CN101955968A

CN101955968A - Constitutive expression plasmid pETPc with high startup strength, fast startup speed and wide host range and application thereof

Info

Publication number: CN101955968A
Application number: CN 201010277575
Authority: CN
Inventors: 许平; 徐友强; 陶飞; 马翠卿
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2010-09-09
Filing date: 2010-09-09
Publication date: 2011-01-26
Anticipated expiration: 2030-09-09
Also published as: CN101955968B

Abstract

The invention discloses a constitutive expression plasmid pETPc with high startup strength, fast startup speed and wide host range, and application thereof for expressing catechol dioxygenase in gram-negative bacteria. The plasmid of the invention not only can constitutively start up the expression of foreign genes, without adding any inducer or carrying out any additional induction operation, but also has the advantages of high startup strength and fast induction speed, which indicates that the plasmid has great application potential in biodegradation and bioremediation field.

Description

High startup intensity wide host range constitutive expression plasmid pETPc and application thereof

Technical field

What the present invention relates to is genetically engineered field expression plasmid and application, especially starts intensity wide host range constitutive expression plasmid pETPc about height and in the application in biological degradation and biological restoration field.

Background technology

Gene expression system has vital role in biological degradation and biological restoration field, is the important tool of carrying out exogenous gene expression.Gene expression system commonly used now, such as tac promoter expression system, Tn7 promoter expression system and some light induction types or temperature-induced type promoter expression system etc., a common defective is all arranged, be that the promotor abduction delivering needs the extra inducible factor that adds, as IPTG, temperature variation, illumination variation etc.This has brought extra operation for biological degradation and biological restoration, has increased cost, and, when environmental area is used, increased the difficulty that expression system is implemented, and may bring negative influence (Di Gennaro et al., 2008 to environment; Choi et al., 2005).Thereby, be necessary to develop the new constitutive expression plasmid that is not subjected to above-mentioned restriction.

Arene compounds is the important carcinogenic substance of a class, extensively exists in environment, not only environment has been caused severe contamination, and the serious threat human health.Utilize microorganism, eliminating environmental pollution by biological degradation and biological restoration has become present important research project.Catechol claims pyrocatechol again, is the metabolic intermediate products of many arene compounds.Catechol dioxygenase can act on the metabolic intermediate product pyrocatechol of arene compounds, the ortho position cracking of its catalysis phenyl ring.This characteristic makes this enzyme be in consequence in the arene compounds metabolism, and the environmental pollution of eliminating arene compounds is had great importance.

Reference

Di?Gennaro?P，Ferrara?S，Bestetti?G，et?al.Novel?auto-inducing?expression?systems?for?the?development?of?whole-cell?biocatalysts.Appl?Microbiol?Biotechnol，2008，79：617-625.

Choi?K?H，Gaynor?J?B，White?K?G，et?al.(2005)A?Tn7-based?broad-range?bacterial?cloning?and?expression?system.Nat?Methods，2005，2：443-448.

Summary of the invention

At the defective of existing plasmid and the present situation of present stage environmental pollution, the purpose of this invention is to provide the constitutive expression plasmid of the wide host range of a kind of high startup intensity, and make it be applied in Gram-negative bacteria or gram-positive microorganism, express catechol dioxygenase.

The high wide host range constitutive expression of the intensity plasmid that starts of the present invention, called after pETPc is by replicon ori ₁₆₀₀, selection markers gene Kan (kalamycin resistance gene), multiple clone site, intergenic sequence and the high intensity constitutive promoter Pc that starts; It is characterized in that the nucleotide sequence of described plasmid pETPc is shown in SEQ ID No.4; Wherein, the described high nucleotide sequence of intensity constitutive promoter Pc that starts is shown in SEQ ID No.1.

The construction process of plasmid pETPc of the present invention is:

Synthetic promoter Pc, 225bp altogether.

With above-mentioned synthetic Pc fragment is template, and the design primer is as follows:

Pc.f (the line part is the MluI restriction enzyme site) CATG ACGCGTTGCCGATACAAGAACAA

Pc.r (the line part is the XbaI enzyme cutting site) GTCA TCTAGAACGGGTTCGCTACCTGC

Prepare reaction system: ddH then ₂O 34 μ l, dNTP Mixture (2.5mM each) 4 μ l, 10 * Easy Taq Buffer, 5 μ l, Sense Primer (20 μ M) 0.5 μ l, Anti Primer (20 μ M) 0.5 μ l, template DNA (synthetic promotor Pc fragment) 0.5 μ l, Easy Taq 1 μ l.

Carry out polymerase chain reaction (PCR) after system prepares, it is as follows to circulate:

94 ℃ of 4min; 94 ℃ of 30s afterwards, 55 ℃ of 30s, 72 ℃ of 30s, totally 29 circulations; Last 72 ℃ of 10min.

Use the corresponding nucleic acids restriction endonuclease that amplified production and wide host range expression plasmid pET28a (nucleotide sequence is shown in SEQID No.3) are carried out enzyme respectively and cut, dna ligase connects, and identifies, obtains positive recombinant plasmid, called after pETPc; The nucleotide sequence of described plasmid pETPc is shown in SEQ ID No.4.

Plasmid pETPc of the present invention expresses the application of catechol dioxygenase in Gram-negative bacteria or gram-positive microorganism.Wherein, the expression of described catechol dioxygenase is to realize with the gene bphC (nucleotide sequence is shown in SEQ ID No.2) that inserts catechol dioxygenase behind plasmid pETPc promotor Pc.

The enzyme that catechol dioxygenase gene bphC expresses is catechol dioxygenase BphC, the characteristic of this enzyme is, the sticking furancarboxylic acid semialdehyde of its 2-of catalytic cpd catechol generation rapidly hydroxyl, the sticking furancarboxylic acid semialdehyde of 2-hydroxyl is a kind of compound that yellow color is arranged, and catechol is colourless.Cut by the endonuclease enzyme in the experiment, DNA connects, the operation of conversion equimolecular, catechol dioxygenase gene bphC is inserted into promotor Pc back, then plasmid is transformed different bacterial strains, by spraying the catechol aqueous solution to the transformant flat board, the colour-change of observing transformant detects transformant easily and whether has the ability that the catalytic cpd catechol generates the sticking furancarboxylic acid semialdehyde of 2-hydroxyl, whether can constitutive expression and host's scope of application of plasmid thereby detect plasmid of the present invention, and detect other characteristic of plasmid by the active mensuration of catechol dioxygenase.

The applying step of above-mentioned plasmid pETPc is: extract genome from pseudomonas P.putida B6-2 (CGMCC No.3758), as template, pcr amplification obtains gene bphC, design the primer that has different nucleic acid endonuclease digestions site then respectively, with the amplified production is that template increases again, with the corresponding nucleic acids restriction endonuclease amplified production and plasmid pETPc is carried out enzyme respectively then and cuts, and dna ligase connects, identify, obtain positive recombinant plasmid pETPcbphC.Based on this, recombinant plasmid is transformed different hosts with the electroporation conversion method, as Gram-negative bacteria or gram-positive microorganism.Detect by the spraying catechol aqueous solution and bacterium colony PCR.Result of study shows that pETPc can be applicable to preferably that ((Escherichia coli Mach T1) buys from the Beijing Quanshijin Biotechnology Co., Ltd (TransGen Biotech to the Gram-negative bacteria intestinal bacteria, Co.)), Pseudomonas fluorescens CICC 23254 ((Pseudomonas fluorescens CICC 23254) is available from Chinese industrial microbial strains preservation administrative center) and gram-positive microorganism subtilis 168 ((Bacillus subtilis 168, ATCC 23857) is available from the biological product preservation of USS center) etc.

The present invention further detects the enzyme work of plasmid pETPcbphC expression catechol dioxygenase.At first, will be through verifying the correct transformant Escherichia coli Mach/pETPcbphC incubated overnight that makes up plasmid that contains.Then, by 1% inoculum size switching 50ml/500ml LB triangular flask, the shaking table concussion is cultivated.Cell concentration (OD is measured in sampling in per two hours ₆₀₀) and the enzyme of catechol dioxygenase BphC live.

Described enzyme activity determination method is: the ultrasonic disruption bacterium, centrifugal removal cell debris is got a certain amount of crude enzyme liquid and is diluted to 3ml with APbuffer (the PB damping fluid that contains the pH 7.5 of 10% acetone), adds the catechol solution of the 0.2M of 50 μ l, the vibration mixing.Measure the concrete data (see figure 3) that enzyme is lived with the UV-2500 ultraviolet spectrophotometer then.

The present invention utilizes promotor Pc and the wide host range expression plasmid pET28a in the bacterium III type integron to make up new expression plasmid pETPc, because promotor Pc has does not need to induce (being constitutive expression), start the intensity height, toggle speed is fast and advantage of wide range of application (Xu et al., 2007), this promotor is inserted on the plasmid, make the plasmid that makes up have the advantage of this promotor, promptly do not need to induce, start the intensity height, toggle speed is fast and applied widely, the good alternative system of gene expression system at present just.In order to detect the application potential of plasmid of the present invention in biological degradation and biological restoration field, the present invention is a template with pseudomonas (P.putida) B6-2 genome, the gene bphC of polymerase chain reaction (PCR) clone's catechol dioxygenase, by the endonuclease enzyme cut, serial molecule manipulations such as DNA connection, conversion are inserted into the back of promotor Pc among the expression plasmid pETPc, and the enzyme that has detected catechol dioxygenase is lived.To make up plasmid by natural conversion method and electroporation conversion method and transform different Gram-negative bacteria and gram-positive microorganism, find that plasmid of the present invention is preferably applied to Gram-negative bacteria intestinal bacteria, Pseudomonas fluorescens or gram-positive microorganism subtilis.Above characteristics show that plasmid pETPc of the present invention has that host range is wide, constitutive expression, characteristics that starting efficiency is high, do not need to add any inductor or carry out any extra operation of inducing.The characteristics of plasmid provided by the present invention make the good alternative system of its gene induced expression system that becomes present use, have great application prospect in biological degradation and biological restoration field.

Described host is meant the bacterial cell that plasmid transforms.

Described transformant is meant that plasmid is transformed in the bacterium, and the bacterial cell of accepting plasmid is called transformant.

Described active the detection is meant to connect foreign gene in promotor Pc back, transformed host cell then, and the activity of the enzyme by detecting exogenous gene expression, whether the promotor Pc fragment that characterizes acquisition has functionally active.

Described constitutive expression is and the corresponding notion of inducible expression to be meant that gene need not to induce can realize a kind of gene expression ways of expressing.

Described inducible expression be meant that gene is not expressed under normal conditions or the expression degree is very low, but under the effect of inductor, this gene transcription and expression is activated or a kind of gene expression ways of enhanced.

Reference

Xu?H，Davies?J，Miao?V.(2007)Molecular?characterization?of?class?3integrons?from?Delftiaspp.J?Bacteriol，2007，189：6276-6283.

Description of drawings

Fig. 1 plasmid pETPc collection of illustrative plates, ori among the figure ₁₆₀₀Be replicon, Kan is a kalamycin resistance gene, and f1 region is the exclusive zone of this plasmid, and it doesn't matter with content of the present invention.

Fig. 2 plasmid pETPcbphC collection of illustrative plates, ori among the figure ₁₆₀₀Be replicon, bphC is the gene of catechol dioxygenase, and Kan is a kalamycin resistance gene, and f1 region is the exclusive zone of this plasmid, and it doesn't matter with content of the present invention.

The structure of plasmid pETPcbphC is in order to detect the characteristic of plasmid pMMPc by gene bphC.

Fig. 3 is transformant E.coli Mach T1/pETPcbphC cell concentration and enzyme live data curve.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only are used to illustrate the present invention, limit the scope of the invention and be not used in.The experimental technique of unreceipted actual conditions among the following embodiment, according to ordinary method, clone as the Sambrook equimolecular: the condition described in the laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or the condition of advising according to manufacturer.

Embodiment 1

PET28a (extracts available from U.S. hero's life technology company limited (Invitrogen, Co., USA)) plasmid

A small amount of extraction of plasmid uses TIANGEN TIANperp Mini Plasmid Kit plasmid corpusculum test kit (centrifugal column type) to finish.

1. column equilibration step: to adsorption column CB3 (adsorption column is put into collection tube), add the balance liquid BL of 500 μ l, 12, (13400*g) centrifugal 1min outwells the waste liquid in the collection tube to 000rpm, and adsorption column is reentered in the collection tube.

2. get the bacterium of 1-5ml incubated overnight, add in the centrifuge tube, 12, (13400*g) centrifugal 1min absorbs supernatant (bacterium liquid can be collected bacterial sediment in the centrifuge tube by repeatedly centrifugal more for a long time) to 000rpm as far as possible.

3. in the centrifuge tube that leaves bacterial sediment, add 250 μ l solution P1 (please check earlier and added RNaseA whether), use pipettor or the vortex vibrator bacterial precipitation that thoroughly suspends.

Attention: if the not bacterium piece of thorough mixing is arranged, can influence cracking, cause extracted amount and purity on the low side.

4. in centrifuge tube, add 250 μ l solution P2, leniently spin upside down and make the abundant cracking of thalline for 4-6 time.

Attention: gentle mixing, concuss not in order to avoid interrupt genomic dna, causes in the plasmid of extraction and is mixed with genomic DNA fragment.This moment the bacterium liquid limpid thickness that becomes, the used time is no more than 5min, in order to avoid plasmid is damaged.

5. add 350 μ l solution P3 in centrifuge tube, gentle immediately spins upside down 6-8 time, and fully mixing white flocks will occur at this moment.12, (13400*g) centrifugal 10min, form precipitation in the centrifuge tube bottom this moment to 000rpm.

Attention: P3 should mix after adding immediately, avoids producing localized precipitation.If also have the minute white precipitation in the supernatant, but get supernatant behind the recentrifuge.

6. carefully supernatant is poured or is moved into into (adsorption column is put into collection tube) among the adsorption column CB3, the sucking-off precipitation of noting trying not.Room temperature is placed 1-2min, and 12,000rpm (13400*g) centrifugal 30-60 second, outwell the waste liquid in the collection tube, adsorption column is relay reclaim in the collector.

7. in adsorption column CB3, add 700 μ l rinsing liquid PW (please check earlier and added dehydrated alcohol whether), 12,000rpm (13400*g) centrifugal 30-60 second, outwell the waste liquid in the collection tube, adsorption column is relay reclaim in the collector.

8. in adsorption column CB3, add 500 μ l rinsing liquid PW, 12,000rpm (13400*g) centrifugal 30-60 second, outwells the waste liquid in the collection tube.

9. adsorption column CB3 is relay and reclaim in the collector, 12, (13400*g) centrifugal 2min, purpose is that rinsing liquid remaining on the adsorption column is removed to 000rpm.

Attention: experiment that alcoholic acid is residual in the rinsing liquid can the follow-up enzyme reaction of influence (enzyme is cut, PCR etc.).For guaranteeing that the downstream experiment is not subjected to the influence of residual ethanol, adsorption column CB3 is uncapped in suggestion, places room temperature or 50 ℃ of incubators to place several minutes, thoroughly to dry rinsing liquid remaining in the sorbing material.

10. adsorption column CB3 is placed a clean centrifuge tube, to adsorption film middle part Dropwise 5 0-100 μ l elution buffer EB, room temperature is placed 1min, and 12, (13400*g) centrifugal 2min collects plasmid solution in the centrifuge tube 000rpm.

The dna gel electrophoresis detection has been extracted plasmid pET28a by test kit.

Embodiment 2

Pseudomonas (Pseudomonas putida) B6-2 (contriver is preserved in the common micro-organisms center C GMCC No.3758 of China Committee for Culture Collection of Microorganisms) genome extracts.

Wizard Genomic DNA Purification Kit is used in genomic a small amount of extraction, and (WI USA) finishes for Promega Corporation, Madison.

1. get the bacterium of 1.5ml incubated overnight, add in the centrifuge tube, 12, (13400*g) centrifugal 1min absorbs supernatant (bacterium liquid can be collected bacterial sediment in the centrifuge tube by repeatedly centrifugal more for a long time) to 000rpm as far as possible.

2. add 600 μ l nucleic acid lysate, mixings gently.

3. 80 ℃, incubation 5min is cooled to room temperature then.

4. add 3 μ l RNA enzymes, mixing, 37 ℃, incubation 15-60min is cooled to room temperature then.

5. add 200 μ l albumen extracts, the vortex mixing.Ice bath 5min.Then 13,000rpm, centrifugal 3min.

6. supernatant is transferred in the new eppendorf pipe, adds 600 μ l Virahols, mixing.13,000rpm, centrifugal 3min discards supernatant liquor.

7. 70% ethanol that in the eppendorf pipe, adds 600 μ l room temperatures, the light shaking mixing.Then 13,000rpm, centrifugal 3min.

8. abandon supernatant, room temperature is placed 10-15min, and the eppendorf pipe is dried.

9. add 100 μ l lysates and place 1h, perhaps 4 ℃ of dissolving genomic dnas that spend the night for 65 ℃.

The dna gel electrophoresis detection has been extracted the genome of pseudomonas B6-2 by test kit.

Embodiment 3

1. polymerase chain reaction (PCR) clone gene bphC

Design of primers is as follows:

BphC.f (the line part is the NheI restriction enzyme site)

CGTA GCTAGCTCGACGAAGGAGACAGTAATGAGCATCA

BphC.r (the line part is the HindIII restriction enzyme site)

GATC AAGCTTCTAGATCATGCTTTGTTGCGCGCAG

1. the preparation of reaction system: ddH ₂O 34 μ l, dNTP Mixture (2.5mM each) 4 μ l, 10 * Easy Taq Buffer, 5 μ l, Sense Primer (20 μ M) 0.5 μ l, Anti Primer (20 μ M) 0.5 μ l, template DNA (P.putida B6-2 genome) 0.5 μ l, Easy Taq 1 μ l.

2. polymerase chain reaction (PCR) circulation

Concrete steps are: 94 ℃ of 4min; 94 ℃ of 30s afterwards, 55 ℃ of 30s, 72 ℃ of 1min, totally 29 circulations; Last 72 ℃ of 10min.

The dna gel electrophoresis detection has amplified gene bphC.

2. polymerase chain reaction (PCR) clone gene Pc (Pc gene fragment by Beijing Liuhe Huada Genomics Technology Co., Ltd synthetic).

Design of primers is as follows:

1. the preparation of reaction system: ddH ₂O 34 μ l, dNTP Mixture (2.5mM each) 4 μ l, 10 * Easy Taq Buffer, 5 μ l, Sense Primer (20 μ M) 0.5 μ l, Anti Primer (20 μ M) 0.5 μ l, template DNA (the promotor Pc fragment of synthetic) 0.5 μ l, EasyTaq 1 μ l.

2. polymerase chain reaction (PCR) circulation

Concrete steps are: 94 ℃ of 4min; 94 ℃ of 30s afterwards, 55 ℃ of 30s, 72 ℃ of 30s, totally 29 circulations; Last 72 ℃ of 10min.

The dna gel electrophoresis detection has amplified gene Pc.

Embodiment 4

PETPc, the structure of pETPcbphC plasmid

1.pETPc the structure of plasmid

Extract the pET28a plasmid, pcr amplification Pc promotor, Pc.f (MluI) Pc.r (XbaI) is with Pc promotor (the endonuclease MluI 0.5 μ l of MluI and XbaI enzyme cutting processing pET28a plasmid and pcr amplification, endonuclease XbaI 0.5 μ l, 10 * Buffer, 1 μ l, DNA 8 μ l, 37 ℃, 2 hours), connect, transformed into escherichia coli screens transformant with colony polymerase chain reaction (PCR) method.Obtained plasmid pETPc by screening, its nucleotide sequence is shown in SEQ ID No.4.

2.pETPcbphC the structure of plasmid

1. extract the pETPc plasmid, NheI and HindIII double digestion (endonuclease NheI 0.5 μ l, endonuclease HindIII 0.5 μ l, 10 * Buffer, 1 μ l, DNA8 μ l, 37 ℃, 2 hours) are cut glue and are reclaimed plasmid purification pETPc.

2. amplification gene bphC (bphC.f (NheI) bphC.r (HindIII)), NheI and HindIII enzyme are cut PCR product (endonuclease reaction with step 1.), be connected (10 * T4DNA Ligase Buffer, 1 μ l then with the pETPc plasmid that above-mentioned enzyme cuts, T4DNALigase 1 μ l, plasmid fragment 1.5 μ l, gene bphC fragment 6.5 μ l, 16 ℃, the connection of spending the night), transformed into escherichia coli, transformant by the ordinary method screening has gene activity has obtained plasmid pETPcbphC, and its nucleotide sequence is shown in SEQ IDNo.5.

Embodiment 5

Making up the plasmid host scope of application detects

1. plasmid pETPc, pETPcbphC is by nature conversion method transformed into escherichia coli (intestinal bacteria Mach T1 ((Escherichia coli Mach T1) buys from the Beijing Quanshijin Biotechnology Co., Ltd (TransGen Biotech, Co.))).

1. prepare competent escherichia coli cell.

2. 10 μ l plasmids are added 100 μ l competence Bacillus coli cells, mix ice bath 30min.

3. 37 ℃ of water bath heat preservation 5min.

4. ice bath 2min adds 400 μ l LB liquid nutrient mediums, cultivates 1h for 37 ℃.

5. get 100 μ l cultures, coating resistant panel, overnight incubation.

Through the ordinary method checking, obtained E.coli Mach T1/pETPc, E.coli Mach T1/pETPcbphC transformant.

2. plasmid pETPcbphC transforms pseudomonas (Pseudomonas fluorescens CICC 23254 ((Pseudomonas fluorescens CICC 23254) is available from Chinese industrial microbial strains preservation administrative center)) by the electroporation conversion method.

1. prepare the pseudomonas competence.

2. in 150 μ l competent cells, add 10 μ l (50ng/ μ l) DNA, transfer in the electric revolving cup of ice bath precooling, place 1～1.5min on ice.

3. shock by electricity: 25 μ F, 200 Ω, time constant is 4.5～5.0ms, is lower than 4.2ms, then efficient obviously descends.

4. take out cup and add the 1ml recovery media immediately after electric shock finishes, hatch 1h for 30 ℃.

5. be coated with resistant panel, 30 ℃ of incubated overnight.

Through the ordinary method checking, obtained Pseudomonas fluorescens/pETPcbphC transformant.

3. plasmid pETPcbphC transforms subtilis (subtilis 168 ((Bacillus subtilis 168, ATCC 23857) is available from the biological product preservation of USS center)) by the electroporation conversion method.

1. the competent preparation of subtilis.

2. in 80 μ l competent cells, add 1 μ l (50ng/ μ l) DNA, transfer in the electric revolving cup of ice bath precooling, place 1～1.5min on ice.

4. take out cup and add the 1ml recovery media immediately after electric shock finishes, hatch 3h for 37 ℃.

5. be coated with resistant panel, 37 ℃ of incubated overnight.

Through the ordinary method checking, obtained the B.subtilis/pETPcbphC transformant.

4. to the dull and stereotyped spraying of the transformant catechol aqueous solution, change the detection plasmid whether can the constitutive expression and its scope of application by the transformant colony colour.

Found that plasmid pETPc can preferably be applicable to gram negative strain bacterial strain intestinal bacteria, Pseudomonas fluorescens or gram-positive microorganism subtilis.

5. bacterium colony PCR detects transformant

Picking transformant bacterium colony shakes pipe to LB, the concussion of spending the night is cultivated, and gets 1ml bacterium liquid, and is centrifugal, abandon supernatant, bacterium mud suspends with 100 μ l sterilized waters, and boiling water bath 10min is centrifugal then, with supernatant as template, carry out embodiment 3 described polymerase chain reactions, amplified the band about 800bp, prove and contain correct structure plasmid in the transformant.

Embodiment 6

Make up plasmid and induce intensity detection

Will be through verifying the correct transformant E.coli Mach/pETPcbphC incubated overnight that makes up plasmid that contains.

By 1% inoculum size switching 50ml/500ml LB triangular flask, 30 ℃ of shaking table concussions are cultivated.Transformant E.coli Mach/pETPcbphC does not add any inductor and does not carry out any other the operation of inducing yet.Cell concentration (OD is measured in sampling in per two hours ₆₀₀) and the enzyme of catechol dioxygenase (BphC) live.

The enzyme activity determination method: the ultrasonic disruption bacterium, centrifugal removal cell debris is got a certain amount of crude enzyme liquid and is diluted to 3ml with AP buffer (the pH 7.5PB damping fluid that contains 10% acetone), adds the catechol solution of the 0.2M of 50 μ l, the vibration mixing.Measure the concrete data (concrete data are seen Fig. 3) that enzyme is lived with the UV-2500 ultraviolet spectrophotometer then.

Claims

1. the one kind high wide host's constitutive expression of startup intensity plasmid, called after pETPc is by replicon ori ₁₆₀₀, selection markers gene Kan (kalamycin resistance gene), multiple clone site, intergenic sequence and the high intensity constitutive promoter Pc that starts form; It is characterized in that the nucleotide sequence of described plasmid pETPc is shown in SEQ ID No.4; Wherein, the described high nucleotide sequence of intensity constitutive promoter Pc that starts is shown in SEQ ID No.1.

2. the pETPc of plasmid described in the claim 1 expresses the application of catechol dioxygenase in Gram-negative bacteria or gram-positive microorganism.

3. application as claimed in claim 2 is characterized in that, the expression of described catechol dioxygenase is to realize with the gene bphC that inserts catechol dioxygenase behind plasmid pETPc promotor Pc.

4. application as claimed in claim 2 is characterized in that, described Gram-negative bacteria is intestinal bacteria, Pseudomonas fluorescens, and described gram-positive microorganism is a subtilis.