that the G6P content influence is less, its RVA curve also demonstrates to be modified slightly or not to have a modification.Observing rsGWD4-1 is that viscosity number descends at least 30%.With parallel pattern other cereal starch is analyzed, compared with the control, rsGWD5-9X demonstrates identical viscograph.

The analysis of the enzymic activity relevant with starch

Do not expect ground, in the presence of no alpha-amylase inhibitor, the semolina sample of transgenosis cereal is carried out the analysis of same type, demonstrate intensive, special phenotype (Fig. 4).Add the amylase inhibitor purpose in this test and be obtain viscosity parameter resolving power preferably and avoid since amylolytic enzyme to any threshold value of parent system (BW26).Yet we see that in surprise the viscosity peak value and the whole viscosity number of the RVA curve of transgenosis cereal semolina subsides fully.Be that the curve negotiating of semolina adds amylase inhibitor Silver Nitrate or EDTA and recovers from the parent in analyzing forward direction suspension, obtain curve to the similar proterties of isolating starch RVA curve.

This result shows the α-Dian Fenmei pond that has increase in the transgenosis cereal.For verifying this hypothesis, the alpha-amylase activity level in the seed of having tested is described as embodiment 1.What select is that the T3 offspring's that comprises that these are data presentation is in Fig. 5.Analyze for rsGWD system, compare with contrast parent system or control series, alpha-amylase activity has raise 2-5 times at least.The beta-amylase activity is measured, compared, observe that the beta-amylase activity has raise at least 20% in the flour with non-conversion contrast.But inference draws the amylase that increases in the GWD that reduces in the crop and the transgenosis cereal, and the accumulation of α-Dian Fenmei and beta-amylase is relevant.

Also measure the level of other enzyme that relates to during the transgenosis cereal starch decomposes, adopted Zeeman etc., the working method that Plant Journal 15:357-365 (1998) describes.Compare with the contrast seed, there are similar amount in alpha-glucosidase, beta-glucanase, D-enzyme, cellulase, lichenase and xylosidase in the transgenosis seed, although the activity of the indivedual enzymes of some seeds is high slightly.But the main influence that inference draws enzymic activity is an amylase, particularly α-Dian Fenmei.

Seed (25DPA) and the ripe cereal of sprouting that decomposes transgenosis and contrast crop is to separate aleurone layer and cortex, endosperm and plumule tissue, and the amylase activity of measuring these tissues shows that the alpha-amylase activity of increase mainly is positioned at aleurone layer and cortex.Only observe low-down activity in low activity level and the plumule in the endosperm.

Separate aleurone layer and use the dyeing of iodate pyridine, the iodate pyridine is a fluorescent mixture, it can not enter in the viable cell with intact cell film, or dye with Fluoresceincarboxylic acid diacetate (CFDA), it can stride across cytolemma and enter cell, observe with contrasting aleurone layer and compare, have more cell in the program necrocytosis, to rise in value in the aleurone layer of transgenosis cereal.

Other carbohydrate

Analyze the blade of 25DPA, several carbohydrate levels of corolla and stem of plant.In two independent experiments, test.Analysis revealed is compared with wild-type Bob White, and the fructose in the genetically modified crops stem, sucrose and glucose level increase in fact.Starch level also increases, but the Polylevulosan level descends in the stem.

The crop phenotype that changes

Surprisingly and do not reckon with ground, the downstream regulation and control of observing GWD genetic expression in the transformed wheat system cause planting the crop pattern in the greenhouse and the main modification of growth.The most important thing is, comprise illumination, temperature and moisture when planting in identical envrionment conditions, compare with the contrast crop, genetically modified crops show bigger vigor, stalwartness and more biological yield and comprise blade, corolla and fringe.Compare with parent or contrast crop, the cereal amount that deposits yields is made in every strain increases at least 50% basically, and seed production data (every strain crop seed g) and Fig. 6 of seeing Table in 5 show typical corolla size.

For determining these observationss, transgenic lines, contrast and the parent crop of selecting carried out further increment study to make statistical analysis.The parameter of measuring comprises the leaf area of percentage of germination, different growth phases and the corolla quantity of every strain crop.Each is made system and repeats 5 these analyses.Data presentation and table 6.The commitment of the biological yield that but inference draws genetically modified crops from data after germinate increases, and for example forms until corolla in the 2-leaf phase.Biomass on average increases by 30%, increases to be higher than 40% in some crops.Leaf area increase at least 50%, increase is higher than 60% in some are.The tillering number increase of every strain crop is higher than 15%, is higher than 20% sometimes.The corolla quantity increase at least 40% of every strain crop increases at least 50% in some cases.Typically, the seed production increase at least 40% or at least 50% of every strain crop, every seed quality is similar.

More surprisingly, the g and D of transgenic lines rsGWD5-9X crop also is affected basically.As implied above, this is that the G6P or the viscosity number of cereal starch obviously do not modified, so this g and D of making system should affected reason be unconspicuous.Can think before these are observed, be used to produce the expression that RNAi suppresses the HMW glutenin promoter of structure in the endosperm and be restricted.Yet growth curve shows that strongly the expression of promotor is that the transient starch metabolism produces following photosynthesis in " omission ", particularly crop leaf.For measuring possible RNAi structure to the metabolic influence of transient starch, when the photoperiod finishes, the starch G6P level that exists in the transgenic lines that mensuration is selected and the blade of control series.The transient starch accumulation of this time point and GWD maximum activity and 24 hours is selected this time point and is changed because enzymic activity demonstrates diel rhythm to consistent.

The data that obtain are shown in Fig. 7.Continue to observe this g and D that is, compare with kind BobWhite or contrast crop, the G6P level significantly descends in the blade starch.This result confirms that the level of RNAi structure representation in the blade is enough to upset the regulation and control of GWD in the blade, therefore has influence on the transient starch metabolism.

Conclusion

The decline of glucose-water-two kinase activity that is caused by the structure of encoding gene expression inhibitor of GWD in the coding transgenic wheat makes that G-6-P content reduces in the storage starch (being cereal starch in this example).This shows target gene encoding function GWD.The attenuating of mono-esterification phosphoric acid level impels the modification of gelatinization character and the attenuating of the starch coefficient of expansion.In the new observation of not expecting, the grain of these genetically modified crops also demonstrates the α-Dian Fenmei level and the beta-amylase level of remarkable increase, also has influence on the natural gelatinization character of semolina.These amylase mainly are expressed in the aleurone layer of cereal usually, particularly after the imbibition and the grain duration of germination, can think that therefore most of amylase that increases may be expressed in the aleurone layer.When purifying starch is analyzed (albumen is removed), this influence only is appropriate.This influence to flour is worked in bread processing and other food applications.Yet the observation of not expecting most makes the RNAi structure greatly influence plant growth and growth, causes the biological yield and the grain output that increase basically.Biomass and grain yield increase 30-40% or more, and the G-6-P level of transient starch descends simultaneously.The result who obtains based on transgenic lines rsGWD5-9X crop, to the mediation of growth and yield effect mainly by expression of gene in the grain of modification chlorenchyma such as blade rather than sprouting.This is for reckoning with, is the endosperm special use because be used to drive the promotor of RNAi structure, expresses very low in other tissue.In addition, before desk is sprouted, observe influence to crop growth and form.

Embodiment 5 suppresses the influence of GWD genetic expression under different genetic backgrounds

For determining the influence of GWD gene downstream regulation and control under the different genetic backgrounds, the genetically modified crops that will contain the pBx17-GWD_IR structure hybridize with commercially available bread wheat kind Westonia, Hume and Sunstate.Obtain ripe F1 for seed.In the greenhouse of these planting seeds under controlled condition, F1 is hybridized the quantity of the every strain fringe that demonstrates increase in crop and 3 the commercially available kinds each, for example see the data among Fig. 8, each is with 4 or 5 strain crops.But inference draws the output parameter of increase and may extend to different genetic backgrounds.

In the manner described above g and D and starch property are further analyzed from the crop and the crop that obtains of further backcrossing that these seeds obtain.The germination of seed and the growth of crop are compared with contrast parent crop, with the observed phenotype of transgenic lines under the genetic background of determining Bob White kind.Measure feature such as germinating time, early growth rate and leaf area, tillering quantity, corolla quantity and output in addition.Carry out field experiment to estimate big Tanaka's effect.

The expression of embodiment 6GWD is regulated

Crossing of GWD expressed

GWD cross expressing in wheat or other crop need be with the cDNA genomic dna coding GWD that lives.For this reason, can use Wheat Full-length cDNA sequence protein-coding region (SEQ ID NO:2), can be operatively connected with promotor, can be the allogeneic promoter of GWD coding region.

Different tissues and in plant growth, encode GWD and PWD expression of gene level

Isolating mRNA sample in Different Crop tissue, particularly blade and the endosperm from process of crop growth is carried out quantitative reverse transcription-PCR (RT-PCR) test, to measure GWD and PWD expression of gene pattern.The expression level of measuring in the blade in per 3 hours in 24 hours periods changes with the diel rhythm that expression level is described, and is of C.reinhardtii model (Ral etc., 2005).Phosphorus acid content, starch content variation and alpha-amylase activity are with carbohydrate metabolism in the middle of analyzing in the monitoring blade.

Collect the endosperm of the wild-type crop of different growth phases, be used for the expression of isolation of RNA, adopt the method for quantitative RT-PCR with research endosperm development process GWD and PWD.

Selection has similar amylopectin/a large amount of genotype of amylose starch ratio and is used for the research of its special physical-chemical property.Some kinds are known relevant with noodles processing (Chara) with baking.More known for steaming bread (Baxter) and other the baking character (AC Barrie and Alsen) that is used for sponge (sponge) and dough bread (dough bread) is useful in the Asia.

The expression of embodiment 7GWD and PWD is regulated

The sudden change of PWD in the paddy rice

The proteic aminoacid sequence of Arabidopis thaliana (NP_194176) PWD inserts the accidental data storehouse as inquiry sequence with inquiry paddy rice Tos17.Identify 3 different Tos17 systems (NG0294, ND9050_0_701_1A and T29717T) and obtain the seed that these are.The rice genome sequence (SEQ ID Nos:8-10) that has mark is connected with these 3 insertions, and each demonstrates and Arabidopis thaliana PWD sequence homology (about 75% consistence), shows that this is inserted in the paddy rice PWD gene.

NG0294

TGCTGGAGCAGCAGTATATGATAGGTTAGAGAAAGTCCGCCATAATTTTTGT

AGTTTGCTCAAGAATTTATTTGGCATTACAACTAAGCTGACTGCTTGTTTCA

GTGTCCCTATGGATGAGGAAGATGAAGTCGTACTCGACTACACCACAGACC

CCCTCATTACAGATCAGGGATCCAAAAATCAATCCTCTCGAGCATTGCACG

GGCTGGTCATGCCATTGAGGATTTCTATGGGTCACCACAGGGCACAGGATG

TTGAGGGTGCAGTGAAGGAAGGGAAGCTATAAGTAGTACAGACAAGACCA

CAAATGTAATCTATATGTATATTTTATAGCCAAGTCAATCAGGAAATGTTGTA

GAGTAAGATATACGGGCCGTGGGACATGTATAACACGTTATGCTCCTTTTTT

T(SEQ?IDNO：8)

ND9050_0_701_1A

TCTACAACTACAACTTTTTAGAATCTGGACCAAAAGCTGGACTGTTTGAGG

GAGCTTCTGATTCTGAGAGAAGCTGCAGCAGCTAGAAGCTCCCCCAAACA

GGCCCTTAGGTAGCTGGTTACAAGTCTGATCACACTGTTTTAGGTTTGTCT

GTTGTTGTATATCAGATAGCTAAATGCATAGCTGTGAGCTAGAGTTGTGAT

AAACTGGAAATAGGTCAGGGAACGTCTTTTTTTGCCAAAGTATGGGTAAA

GATAAACTTGGTGAGCTCAGCTGGGGACAAAATCATCAGATTTTGTATTCT

CCCAGCAGAGCAAATAGGGATTTGCCTGTGAGTGCATGCCTGACTTGTCT

GTTGGTCTATGAAATGGGCCGTGAAGTGTGCTTCTATGGGCCTTGTCACTA

CTNACCAGGCGGTATTGCAGAGCAGATTTCTTGGCCCATTTTGTCCTTTTT

CTCTCT(SEQ?ID?NO：9)

T29717T

CTTGGGAAGACGGTGCGTGTTAGATTTGTGCTGAAGAGGGAATGCACGTT

CGGCCAGAGCTTCCACCTTGTCGGCGACGACCCGGCGCTCGGCCTCTGGG

ATCCGTCGAAGGCAGTGCCTTTGGATTGGTCAGAAGGACACGACTGGACT

GTGGAGAAAGTGAGCCTTGCATCGTGCGCATTGTTTGATGTACTCTCCTTT

TGAGGTAATCATCACCCCTTTTCTTCTGTACAGGACTTGCCAGCCAACAAG

TTGATTGAGTACAAGTTCGTGCTGCAAGATTTGTCGGGCAAGTTGCATTGG

CAGAATGGTCGTAATAGAAGCGTACAGACAGGTGAAACTGCAAACATTCT

AGTCGTATATGAAGATTGGGGTAATGCAAATAGTCAGACAGTAGAAGAG

GAGGGTAAAGTGTCCATTGGGATGGAGGAGGGTAAATTGTCCGTTGGGAT

GGAGGAGGCTGTAGTTCCAGATGATAGTGAAAGCAGAG(SEQ?ID?NO：10)

Because it is retrograde that these Tos17 insertion sudden changes are expected to be, separate each homozygous mutation.This at first needs to develop homozygote and the heterozygote of screening method to distinguish each wild-type and mutation allele, to identify crop wild-type, heterozygote or homozygote sudden change.Finish by the following method.

Each is design and to produce 2 medicines right, referring to as follows.The Tos17 primer is used for each primer to A, has the sequence complementation in the nucleotide sequence and the Tos17 factor, so must there be and be used for amplification in this factor.With the positive PCR result of primer to A, therefore identify crop and have mutation allele, be used for the PWD gene yet the negative PCR result of A has been disclosed the wild-type crop with primer.Each primer is distinguished heterozygote mutantion line to B from those homozygotes, and definite wild-type status.Each primer is positioned at the both sides of Tos17 insertion point to B.Primer is very big to the amplified production that the PCR result of B has disclosed homozygote mutant crop prediction in the presence of Tos17, expectation amplification.The heterozygote crop of wild-type and mutation allele is told in 2 positive PCR results' that 2 primers are right land.

Primer	5 ' to 3 ' sequence
		Tos17primer	ATTGTTAGGTTGCAAGTTAGTT(SEQ?ID?NO：15)
Tos17PWDI	CTTCCCTTCCTTCACTGCAC(SEQ?ID?NO：16)
		Tos17PWDII	GCAAGGCTCACTTTCTCCAC(SEQ?ID?NO：17)
Tos17PWDIII	TCCATCCCAATGGACACTTT(SEQ?ID?NO：18)
		HomoPWDfor	TACGACATGGAAGCCG(SEQ?ID?NO：19)

Adopt this method, identify homozygote sudden change crop and be used for 3 each that insert system and be.Adopt aforesaid method to analyze the seed of these wheat crops, sowing has detected crop phenotype under controlled condition.Nipponbare compares with the wild-type kind, can see the decline slightly of inserting starch phosphate content in the mutant at one, but compare with the segregant starch that is that lacks described insertion, owing to have a large amount of wrong bars (bars) in analyzing, whether content descends it be unclear that.Comparing with the segregant that lacks insertion or wild-type, is that the flour sample of grain is obviously not different on starch content, the coefficient of expansion, λ max, chain length distribution or α-Dian Fenmei level from insertion.These data show that the inactivation that paddy rice PWD is acted on separately only is minimal effect.Yet Baunsgaard etc. (2005) data show with the independent effect of GWD to be compared, and the combination of GWD and PWD demonstrates the influence of increase in the Arabidopis thaliana.

Identify other several paddy rice and insert system in Origene database (http://orygenesdb.cirad.fr/index.html), in paddy rice GWD gene, they demonstrate contains the T-DNA insertion.As follows:

3A-51160?corresponding?to?the?FST?A29424

3A-07997?corresponding?to?the?FST?A16348

2A-40470?corresponding?to?the?FST?A07158

3A-17981?corresponding?to?the?FST?A27803

These are to obtain from posTECH (Republic of Korea).In addition, identify in 2 paddy rice SEX4 genes that tie up to the coding starch phosphorylase and have an insertion fragment: corresponding to the 1B-06142 of FST A3204 and corresponding to the 2D41347 of FST D08500.Analyze their identical character according to the method described above.

The further sudden change of GWD in embodiment 8 cereal

The genome primer special of wheat GWD gene

Design genome primer special particularly from A, B and the genomic fragment of D, is distinguished 3 homologous genes of hexaploid wheat with amplification GWD gene fragment thus.Finish as follows.Fragment cloning and order-checking are carried out by pcr amplification in several subareas that include of the GWD gene of hexaploid wheat.As a rule, can determine the difference of 3 sequences,, but not allow location each variable of special gene group with consistent from A, B and the genomic GWD gene of D.For obtaining this location, carry out same PCR reaction, adopt from the genomic dna of specific chromosome deletion system and make template, amplified fragments is also cloned and is checked order.These be in only 2 genomes contain the GWD gene, the 3rd for the disappearance.For example, chromosome deletion is that the karyomit(e) 7A of N7At7B is invalid, therefore lacks A genome GWD gene, but has the karyomit(e) 7D GWD gene of 2 copies and the karyomit(e) 7B GWD gene of 4 copies.Therefore, lack the location that the intron sequences that increases the system allows the sequence variable of each special gene group from N7AT7B, N7BT7D and N7DT7A.

15 cloned sequences to amplification check order, thereby the genome that identifies the uniqueness relevant with the D genome with A, B is modified specially.For example, observe C and be replaced by T in disappearance system, it is present in the A genome and still is not present in the invalid system of A.This shows that the GWD sequence variable that has T is that the A genome is proprietary.It is right that this then polymorphism is used to design following primer special:

The A genome

Primer GWD1ForA* 5 '-GAAACACATAGTCTG-3 ' (SEQ ID NO:20)

Primer I B_GWD2rev 5 '-TTGCGGTGCCTTTACC-3 ' (SEQ ID NO:21)

The B genome

Primer GWD1ForB*_HTM 5 '-GAAAGAAACACATAGTCTG-3 ' (SEQ ID NO:22)

Primer I B_GWD3rev 5 '-ATCTGTAAACCTGTCTTGTG-3 ' (SEQ ID NO:23)

The D genome

Primer GWD2for2 5 '-TTGCGGTGCCTTTACC-3 ' (SEQ ID NO:24)

Primer I B_GWD3rev 5 '-ATCTGTAAACCTGTCTTGTG-3 ' (SEQ ID NO:25)

When these primers react the PCR that is used to wheat cdna group DNA, adopt following PCR cycling condition: 94 ℃ 5 minutes, then 94 ℃ 30 seconds, 53 ℃ 30 seconds, 72 ℃ 40 seconds, 40 circulations, then be 72 ℃ 5 minutes, product separates by gel electrophoresis, can distinguish following amplified production: the GWD gene on the A genome, observe the unique fragment that produces about 600bp, GWD gene on the B genome, observe the unique fragment that produces about 1000bp, and the GWD gene on the D genome is observed the unique fragment that produces about 500bp.Use 3 primers right, 3 PCR reactions can be combined into a various PCR reaction, allow the high flux screening of mutagenesis seed and crop groups.

Wheat disappearance system is repeated these PCR reactions, described wheat disappearance frenulum has the specific chromosome deletion of more restrictions, lacks special chromosome segregation, lacks the amplified production from particular hole system, show that wheat GWD gene is positioned at karyomit(e), the i.e. end of karyomit(e) 7S galianconism No. 7.

The sudden change of wheat GWD gene

The seed of Chara wheat breed carries out mutagenesis by heavy ion bombardment, method therefor and Shitsukawa etc., and the method that Genes Genet.Syst.82:167-170 (2007) provides is basic identical.The seed of each crop is collected and preserved to seed after the plantation mutagenesis to produce the M1 crop, produces 8000 mutagenesis systems thus.

To screening described 8000 systems, identify the mutant that lacks one of 3 GWD genes with above-mentioned genome primer special.Identify 2 mutant that lack the gene regions relevant with B genome GWD gene, and 1 mutant that lacks D genome GWD gene regions.These crops that suddenly change are assumed that the null mutant of GWD gene, plant in the greenhouse, and it is normal to demonstrate phenotype.These crops are hybridized two times of mutant that lack B and D genome GWD gene with generation.

Further test mutagenesis system is to identify the null mutant of GWD gene on the A genome.When identifying, these crops can hybridize to produce A, B and each genomic three times of mutant of D with B and two times of mutant of D genome.

It will be understood by those skilled in the art that and outside the detailed description of the present invention, to make some modifications or improvements.The present invention includes all such modifications or improvement.The present invention also comprises all discrete that relate in the literary composition or step, feature, composition and the compound of combination, described step or feature any 2 or a plurality of combinations.

Table 1

The sequencing overview

SEQUENCE?ID?NO：	Describe
		1	The wheat cdna sequence relevant with PWD (Arabidopis thaliana) with R1 (potato)
2	The cDNA of wheat GWD
		3	SEQ ID NO:2 amino acid sequence coded
4	The EST of barley GWD
		5	The cDNA of the similar gene of wheat GWD
6	The forward primer of GWD gene
		7	The reverse primer of GWD gene
8	Part paddy rice PWD insertion sequence
		9	Part paddy rice PWD insertion sequence
10	Part paddy rice PWD insertion sequence

11	The EST of Chinese sorghum GWD gene (Accession No BI245998)
		12	The EST of Chinese sorghum GWD gene (Accession No CF074015)
13	The EST of Chinese sorghum GWD gene (Accession No EH406623)
		14	The EST of Chinese sorghum GWD gene (Accession No CD423248)
15	Paddy rice PWD gene primer
		16	Paddy rice PWD gene primer
17	Paddy rice PWD gene primer
		18	Paddy rice PWD gene primer
19	Paddy rice PWD gene primer
		20	Wheat GWD gene primer
21	Wheat GWD gene primer
		SEQUENCE?ID?NO：	Describe
22	Wheat GWD gene primer
		23	Wheat GWD gene primer
24	Wheat GWD gene primer
		25	Wheat GWD gene primer

Table 2

The amino acid subclass

Table 3

Example and preferred amino acid are replaced

Table 5

The kind subparameter of transgenosis and contrast crop (wt) T2 seed

Table 7

Compare the exon of wheat GWD gene with paddy gene

Reference list

Abel?et?al.，The?Plant?Journal?10：981-991，1996

Adams?et?al.，Anal.Biochem.，266：77-84，1999

Almeida?and?Allshire，Trends?Cell?Biol?15：251-258，2005

Altschul?et?al.，Nucl.Acids?Res.25：3389，1997

An，Methods?in?Enzymology，153：292，1987

Ausubel(Ed)Current?Protocols?in?Molecular?Biology，5 ^th?Edition，John?Wiley?&?Sons，Inc，NY，2002

Ausubel?et?al.eds.，Current?Protocols?in?Molecular?Biology，John?Wiley?and?Sons，New?York，1990

Ausubel?et?al.，(eds.)，Current?Protocols?in?Molecular?Biology，John?Wiley?&?Sons，NY，6.3.1-6.3.6.，1989

Ausubel?et?al.，Current?Protocols?in?Molecular?Biology?John?Wiley?&?Sons?Inc，Chapter?15，1994-1998

Baba?et?al.，Biochem?Biophys?Res?Commum?181：87-94，1991

Banks?et?al.Starch/die 23：118-124，1971

Barker?et?al.，Plant?Mol.Biol.，2：235-350，1983

Batey?et?al.，J.Sci.Food?Agric.74：503-508，1997

Baunsgaard?et?al.，The?Plant?Journal?41，595-605，2005

Bechtold?et?al.，C.R.Acad.Sci.Paris，316：1194，1993

Bevan?et?al.，Nucl.Acid?Res.，11：369，1983

Birch，Ann?Rev?Plant?Physiol?Plant?Mol?Biol?48：297-326，1997

Blennow?et?al.，Int.J.Biol.Macromol.27：211-218，2000a

Blennow?et?al.，Carbohdr.Polym.41：163-174，2000b

Bonner?et?al.，Eur.J.Biochem.，46：83，1974

Bourque?Plant?Sci.105：125-149，1995

Bower?et?al.，Molec.Breed.，2：239-249，1996

Boyer?and?Preiss，Carbohydrate?Research?61：321-334，1978

Buléon?et?al.，International?Journal?of?Biological?Macromolecules，23：85-112，1998

Cao?et?al.Plant?Cell?Reporter，11：586-591，1992

Cao?et?al.，Archives.of?Biochemistry?and?Biophysics.373：135-146，2000

Chamberlain?et?al.，Aust.J.Plant?Physiol.，21：95-112，1994

Christensen?et?al.，Transgen.Res.，5：213-218.1996

Comai?et?al.，Plant?J?37：778-786，2004

Craig?et?al.，Plant?Cell?10：413-426，1998

De?Framond，Biotechnology，1：262，1983

Deikman?et?al.，EMBO?J.，2：3315-3320，1998

DellaPenna?et?al.，Plant?Cell，1：53-63，1989

Dellaporta?et?al.，in?Chromosome?Structure?and?Function，pp.263-282，1988

Delrue?et?al.，Journal?of?Bacteriology，174：3612-3620，1992

Delvalle?et?al.，Plant?J?43：398-412，2005

Denyer?et?al.，Plant?Physiology?112：779-785，1996

Eagles?et?al.，Aust，J.Agric.Res.52：1349-1356，2001

Ehrlich，Proc.Natl.Acad.Sci.USA，75：1433，1978

Ekman?and?Jager，Anal?Biochem?214：138-141，1993

Erickson?et?al.，Science，249：527-533，1990

Fergason，Speciality?Corns?eds，CRC?Press?Inc.pp?55-77，1994

Fisher?et?al.，Plant?Physiol?102：1045-1046，1993

Fromm?et?al.，Proc.Natl.Acad.Sci.，U.S.A，82：5824，1985

Gao?et?al.，Plant?Physiol?114：69-78，1997

Gao?et?al.，Plant?Cell?10：399-412，1998

Garfinkel?et?al.，Cell，27：143-153，1983

Gordon-Kamm，Plant?Cell，2：603-618，1990

Greve，Mol.Appl.Genet.，1：499-511，1983

Harayama，Trends?Biotechnol?16：76-82，1998

Hartmann?and?Endres，Manual?of?Antisense?Methodology，Kluwer，1999

Haseloff?and?Gerlach，Nature?334：585-591，1988

Hedman?and?Boyer，Biochemical?Genetics?20：483-492，1982

Hendrix?et?al.，J.Insect?Physiol.，47：423-432，2001

Henikoff?et?al.，Plant?Physiol?135：630-636，2004

Hinchee?et?al.，Biotech.，6：915，1988

Hodgson，Bio/Technology，9：19-21，1991

Hoekema?et?al.，Nature，303：179，1983

Horsch?et?al.，Science，227：1229，1985

Ikuta?et?al.，Biotech.，8：241，1990

James?et?al.，Plant?Cell?7：417-429，1995

Jobling?et?al.，Plant?Journal?18：163-171，1999

Joshi，Nucl.Acid?Res.，15：6643，1987

Katz?et?al.，J.Gen.Microbiol.，129：2703，1983

Klee?et?al.，Annual?Review?of?Plant?Physiology，38：467，1987

Klein?et?al.，Nature?327：70，1987

Konik-Rose?et?al.，Starch/die

53：14-20，2001

Kotting?et?al.，Plant?Physiology?137?pp?242-252，2005

Kubo?et?al.，Plant?physiology.121：399-409，1999

Kurrek，Eur.J.Biochem.，270：1628-1644，2003

Langridge?et?al.，Aust.J.Agric.Res.52：1043-1077，2001

Lee，Plant?Mol.Biol.，13：21-30，1989

Lemieux，Current?Genomics?1：301-311，2000

Li?et?al.，Plant?Physiology?123：613-624，2000

Li?et?al.，Plant?physiology.120：1147-1155，1999a

Li?et?al.，Theoretical?and?Applied?Genetics?98：1208-1216，1999b

Li?et?al.，Funct?Integr?Genomics?3：76-85，2003

Liu?et?al.，J.Am.Chem.Soc.118：1587-1594，1996

Lorberth?et?al.，Nat.Biotechnol.16：473-477，1998

Maas?et?al.，Mol?Breeding，3：15-28，1997

Marmur?et?al.，J.Mol.Biol.，5：109，1962

McPherson?and?Moller(Ed)，BIOS?Scientific?Publishers?Ltd，Oxford，2000

Medberry?et?al.，Plant?Cell?4：185-192，1992

Medberry?et?al.，Plant?J.3：619-626，1993

Millar?and?Waterhouse，Funct?Integr?Genomics?5：129-135，2005

Mizuno?et?al.，Journal?of?Biochemistry?112：643-651，1992

Morrison?and?Laignelet，Journal?of?Cereal?Science?1：9-20，1983

Myers?et?al.，Plant?Physiology?122：989-997，2000

Nair?et?al.，Plant?Sci?122：153-163，1997

Nakamura?and?Yamanouchi，Plant?Physiol?99：1265-1266，1992

Needleman?and?Wunsch，J.Mol.Biol.48：443-453，1970

Niedz?et?al.，Plant?Cell?Reports，14：403，1995

Ow?et?al.，Science，234：856，1986

Pasquinelli?et?al.，Curr?Opin?Genet?Develop?15：200-205，2005

Perriman?et?al.，Gene?113：157-163，1992

Plasterk?et?al.，Current?Opinion?in?Genetics?and?Dev.，10：562-67，2000

Potrykus?et?al.，Mol.Gen.Genet.，199：183，1985

Prasher?et?al.，Biochem.Biophys.Res.Comm.，126：1259，1985

Rahman?et?al.，Genome?40：465-474，1997

Ral?et?al.，.Plant?Phys.142：305-317，2006

Reddy?et?al.，Theor.Appl.Genet.，85：616-624，1993

Remington′s?Pharmaceutical?Sciences，18 ^th?Ed.，Mack?Publishing，Company，Easton，PA，U.S.A.，1990

Repellin?et?al.，Plant?Gene?Reg?pp.97-094，1997

Ritte?et?al.，FEBS?pp.4872-4876，2006

Robinson，The?Organic?Constituents?of?Higher?Plants，Cordus?Press，North?Amherst，USA，1980

Salomon?et?al.，EMBO?J.，3：141-146，1984

Sambrook?et?al?Molecular?Cloning：A?Laboratory?Manual(2nd?ed.).Cold?Spring?Harbour

Laboratory，Cold?Spring?Harbour，NY，1989

Sambrook，Molecular?Cloning：A?Laboratory?Manual，3rd?Edition，CSHLP，CSH，NY，2001

Schulman?and?Kammiovirta，Starch?43：387-389，1991

Schwall?et?al.，Nature?Biotechnol.18：551-554，2000

Senior，Biotech.Genet.Engin.Revs.15：79-119，1998

Sharp?et?al.，Aust?J?Agric?Res?52：1357-1366，2001

Shimamoto?et?al.，Nature?338：274-276，1989

Shippy?et?al.，Mol.Biotech.12：117-129，1999

Shitsukawa?et?al.，Genes?Genet.Syst.82：167-170，2007

Slade?and?Knauf，Transgenic?Res?14：109-115，2005

Smith?et?al.，Nature?407：319-320，2000

Sooknanan?et?al.，Biotechniques?17：1077-1080，1994

Stalker?et?al.，Science，242：419，1988

Summerton?et?al.，Antisense?and?Nucleic?acid?Drug?Development，7：187-195，1997

Sun?et?al.，The?New?Phytologist?137：215-215，1997

Sutcliffe，，Proc.Natl.Acad.Sci.USA，75：3737，

Takeda?et?al.，Carbohydrate?Research?240：253-262，1993a

Takeda?et?al.，Carbohydrate?Research?246：273-281，1993b

Thillet?et?al.，J.Biol.Chem.，263：12500，1988

Thompson?et?al.，Carbohydrate?Res.，331：149-161，2001

Thorbjornsen?et?al.，Plant?Journal?10：243-250，1996

Tingay?et?al.，Plant?J.11：1369-1376，1997

Tyagi?et?al.，Proc.Natl.Acad.Sci.USA，93：5395-5400，1996

Vain?et?al.，Plant?Cell?Reporter；12：84-88，1993

Vasil，Bio/Technol.8：429-434，1990

Veronese?et?al.，Enz.Microbial?Tech.，24：263-269，1999

-Nielsen?et?al.，Biomacromolcules?3：836-841，2001

-Nielsen?et?al.，Carbohydr.Res.337，pp.327-333，2001

Vogel?et?al.，Fermentation?and?Biochemical?Engineering?Handbook：Principles，Process?Design，and?Equipment，Noyes?Publications，Park?Ridge，N.J.，USA，1996

Wan?and?Lemaux，Plant?Physiol.104：37-48，1994

Waterhouse?et?al.，Proc.Natl.Acad.Sci.USA?95：13959-13964，1998

Wells，Methods?Enzymol.，202：2699-2705，1991

Yu?et?al.，Plant?Cell?13：1907-1918，2001

Zeeman?et?al.，New?Phytologist?163：247-261，2004

Zeeman?et?al.，Plant?Journal?15：357-365，1998

Zukowsky?et?al.，Proc.Natl.Acad.Sci.USA，80：1101，1983

Zwar?and?Chandler，Planta?197：39-48，1995

Claims (71)

1. one kind is obtained and contrasts crop and compare, the method of the crop of the genetic modification that production potential improve, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) from a large amount of crops, identify and the contrast crop is compared, production potential improve and contain the allos polynucleotide crop, and the crop of iii) screening genetic modification, wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

2. one kind is obtained and contrasts crop and compare, the method of the crop of the genetic modification that endogenous transglucosylase improves, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) from a large amount of crops, identify with the contrast crop and compare, transglucosylase improves and contains the crop of the genetic modification of allos polynucleotide, and the crop of iii) screening genetic modification, wherein said polynucleotide contains the transcription regulating nucleotide sequence that is connected with the nucleotide sequence of the coding modification endogenous starch phosphorylation of crop and/or the amylolytic factor.

3. one kind is obtained and contrasts crop and compare, the method of the crop of the genetic modification that the digestibility at a certain at least position improves, the method comprising the steps of i) obtains a large amount of crops, wherein at least one pnca gene group contains the allos polynucleotide, ii) from a large amount of crops, identify with the contrast crop and compare, the digestibility at a certain at least position improves and contains the crop of the genetic modification of allos polynucleotide, and the crop of iii) screening genetic modification, wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

4. production potential of measuring the crop of genetic modification, the digestibility at endogenous transglucosylase or a certain at least position is compared the method whether digestibility at a certain at least position improves with the contrast crop, the method comprising the steps of i) obtains the crop that a strain or many pnca genes group contain the allos polynucleotide, and the production potential of ii) measuring a described strain or many strains crop, whether the digestibility at endogenous transglucosylase or a certain at least position is compared and is improved with the contrast crop, and wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

One kind with the contrast crop compare, make the authentication method of the gene of crop productivity potential raising, the method comprising the steps of i) obtains a large amount of crops, every pnca gene group contains the allos polynucleotide, ii) measure and contrast crop and compare, the production potential of every strain and at random the digestibility at its endogenous transglucosylase or a certain at least position whether improve, iii) identify the crop that production potential improve, and iv) identify wherein allos polynucleotide, the transcription regulating nucleotide sequence that thereby identified gene, wherein said polynucleotide contain and the nucleotide sequence of the coding modification endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

One kind with the contrast crop compare, can improve crop productivity potential, the authentication method of the polynucleotide of the digestibility at endogenous transglucosylase or a certain at least position, the method comprising the steps of i) obtains one or more polynucleotides, each Nucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, ii) described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop, iii) breed a large amount of above-mentioned crops, iv) measure and contrast crop and compare, whether the crop that at least one strain contains the allos polynucleotide has improved production potential, the digestibility at endogenous transglucosylase or a certain at least position, and v) screen described polynucleotide.

One kind with the contrast crop compare, its production potential, the propagation method of the crop of the genetic modification that the digestibility at endogenous transglucosylase or a certain at least position improves, the method comprising the steps of i) obtains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, ii) described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop, iii) obtain a large amount of above-mentioned crops, at least the one genome contains described allos polynucleotide, iv) from described a large amount of crops, identify with the contrast crop and compare, its production potential, improve and the crop that contain described allos polynucleotide of the digestibility at endogenous transglucosylase or a certain at least position, and v) screen this crop, thereby breed the crop of this genetic modification.

One kind with the contrast crop compare, its production potential, the propagation method of the crop of the genetic modification that the digestibility at endogenous transglucosylase or a certain at least position improves, the method comprising the steps of i) mutagenesis precursor cell, tissue, organ, seed or crop, ii) therefrom obtain a large amount of crops, at least the one genome contains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, and iii) from described a large amount of crops, identify with the contrast crop and compare its production potential, improve and the crop that contain described allos polynucleotide of the digestibility at endogenous transglucosylase or a certain at least position.

9. as the arbitrary described method of claim 1-5, step I i wherein) further comprises and measure phenotype and/or identify crop, described crop is compared with the contrast crop, have the starch content or the composition that change as the starch phosphorylation level, the production potential that improve, at least the endogenous transglucosylase that improves in part cell or the organ, or the digestibility at a certain at least position improves.

10. as the arbitrary described method of claim 1-9, comprise the step that described allos polynucleotide is introduced precursor cell, tissue, organ, seed or crop and bred described a large amount of crops.

11. comprising, method as claimed in claim 10, the step of wherein introducing described polynucleotide transform and/or the described precursor cell of mutagenesis, tissue, organ, seed or crop.

12. as the arbitrary described method of claim 1-11, expression or its functionally active of the encoding gene of the enzyme that wherein said factor downward modulation comprises in endogenous starch phosphorylation and/or amylolysis.

13. as the arbitrary described method of claim 1-12, the wherein said factor is reduced endogenous starch phosphorylation in crop.

14. as the arbitrary described method of claim 1-13, wherein said method comprises that further detection is from the sudden change with the encoding gene of the polypeptide that obtains comprising of the sample of nucleic acid of crop in amylolysis and/or starch phosphorylation.

15. as the arbitrary described method of claim 1-14, wherein said endogenous starch phosphorylation and/or amylolysis are expression or active modifications that is selected from one or more enzymes of following group by change, described group comprises α-Dian Fenmei (EC 3.2.1.1), beta-amylase (EC 3.2.1.2), glucoamylase (EC 3.2.1.3), starch phosphorylase (EC2.4.1.1), transglucosylase (EC3.1.33), Sucrase-isomaltase (EC 3.2.10), amylomaltase (EC 2.4.1.25), maltin (EC 3.2.1.20), isoamylase and alpha-glucan water two kinases (GWD, EC2.7.9.4).

16. method as claimed in claim 15, wherein endogenous starch phosphorylation and/or amylolysis are by improving the expression activity of α-Dian Fenmei or beta-amylase, and/or reduce that the expression activity of GWD modifies.

17., further comprise the expression activity that reduces phosphoric acid polysaccharide water two kinases (PWD, EC 2.7.9.5) as the arbitrary described method of claim 1-16.

18. as the arbitrary described method of claim 1-17, wherein said factor expression is in the storage organ of crop, in seed, root, stem tuber or the stem of growing.

19. as the arbitrary described method of claim 1-17, wherein said factor expression is in the photosynthetic activity tissue of crop.

20. as the arbitrary described method of claim 1-19, wherein said endogenous starch phosphorylation and/or amylolysis are transient starches.

21. as claim 2 and the arbitrary described method of 4-20, wherein said transglucosylase is α-Dian Fenmei, beta-amylase, glucoamylase or transglucosylase.

22. as the arbitrary described method of claim 1-21, wherein said crop is selected from grass, vegetables, cereal, beans and the solid or crop that blooms.

23. method as claimed in claim 22, wherein said cereal are wheat, cereal (corn), barley, paddy rice, rye, oat, millet, Chinese sorghum, triticale, buckwheat, Fu Niaomi, Zhu lamb's-quarters, Si Peierte wheat, durum wheat, bread wheat, einkorn, three-coloured amaranth, wild-rice or Herba Eragrostidis pilosae.

24. as the arbitrary described method of claim 1-23, wherein said crop further contains the allos polynucleotide, the factor of its coding is connected with transcription regulating nucleotide sequence, the expression or the activity of downward modulation α-Dian Fenmei or beta-amylase, or the sudden change of regulation and control α-Dian Fenmei or beta-amylase encoding gene, wherein crop is selected from α-Dian Fenmei or the expression of beta-amylase or the crop of active reduction at least a organ.

25. method as claimed in claim 24, wherein said factor expression in the storage organ or described α-Dian Fenmei or beta-amylase encoding gene be expressed among the storage organ.

26. as the arbitrary described method of claim 1-25, the wherein said factor is the RNA molecule of downward modulation two kinase expressions.

27. as the arbitrary described method of claim 1-26; the production potential of wherein said raising are for comparing biomass raising or that increase with the contrast crop; vigor; sprout; the seedling vigor; growth rate; highly; total leaf area; the photosynthetic rate of unit leaf area; single-strain blade quantity; individual plant corolla quantity; the individual plant tillering quantity; individual plant seed quantity; single corolla seed quantity; average kernel weight; individual plant seed gross weight; the starch content of seed or stem tuber or composition; stem thickness; internode quantity; branch quantity; the quantity of blooming; the size or the shape of flower; pattern; individual plant beanpod quantity; the beanpod size; single beanpod seed quantity; the solid quantity of individual plant; bear fruit; the fruit size; the fruit shape; fruit color; fruit quality; resist disease; the root system quality; the amount of taking root; root length and/or productive rate and/or delay senility.

28. the crop of the genetic modification of or evaluation that obtain, breeding according to the arbitrary described method of claim 1-27.

29. the crop of a genetic modification, its genome contains the allos polynucleotide, it contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected, wherein said crop is characterised in that, compare with the contrast crop, it has the starch phosphorylation and/or the amylolysis of modification, and it has the production potential of raising, the endogenous transglucosylase of raising and/or the digestibility that improve at a certain at least position in addition.

30. the crop of a genetic modification, its genome contains the sudden change of introducing, this mutator gene encode endogenous starch phosphorylation polypeptide and/or amylolytic enzyme, wherein said crop is characterised in that, compare with the contrast crop, it has the production potential of raising, the endogenous transglucosylase of raising and/or the digestibility that improve at a certain at least position.

31. the crop of a genetic modification, its genome contains one or more allos polynucleotides, each polynucleotide contains the transcription regulating nucleotide sequence that is connected with the nucleotide sequence of the coding modification endogenous starch phosphorylation of crop and/or the amylolytic factor, wherein said crop is characterised in that, compare with the contrast crop, at least a certain position of described crop has the starch phosphorylation and/or the amylolysis of reduction, expression and/or active raising or the reduction of transglucosylase preferred starch enzyme in the crop ripe seed, and the production potential that improve.

32. as the arbitrary described crop of claim 28-31, it demonstrates level that target starch phosphorylation polypeptide and/or amylolytic enzyme reduce and at random at least in first organ of crop, at least demonstrate the level that target starch phosphorylation polypeptide and/or amylolytic enzyme raise in second organ of crop, wherein first or second organ is identical or different organs.

33. as the arbitrary described crop of claim 28-32, the expression or the functionally active of the enzyme that wherein said factor downward modulation comprises in endogenous starch phosphorylation and/or amylolysis.

34. as the arbitrary described crop of claim 32-33, wherein said target polypeptide or enzyme are selected from the group of being made up of following substances: α-Dian Fenmei, beta-amylase, glucoamylase, starch phosphorylase, transglucosylase, Sucrase-isomaltase, amylomaltase, maltin, isoamylase and alpha-glucan water two kinases.

35. as the arbitrary described crop of claim 28-34, the wherein said factor is reduced two kinase whose level or functionally activies.

36. crop as claimed in claim 35, wherein said two kinases are GWD or GWD and PWD.

37. as the arbitrary described crop of claim 28-36, wherein said factor expression is in the storage organ.

38. as the arbitrary described crop of claim 28-36, wherein said factor expression is in the photosynthetic activity tissue of crop.

39. as the arbitrary described crop of claim 28-38, wherein said starch phosphorylation and/or amylolysis are transient starches.

40. as the arbitrary described crop of claim 28-39, wherein said crop is selected from grass, vegetables, cereal, beans and fruit-bearing plant.

41. crop as claimed in claim 40, wherein said cereal are wheat, cereal (corn), barley, paddy rice, rye, oat, millet, Chinese sorghum, triticale, buckwheat, Fu Niaomi, Zhu lamb's-quarters, Si Peierte wheat, durum wheat, bread wheat, einkorn, three-coloured amaranth, wild-rice or Herba Eragrostidis pilosae.

42. as the arbitrary described crop of claim 28-41, wherein said transcription regulating nucleotide sequence is preferentially regulated and control the expression of polynucleotide in storage organ and/or the crop photosynthesis active mass.

43. as the arbitrary described crop of claim 28-42, wherein said crop further contains polynucleotide, it operationally is connected with the transcription regulating nucleotide sequence of the factor of coding downward modulation amylase activity.

44. as claim 28-43 arbitrary as described in the position of crop, described crop position is the plugged ear of seed, blade, stem, root, stem tuber, change, fruit, beanpod or crop.

45. crop as claimed in claim 44 position is characterized in that it has the starch content or the composition of modification, according to the output that claim 26 improves, the endogenous transglucosylase or the digestibility of raising with respect to contrast crop position.

46. a seed that contains starch, wherein the G-6-P level in the seed starch is lower than 10ng/mg starch, and the diastatic activity force level is at least 4 units/g powder in the seed powder.

47. as claim 28-43 arbitrary as described in the product of crop, it is cereal, flour, whole wheat flour or partially purified at least starch of processing, wherein said product is compared with the product of contrast crop, starch content or total starch with modification are formed.

48. a method of producing product comprises the position of plant growth and/or harvesting crops or the arbitrary described crop of claim 28-43.

49. the method for the cereal of a process for processing, flour, whole wheat flour or partially purified at least starch comprises position such as the cereal of processing the arbitrary described crop of claim 28-43.

50. method of producing foodstuff products, comprise that the product with the arbitrary described crop of claim 28-43 or position or claim 47 mixes with another food composition, and the arbitrarily cooking, baking, fry, boiling, boil, push or other processes the method for described mixture.

51. a method of producing leavened prod, this method comprise the fermentation described product of claim 47 or produce flour or starch by the described method of claim 49.

52. method that offers human or animal's food, comprise to the human or animal claim 28-43 is provided arbitrary described crop, the arbitrary described crop of claim 44-46 position, the described product of claim 47 or the product of producing by the arbitrary described method of claim 48-51.

53. product by the arbitrary described method production of claim 48-51.

Produce crop 54. use the allos polynucleotide; described crop is compared with the contrast crop; its production potential improve, the digestibility of endogenous transglucosylase raising or seed or at least a portion organ improves, and wherein said polynucleotide contains with coding modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

55. application rights requires the position that the arbitrary described crop of 28-43 or its contain starch to produce foodstuff products or non-foodstuff products.

56. described method of claim 51 or the described application of claim 55, wherein product is an ethanol.

57. application rights requires the arbitrary described crop of 28-43 or its to contain the position of starch as growth or the health of animal-feed with the enhancing animal.

Produce the human food that consumes 58. use crop or its position, wherein genetic modification is carried out by introducing at least two allos polynucleotides in crop or its position, wherein crop is characterised in that, its production potential improve, starch phosphorylation in the crop leaf and/or amylolysis reduce, endogenous transglucosylase in the crop kernel reduces, and wherein each allos polynucleotide contains with coding and modifies the transcription regulating nucleotide sequence that the nucleotide sequence of the endogenous starch phosphorylation of crop and/or the amylolytic factor can be operatively connected.

59. identify or use with the contrast crop for one kind and compare; the endogenous transglucosylase of crop productivity potential, raising or seed or the molecular marker method that improves of the part digestibility of crop at least; this method comprises the sample of nucleic acid that obtains crop, and the polymorphism of identification code crop GWD gene or its heredity connect.

60. a method of measuring crop comprises the sample of nucleic acid that obtains crop, handles the characteristic of sample with screening Nucleotide in definite GWD gene, and identifies any Nucleotide relevant with crop productivity potential.

61. one kind contain coding alpha-glucan water two kinase polypeptides or with the isolating or chimeric nucleic acid molecule of its complementary nucleotide sequence, described alpha-glucan water two kinase polypeptides contain just like aminoacid sequence or its biologically-active moiety shown in the SEQ ID NO:3 or the version that has SEQID NO:3 sequence 90% homology at least.

62. contain with nucleotide sequence shown in SEQ ID NO:2 or SEQ ID NO:5 or SEQ ID NO:8 or SEQID NO:9 or SEQ ID NO:10 or SEQ ID NO:12 or SEQ ID NO:13 or the SEQ IDNO:14 or its proteins encoded or its biologically-active moiety or with SEQ IDNO:2 (wheat GWD) or SEQ ID NO:5 (wheat GWD) or SEQ ID NO:8 or SEQ ID NO:9 or SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, the version unanimity of nucleotide sequence or its protein-coding region 90% sequence homology or the isolating or chimeric nucleic acid molecule of complementary nucleotide sequence shown in SEQID NO:13 or the SEQ ID NO:14.

63. contain under stringent condition and SEQ ID NO:2 or SEQ ID NO:5 or SEQ IDNO:8 or SEQ ID NO:9 or SEQ ID NO:10, SEQ ID NO:11, SEQ IDNO:12, nucleotide sequence or its proteins encoded or its biologically-active moiety shown in SEQ ID NO:13 or the SEQ ID NO:14 or with SEQ ID NO:2 (wheat GWD) or SEQ ID NO:5 (wheat GWD) or SEQ ID NO:8 or SEQ ID NO:9 or SEQ ID NO:10, SEQ IDNO:11, SEQ ID NO:12, isolating or the chimeric nucleic acid molecule of the nucleotide sequence of the hybridization of the version of nucleotide sequence or its protein-coding region 90% sequence homology shown in SEQ ID NO:13 or the SEQ ID NO:14.

64. contain the claim 61 that can be operatively connected, the chimeric nucleic acid configuration of 62 or 63 described nucleic acid molecule with transcription regulating nucleotide sequence.

Isolating or the chimeric nucleic acid molecule of the genetic expression that 65. can reduce encodes in the cereal crop has the active polypeptide of GWD.

66. nucleic acid molecule as claimed in claim 62, its for or encoding antisense RNA, suppress RNA, double-stranded RNA, hairpin RNA or ribozyme altogether.

Coding has the expression of gene of the active polypeptide of GWD in the isolating or chimeric nucleic acid molecule reduction cereal crop 67. use.

68. contain the single stranded nucleic acid probe of 20 continuous nucleotides, the nucleotide sequence of wherein said 20 Nucleotide is identical with the complementary nucleotide sequence of the arbitrary described nucleic acid molecule of claim 58-60.

69. be attached to the arrayed nucleic acid molecule of solid support, the oligonucleotide that this array contains optionally with contain in the cereal crop making nucleic acid molecular hybridization that coding has the gene of the active polypeptide of GWD.

70. contain claim 61-63, claim 65 or 66 or expression vector, host cell, crop cell, crop or the seed of arbitrary described nucleic acid molecule of the described configuration of claim 64.

71. the method for production cereal GWD polypeptide or its version, or the method for producing its bioactive fragment or its version are included in and express the described configuration of claim 64 in host cell, crop cell, crop, crop position or the seed.

Images