CN101955967B - Constitutive expression plasmid pMMPc with high start strength and wide host range and application thereof - Google Patents
Constitutive expression plasmid pMMPc with high start strength and wide host range and application thereof Download PDFInfo
- Publication number
- CN101955967B CN101955967B CN2010102775656A CN201010277565A CN101955967B CN 101955967 B CN101955967 B CN 101955967B CN 2010102775656 A CN2010102775656 A CN 2010102775656A CN 201010277565 A CN201010277565 A CN 201010277565A CN 101955967 B CN101955967 B CN 101955967B
- Authority
- CN
- China
- Prior art keywords
- plasmid
- pmmpc
- gene
- expression
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a constitutive expression plasmid pMMPc with high start strength, high start speed and wide host range and application of the constitutive expression plasmid pMMPc for expressing catechol dioxygenase in Gram negative bacteria. The plasmid of the invention can constitutively start the expression of an exogenous gene without adding any inducer or carrying out any additional induction operation, the inducing strength is about six times higher than that of a tac promoter expression system induced by IPTG (Isopropyl Thiogalactoside), and the inducing speed is high; and proved by the tests, the plasmid has great application potentials in the fields of biodegradation and bioremediation.
Description
Technical field
What the present invention relates to is genetically engineered field expression plasmid and application, especially starts intensity wide host range constitutive expression plasmid pMMPc about height and in the application in biological degradation and biological prosthetic field.
Background technology
Gene expression system has vital role in biological degradation and biological prosthetic field, is the important tool of carrying out exogenous gene expression.Gene expression system commonly used now; Such as tac promoter expression system, Tn7 promoter expression system and some light induction types or temperature-induced type promoter expression system etc.; A common defective is all arranged; Be that the promotor abduction delivering needs extra interpolation inducible factor, like IPTG, temperature variation, illumination variation etc.This has brought extra operation for biological degradation and biological prosthetic, has increased cost, and, when environmental area is used, increased the difficulty that expression system is implemented, and may bring negative influence (Di Gennaro et al., 2008 to environment; Choi et al., 2005).Thereby, be necessary to develop the new constitutive expression plasmid that does not receive above-mentioned restriction.
Arene compounds is one type of important carcinogenic substance, in environment, extensively exists, and not only environment has been caused severe contamination, and the serious threat human health.Utilize mikrobe, eliminating environmental pollution through biological degradation and biological prosthetic has become present important research project.Catechol is claimed pyrocatechol again, is the metabolic intermediate products of many arene compounds.Catechol dioxygenase can act on the metabolic intermediate product pyrocatechol of arene compounds, the ortho position cracking of its catalysis phenyl ring.This characteristic makes this enzyme in the arene compounds metabolism, be in consequence, and the environmental pollution of eliminating arene compounds is had great importance.
Reference
Di?Gennaro?P，Ferrara?S，Bestetti?G，et?al.Novel?auto-inducing?expression?systems?for?the?development?of?whole-cell?biocatalysts.Appl?Microbiol?Biotechnol，2008，79：617-625.
Choi?K?H，Gaynor?J?B，White?K?G，et?al.(2005)A?Tn7-based?broad-range?bacterial?cloning?and?expression?system.Nat?Methods，2005，2：443-448.
Summary of the invention
To the defective of existing plasmid and the present situation of present stage environmental pollution, the purpose of this invention is to provide the constitutive expression plasmid of the wide host range of a kind of high startup intensity, and make it be applied in Gram-negative bacteria, express catechol dioxygenase.
The high wide host range constitutive expression of the intensity plasmid that starts according to the invention, called after pMMPc is made up of replicon Ref1010, selection markers gene bla (ammonia benzyl resistant gene), MCS, intergenic sequence and the high intensity constitutive promoter Pc that starts; It is characterized in that the nucleotide sequence of said plasmid pMMPc is shown in SEQ ID No.4; Wherein, the said high nucleotide sequence that starts intensity constitutive promoter Pc is shown in SEQ ID No.1.
The construction process of plasmid pMMPc of the present invention is:
Synthetic promoter Pc, 225bp altogether.
With above-mentioned synthetic Pc fragment is template, and the design primer is following:
Pc.f (the line part is the MluI restriction enzyme site) CATG
ACGCGTTGCCGATACAAGAACAA
Pc.r (the line part is the EcoRI restriction enzyme site) GTCA
GAATTCACGGGTTCGCTACCTGC
Prepare reaction system: ddH then
2O 34 μ l, dNTP Mixture (2.5mM each) 4 μ l, 10 * Easy Taq Buffer5 μ l; Sense Primer (20 μ M) 0.5 μ l; Anti Primer (20 μ M) 0.5 μ l, template DNA (synthetic promotor Pc fragment) 0.5 μ l, EasyTaq 1 μ l.
Carry out polymerase chain reaction (PCR) after system prepares, circulate as follows:
94 ℃ of 4min; 94 ℃ of 30s afterwards, 55 ℃ of 30s, 72 ℃ of 30s, totally 29 circulations; Last 72 ℃ of 10min.
Use the corresponding nucleic acids restriction endonuclease that amplified production and wide host range expression plasmid pMMB66EH (nucleotide sequence is shown in SEQ ID No.3) are carried out enzyme respectively and cut, dna ligase connects, and identifies, obtains positive recombinant plasmid, called after pMMPc; The nucleotide sequence of said plasmid pMMPc is shown in SEQ ID No.4.
Plasmid pMMPc according to the invention expresses the application of catechol dioxygenase in Gram-negative bacteria.Wherein, the expression of said catechol dioxygenase is to realize with the gene bphC (nucleotide sequence is shown in SEQ ID No.2) that behind plasmid pMMPc promotor Pc, inserts catechol dioxygenase.
The enzyme that catechol dioxygenase gene bphC expresses is catechol dioxygenase BphC; The characteristic of this enzyme is; The sticking furancarboxylic acid semialdehyde of its 2-of catalytic cpd catechol generation rapidly hydroxyl, the sticking furancarboxylic acid semialdehyde of 2-hydroxyl is a kind of compound that yellow color is arranged, and catechol is colourless.In the experiment through the endonuclease enzyme cut, DNA connects, transform the equimolecular operation, and catechol dioxygenase gene bphC is inserted into promotor Pc back, then plasmid is transformed different bacterial strains.Through spraying the catechol aqueous solution to the transformant flat board; Observe the colour-change of transformant and come to detect easily the ability whether transformant has the sticking furancarboxylic acid semialdehyde of catalytic cpd catechol generation 2-hydroxyl; Whether can constitutive expression and host's scope of application of plasmid thereby detect plasmid of the present invention, and detect other characteristic of plasmid through the active mensuration of catechol dioxygenase.
The applying step of above-mentioned plasmid pMMPc is: from pseudomonas B6-2 (CGMCC No.3758), extract genome, as template, pcr amplification obtains gene bphC.Design has the primer of endonuclease restriction enzyme site then, is template with the bphC gene, once more amplification.With endonuclease amplified production and plasmid pMMPc are carried out enzyme afterwards and cut, dna ligase connects.Through identifying, obtain positive recombinant plasmid pMMPcbphC.Based on this, recombinant plasmid is transformed different hosts with natural conversion method with the electroporation conversion method, like Gram-negative bacteria.Detect through the spraying catechol aqueous solution and bacterium colony PCR.Result of study shows that pMMPc is applicable to that preferably ((Escherichia coli MachT1) buys from the Beijing Quanshijin Biotechnology Co., Ltd (TransGen Biotech to intestinal bacteria Mach T1; Co.)), Pseudomonas stutzeri SDM (Pseudomonas stutzeri SDM, CCTCC No.M206010) and pseudomonas putida CICC 23651 ((Pseudomonas putida CICC 23651) is available from Chinese industrial microbial strains preservation administrative center) etc.
The present invention further starts intensity to the Pc promotor and studies, and has compared the startup intensity of Pc promotor and IPTG inductive tac promotor.At first, will pass through the transformant P.putida CICC 23651/pMMPcbphC incubated overnight of checking correct the containing transformant P.putida CICC23651/pMMbphC that makes up plasmid and the present invention's structure.Then, by 1% inoculum size switching 50ml/500ml LB triangular flask, the shaking table concussion is cultivated.Cell concentration (OD is measured in sampling in per two hours
600) and the enzyme of catechol dioxygenase BphC live.
Above-mentioned enzyme activity determination method is: the ultrasonic disruption bacterium, centrifugal removal cell debris is got a certain amount of crude enzyme liquid and is diluted to 3ml with APbuffer (the PB damping fluid that contains the pH 7.5 of 10% acetone), adds the catechol solution of the 0.2M of 50 μ l, the vibration mixing.Measure the concrete data that enzyme is lived with the UV-2500 ultraviolet spectrophotometer then.
With the enzyme work of two transformant different times cell concentration (OD divided by the corresponding time
600) enzyme of the unit's of obtaining concentration thalline lives; Carry out data relatively; Find high about 6 times of the peak that peak that P.putida CICC 23651/pMMPcbphC of the present invention transformant unit concentration bacterial enzyme lives lives than P.putida CICC 23651/pMMbphC transformant unit concentration bacterial enzyme; And inductive speed is fast; Reached the peak of inducing intensity at 12 hours, and IPTG inductive tac promoter expression system reaches the peak (concrete data are seen Fig. 4) of inducing intensity about 14 hours.This result shows; The plasmid pMMPc (Pc promotor) that the present invention makes up need not add any inductor or carry out anyly extraly can starting expression of exogenous gene when inducing operation; And broad host range expression plasmid pMMB66EH (IPTG inductive tac promotor) has higher starting efficiency, and toggle speed is also fast.
The present invention utilizes promotor Pc and the wide host range expression plasmid pMMB66EH in the bacterium III type integron to make up new expression plasmid pMMPc; Because promotor Pc does not have need induce (being constitutive expression), start the intensity height, toggle speed is fast and advantage of wide range of application (Xu et al.; 2007); This promotor is inserted on the plasmid; The plasmid that make to make up has the advantage of this promotor, promptly need not induce, start the intensity height, toggle speed is fast and applied widely, just the good alternative system of gene expression system at present.In order to detect the application potential of plasmid of the present invention in biological degradation and biological prosthetic field; The present invention is a template with pseudomonas (P.putida) B6-2 genome; The gene bphC of polymerase chain reaction (PCR) clone catechol dioxygenase is through the back that the endonuclease enzyme is cut, serial molecule manipulations such as DNA connection, conversion are inserted into promotor Pc among the expression plasmid pMMPc.Enzyme through detecting the bphC gene is lived; And compare with the enzyme work of IPTG inductive tac promotor bphC gene; Discovery plasmid pMMPc in practical application need not to add inductor or carries out any extra startup expression of exogenous gene that operation can be rapidly and efficiently of inducing when starting exogenous gene expression; And its expression intensity in pseudomonas is than high about 6 times of IPTG inductive expression system; And the used time of the peak that reaches expression intensity also shortens 2 hours, i.e. the fast (see figure 4) of inductive speed.To make up plasmid through natural conversion method and electroporation conversion method and transform different gram negative bacteriums, find that plasmid of the present invention can be preferably applied to intestinal bacteria, Pseudomonas stutzeri and pseudomonas putida.Above characteristics show that plasmid pMMPc of the present invention has the advantages that constitutive expression, starting efficiency are high, toggle speed is fast, host range is wide, need not add any inductor or carry out any extra operation of inducing.The characteristics of plasmid provided by the present invention make the good alternative system of its gene induced expression system that becomes present use, have great application prospect in biological degradation and biological prosthetic field.
Described host is meant the bacterial cell that plasmid transforms.
Described transformant is meant that plasmid is transformed in the bacterium, and the bacterial cell of accepting plasmid is called transformant.
Described active the detection is meant at promotor Pc to connect foreign gene at the back, transformed host cell then, and the activity of the enzyme through detecting exogenous gene expression, whether the promotor Pc fragment that characterizes acquisition has functionally active.
Described constitutive expression is and the corresponding notion of inducible expression to be meant that gene need not to induce can realize a kind of gene expression ways of expressing.
Described inducible expression be meant that gene is not expressed under normal conditions or the expression degree is very low, but under the effect of inductor, this gene transcription and expression is activated or a kind of gene expression ways of enhanced.
Reference
Xu?H，Davies?J，Miao?V.(2007)Molecular?characterization?of?class?3integrons?from?Delftia?spp.J?Bacteriol，2007，189：6276-6283.
Description of drawings
Fig. 1 is a plasmid pMMbphC collection of illustrative plates; The structure of this plasmid is in order to compare with plasmid pMMPcbphC, to detect the difference of plasmid pMMbphC (IPTG inductive lac promotor) and plasmid pMMPcbphC (Pc promotor) plasmid characteristic; Ref1010 is a replicon among the figure, and bla is an ampicillin resistance gene, and lacI is the suppressor gene of gene expression regulation, and bphC is the gene of catechol dioxygenase.
Fig. 2 is a plasmid pMMPc collection of illustrative plates, and Ref1010 is a replicon among the figure, and bla is an ampicillin resistance gene, and lacI is the suppressor gene of gene expression regulation, and Pc is the high intensity groups moulding expression promoter gene that starts.
Fig. 3 is a plasmid pMMPcbphC collection of illustrative plates; Ref1010 is a replicon among the figure, and bla is an ampicillin resistance gene, and lacI is the suppressor gene of gene expression regulation; Pc is the high intensity groups moulding expression promoter gene that starts, and bphC is the gene of catechol dioxygenase.
The structure of plasmid pMMPcbphC is in order to detect the characteristic of plasmid pMMPc through gene bphC.
Fig. 4 is transformant P.putida CICC 23651/pMMbphC and P.putida CICC 23651/pMMPcbphC unit cell concentration enzyme live data curve.
Embodiment
Below in conjunction with concrete embodiment, further set forth the present invention.These embodiment only are used to explain the present invention, and are not used in restriction scope of the present invention.The experimental technique of unreceipted actual conditions among the following embodiment; According to ordinary method; Clone like the Sambrook equimolecular: the condition described in the laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or the condition of advising according to manufacturer.
(come from GenBank, numbering: X15234) plasmid extracts pMMB66EH
A small amount of extraction of plasmid uses TIANGEN TIANperp Mini Plasmid Kit plasmid corpusculum test kit (centrifugal column type) to accomplish.
1. column equilibration step: to adsorption column CB3 (adsorption column is put into collection tube), add the balance liquid BL of 500 μ l, 12, (13400*g) centrifugal 1min outwells the waste liquid in the collection tube to 000rpm, and adsorption column is reentered in the collection tube.
2. get the bacterium of 1-5ml incubated overnight, add in the centrifuge tube, 12, (13400*g) centrifugal 1min absorbs supernatant (bacterium liquid can be collected bacterial sediment in the centrifuge tube through repeatedly centrifugal more for a long time) to 000rpm as far as possible.
3. in the centrifuge tube that leaves bacterial sediment, add 250 μ l solution P1 (please check earlier and added RNaseA whether), use pipettor or the vortex vibrator bacterial precipitation that thoroughly suspends.
Attention: if the not bacterium piece of thorough mixing is arranged, can influence cracking, cause extracted amount and purity on the low side.
4. in centrifuge tube, add 250 μ l solution P2, leniently spin upside down and make the abundant cracking of thalline for 4-6 time.
Attention: gentle mixing, concuss not in order to avoid interrupt genomic dna, causes in the plasmid of extraction and is mixed with genomic DNA fragment.This moment the bacterium liquid limpid thickness that becomes, the used time is no more than 5min, in order to avoid plasmid is damaged.
5. in centrifuge tube, add 350 μ l solution P3, gentle immediately spins upside down 6-8 time, and fully mixing white flocks will occur at this moment.12, (13400*g) centrifugal 10min, form deposition in the centrifuge tube bottom this moment to 000rpm.
Attention: P3 should mix after adding immediately, avoids producing localized precipitation.If also have the minute white deposition in the supernatant, but get supernatant behind the recentrifuge.
6. carefully supernatant is poured or is moved into into (adsorption column is put into collection tube) among the adsorption column CB3, the sucking-off deposition of noting trying not.Room temperature is placed 1-2min, and 12,000rpm (13400*g) centrifugal 30-60 second, outwell the waste liquid in the collection tube, adsorption column is relay reclaim in the collector.
7. in adsorption column CB3, add 700 μ l rinsing liquid PW (please check earlier and added absolute ethyl alcohol whether), 12,000rpm (13400*g) centrifugal 30-60 second, outwell the waste liquid in the collection tube, adsorption column is relay reclaim in the collector.
8. in adsorption column CB3, add 500 μ l rinsing liquid PW, 12,000rpm (13400*g) centrifugal 30-60 second, outwells the waste liquid in the collection tube.
9. adsorption column CB3 is relay and reclaim in the collector, 12, (13400*g) centrifugal 2min, purpose is that rinsing liquid remaining on the adsorption column is removed to 000rpm.
Attention: experiment that alcoholic acid is residual in the rinsing liquid can the follow-up enzyme reaction of influence (enzyme is cut, PCR etc.).For guaranteeing that the downstream experiment does not receive the influence of residual ethanol, adsorption column CB3 is uncapped in suggestion, places room temperature or 50 ℃ of incubators to place several minutes, thoroughly to dry rinsing liquid remaining in the sorbing material.
10. adsorption column CB3 is placed a clean centrifuge tube, to adsorption film middle part Dropwise 5 0-100 μ l elution buffer EB, room temperature is placed 1min, and 12, (13400*g) centrifugal 2min collects plasmid solution in the centrifuge tube 000rpm.
The dna gel electrophoresis detection has been extracted plasmid pMMB66EH through test kit.
Pseudomonas (Pseudomonas putida) B6-2 (contriver is preserved in the common micro-organisms center C GMCC No.3758 of China Committee for Culture Collection of Microorganisms) genome extracts.
Wizard Genomic DNA Purification Kit is used in genomic a small amount of extraction, and (WI USA) accomplishes for Promega Corporation, Madison.
1. get the bacterium of 1.5ml incubated overnight, add in the centrifuge tube, 12, (13400*g) centrifugal 1min absorbs supernatant (bacterium liquid can be collected bacterial sediment in the centrifuge tube through repeatedly centrifugal more for a long time) to 000rpm as far as possible.
2. add 600 μ l nucleic acid lysate, mixings gently.
3. 80 ℃, incubation 5min is cooled to room temperature then.
4. add 3 μ l RNA enzymes, mixing, 37 ℃, incubation 15-60min is cooled to room temperature then.
5. add 200 μ l albumen extracts, the vortex mixing.Ice bath 5min.Then 13,000rpm, centrifugal 3min.
6. supernatant is transferred in the new eppendorf pipe, adds 600 μ l Virahols, mixing.13,000rpm, centrifugal 3min discards supernatant.
7. 70% ethanol that in the eppendorf pipe, adds 600 μ l room temperatures, the light shaking mixing.Then 13,000rpm, centrifugal 3min.
8. abandon supernatant, room temperature is placed 10-15min, and the eppendorf pipe is dried.
9. add 100 μ l lysates and place 1h, perhaps 4 ℃ of dissolving genomic dnas that spend the night for 65 ℃.
The dna gel electrophoresis detection has been extracted the genome of pseudomonas B6-2 through test kit.
Embodiment 3
1. polymerase chain reaction (PCR) clone gene bphC
Design of primers is following:
BphC.f (the line part is the SmaI restriction enzyme site)
CGTA
CCCGGGTCGACGAAGGAGACAGTAATGAGCATCA
BphC.r (the line part is the HindIII restriction enzyme site)
GATC
AAGCTTCTAGATCATGCTTTGTTGCGCGCAG
1. the preparation of reaction system: ddH
2O 34 μ l, dNTP Mixture (2.5mM each) 4 μ l, 10 * Easy Taq Buffer5 μ l; Sense Primer (20 μ M) 0.5 μ l; Anti Primer (20 μ M) 0.5 μ l, template DNA (P.putida B6-2 genome) 0.5 μ l, EasyTaq 1 μ l.
2. polymerase chain reaction (PCR) circulation
Concrete steps are: 94 ℃ of 4min; 94 ℃ of 30s afterwards, 55 ℃ of 30s, 72 ℃ of 1min, totally 29 circulations; Last 72 ℃ of 10min.
The dna gel electrophoresis detection has amplified gene bphC.
2. polymerase chain reaction (PCR) clone gene Pc (Pc gene fragment by Beijing Liuhe Huada Genomics Technology Co., Ltd synthetic).
Design of primers is following:
Pc.f (the line part is the MluI restriction enzyme site) CATG
ACGCGTTGCCGATACAAGAACAA
Pc.r (the line part is the EcoRI restriction enzyme site) GTCA
GAATTCACGGGTTCGCTACCTGC
1. the preparation of reaction system: ddH
2O 34 μ l, dNTP Mixture (2.5mM each) 4 μ l, 10 * Easy Taq Buffer5 μ l; Sense Primer (20 μ M) 0.5 μ l; Anti Primer (20 μ M) 0.5 μ l, template DNA (synthetic promotor Pc fragment) 0.5 μ l, EasyTaq 1 μ l.
2. polymerase chain reaction (PCR) circulation
Concrete steps are: 94 ℃ of 4min; 94 ℃ of 30s afterwards, 55 ℃ of 30s, 72 ℃ of 30s, totally 29 circulations; Last 72 ℃ of 10min.
The dna gel electrophoresis detection has amplified gene Pc.
PMMbphC, pMMPc, the structure of pMMPcbphC plasmid
1.pMMbphC the structure of plasmid
1. extract the pMMB66EH plasmid, SmaI and HindIII double digestion (endonuclease SmaI 0.5 μ l, endonuclease HindIII 0.5 μ l, 10 * Buffer, 1 μ l, DNA 8 μ l, 37 ℃, 2 hours) are cut glue then and are reclaimed big fragment.
2. amplification gene bphC (bphC.f (SmaI) bphC.r (HindIII)); SmaI cuts PCR product (endonuclease reaction is with 1. identical) with the HindIII enzyme, is connected (10 * T4DNA Ligase Buffer, 1 μ l, T4DNALigase 1 μ l then with the plasmid that above-mentioned enzyme cuts; Plasmid fragment 1.5 μ l; Gene bphC fragment 6.5 μ l, 16 ℃, the connection of spending the night).Transformed into escherichia coli, the transformant through the ordinary method screening has gene activity has obtained plasmid pMMbphC, and its nucleotide sequence is shown in SEQ IDNo.6.
2.pMMPc the structure of plasmid
1. extract the pMMB66EH plasmid, MluI and EcoRI double digestion (endonuclease MluI 0.5 μ l, endonuclease EcoRI 0.5 μ l, 10 * Buffer, 1 μ l, DNA8 μ l, 37 ℃, 2 hours) are cut glue then and are reclaimed big fragment.
2. pcr amplification Pc promotor, Pc.f (MluI) Pc.r (EcoRI)
Cut Pc promotor (endonuclease MluI 0.5 μ l, endonuclease EcoRI 0.5 μ l, 10 * Buffer, 1 μ l, the DNA 8 μ l that handle pMMB66EH plasmid and pcr amplification with MluI and EcoRI enzyme; 37 ℃, 2 hours), connect (10 * T4DNALigase Buffer, 1 μ l, T4DNALigase 1 μ l; Plasmid fragment 1.5 μ l, gene Pc fragment 6.5 μ l, 16 ℃; The connection of spending the night), transformed into escherichia coli screens transformant with colony polymerase chain reaction (PCR) method.Transformant through the ordinary method screening has gene activity has obtained plasmid pMMPc, and its nucleotide sequence is shown in SEQ ID No.4.
3.pMMPcbphC the structure of plasmid
1. extract the pMMPc plasmid, Sma I and HindIII double digestion (endonuclease SmaI 0.5 μ l, endonuclease HindIII0.5 μ l, 10 * Buffer, 1 μ l, DNA 8 μ l, 37 ℃, 2 hours).Cut glue and reclaim plasmid purification pMMPc.
2. amplification gene bphC (bphC.for (SmaI) bphC.rev (HindIII)), SmaI and HindIII enzyme are cut PCR product and plasmid pMMPc (endonuclease SmaI 0.5 μ l, endonuclease HindIII 0.5 μ l, 10 * Buffer, 1 μ l; DNA 8 μ l, 37 ℃, 2 hours); The T4DNA ligase enzyme connects (10 * T4DNA Ligase Buffer, 1 μ l, T4DNA Ligase 1 μ l, plasmid fragment 1.5 μ l; Gene bphC fragment 6.5 μ l, 16 ℃, the connection of spending the night).Transformed into escherichia coli, the transformant that screening has gene activity.Transformant through the ordinary method screening has gene activity has obtained plasmid pMMPcbphC, and its nucleotide sequence is shown in SEQ ID No.5.
Making up the plasmid host scope of application detects
1. plasmid pMMbphC, pMMPc, pMMPcbphC is through nature conversion method transformed into escherichia coli (intestinal bacteria Mach T1 ((Escherichia coli Mach T1) buys from the Beijing Quanshijin Biotechnology Co., Ltd (TransGen Biotech, Co.))).
1. prepare competent escherichia coli cell.
2. 10 μ l plasmids are added 100 μ l competence Bacillus coli cells, mix ice bath 30min.
3. 37 ℃ of water bath heat preservation 5min.
4. ice bath 2min adds 400 μ l LB liquid nutrient mediums, cultivates 1h for 37 ℃.
5. get 100 μ l cultures, coating resistant panel, overnight cultures.
Through the ordinary method checking, obtained E.coli Mach T1/pMMbphC, E.coli Mach T1/pMMPc, E.coliMach T1pMMPcbphC transformant.
2. plasmid pMMbphC, pMMPcbphC transforms pseudomonas through the electroporation conversion method.(Pseudomonas stutzeri SDM (Pseudomonas stutzeri SDM, contriver are preserved in Chinese typical culture collection center C CTCCNo.M206010); Pseudomonas putida CICC 23651 ((Pseudomonas putida CICC23651) is available from Chinese industrial microbial strains preservation administrative center))
1. prepare the pseudomonas competence.
2. in 150 μ l competent cells, add 10 μ l (50ng/ μ l) DNA, transfer in the electric revolving cup of ice bath precooling, place 1～1.5min on ice.
3. shock by electricity: 25 μ F, 200 Ω, time constant is 4.5～5.0ms, is lower than 4.2ms, then efficient obviously descends.
4. take out cup and add the 1ml recovery media immediately after electric shock finishes, hatch 1h for 30 ℃.
5. be coated with resistant panel, 30 ℃ of incubated overnight.
Through the ordinary method checking, obtained P.stutzeri SDM/pMMPcbphC, P.putidaCICC23651/pMMbphC, P.putida CICC23651/pMMPc, P.putida CICC23651/pMMPcbphC transformant.
3. to the dull and stereotyped spraying of the transformant catechol aqueous solution, change the detection plasmid whether can the constitutive expression and its scope of application through the transformant colony colour.
The result finds that plasmid pMMPc can preferably be applicable to bacterial strain intestinal bacteria, Pseudomonas stutzeri, pseudomonas putida.
4. bacterium colony PCR detects transformant
Picking transformant bacterium colony shakes pipe to LB, and the concussion of spending the night is cultivated, and gets 1ml bacterium liquid; Centrifugal, abandon supernatant, bacterium mud suspends with 100 μ l sterilized waters; Boiling water bath 10min, centrifugal then, with supernatant as template; Carry out embodiment 3 described polymerase chain reactions, amplified the band about 800bp, prove and contain correct structure plasmid in the transformant.
Make up plasmid and induce intensity detection
To pass through transformant P.putida CICC 23651/pMMbphC and P.putidaCICC 23651/pMMPcbphC incubated overnight that correct the containing of checking makes up plasmid.
By 1% inoculum size switching 50ml/500ml LB triangular flask, 30 ℃ of shaking table concussions are cultivated.Transformant P.putida CICC23651/pMMbphC inoculation back 1.5h adds IPTG and induces, and transformant P.putida CICC 23651/pMMPcbphC does not add any inductor and do not carry out any other the operation of inducing yet.Cell concentration (OD is measured in sampling in per two hours
600) and the enzyme of catechol dioxygenase (BphC) live.
Above-mentioned enzyme activity determination method: the ultrasonic disruption bacterium, centrifugal removal cell debris is got a certain amount of crude enzyme liquid and is diluted to 3ml with AP buffer (the pH 7.5PB damping fluid that contains 10% acetone), adds the catechol solution of the 0.2M of 50 μ l, the vibration mixing.Measure the concrete data that enzyme is lived with the UV-2500 ultraviolet spectrophotometer then.
With the cell concentration (OD of the data that obtain divided by the corresponding time
600); The data of transformant P.putida CICC23651/pMMbphC and P.putida CICC 23651/pMMPcbphC are compared in mapping then; Experimental result shows that plasmid of the present invention not only can start expression of exogenous gene by composing type, need not add any inductor and also need not carry out any extra operation of inducing; And induce intensity also than high about 6 times of IPTG inductive tac promoter expression system; And inductive speed is fast, reaches the peak of inducing intensity at 12 hours, and IPTG inductive tac promoter expression system reaches the peak (concrete data are seen Fig. 4) of inducing intensity about 14 hours.
Claims (4)
1. the one kind high wide host's constitutive expression of startup intensity plasmid, called after pMMPc is made up of replicon Ref1010, selection markers gene ammonia benzyl resistant gene, MCS, intergenic sequence and the high intensity constitutive promoter Pc that starts; It is characterized in that the nucleotide sequence of said plasmid pMMPc is shown in SEQ ID No.4; Wherein, the said high nucleotide sequence that starts intensity constitutive promoter Pc is shown in SEQ ID No.1.
2. the pMMPc of plasmid described in the claim 1 expresses the application of catechol dioxygenase in Gram-negative bacteria.
3. application as claimed in claim 2; It is characterized in that; The expression of said catechol dioxygenase is to realize that with the gene bphC that behind plasmid pMMPc promotor Pc, inserts catechol dioxygenase the nucleotide sequence of wherein said gene bphC is shown in SEQID No.2.
4. application as claimed in claim 2 is characterized in that, said Gram-negative bacteria is intestinal bacteria, Pseudomonas stutzeri or pseudomonas putida.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102775656A CN101955967B (en) | 2010-09-09 | 2010-09-09 | Constitutive expression plasmid pMMPc with high start strength and wide host range and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102775656A CN101955967B (en) | 2010-09-09 | 2010-09-09 | Constitutive expression plasmid pMMPc with high start strength and wide host range and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101955967A CN101955967A (en) | 2011-01-26 |
| CN101955967B true CN101955967B (en) | 2012-01-04 |
Family
ID=43483554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102775656A Expired - Fee Related CN101955967B (en) | 2010-09-09 | 2010-09-09 | Constitutive expression plasmid pMMPc with high start strength and wide host range and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101955967B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111117940B (en) * | 2019-12-04 | 2022-06-28 | 天津大学 | Escherichia coli engineering bacterium and method for high yield of pentamethylene diamine |
-
2010
- 2010-09-09 CN CN2010102775656A patent/CN101955967B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101955967A (en) | 2011-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wiegel et al. | An introduction to the family Clostridiaceae | |
| US8309324B2 (en) | Promoters and proteins from Clostridium thermocellum and uses thereof | |
| CN101955968B (en) | Constitutive expression plasmid pETPc with high startup strength and wide host range and application thereof | |
| CN112708589A (en) | Genetically engineered bacterium, construction method thereof and application of genetically engineered bacterium in fermentation production of 5-hydroxytryptophan | |
| CN101955952B (en) | Bacterial laccase gene and expression and application thereof | |
| CN103397006A (en) | Ribitol dehydrogenase (RDH) derived from Klebsiella oxytoca, and coding gene and application thereof | |
| CN109295087B (en) | Method for expression preparation of UDP-glucose-hexose-1-phosphate uridyltransferase | |
| CN101955967B (en) | Constitutive expression plasmid pMMPc with high start strength and wide host range and application thereof | |
| CN104152425A (en) | Thermophilic esterase and application thereof in degradation of PAEs (Phthalic Acid Esters) | |
| CN102732539A (en) | Novel esterase and its application | |
| Young et al. | Clostridium | |
| CN111057695B (en) | Nitrilase and preparation method and application thereof | |
| CN101955965B (en) | Constitutive transposition expression plasmid pUCTn7Pc and application thereof | |
| Goyal et al. | Butanol tolerant bacteria: isolation and characterization of butanol tolerant Staphylococcus sciuri sp. | |
| CN101955966B (en) | High starting intensity and wide host range constitutive expression plasmid pBSPPc and application thereof | |
| KR20140145397A (en) | Recombinant microorganisms producing 1,3-propanediol and the method for preparing 1,3-propanediol using the same | |
| CN116064470A (en) | Cutinase mutant and application thereof in efficient degradation of PET | |
| CN116286560A (en) | Raoult bacterium HC6 and application thereof in low-temperature production of 2, 3-butanediol | |
| CN104403969A (en) | Peroxidase capable of degrading malachite green and preparation method for peroxidase | |
| CN101942427B (en) | Alkyl sulfatase and preparation method thereof | |
| CN109486837B (en) | High-temperature biological desulfurization genes and application | |
| CN107201354A (en) | A kind of neutral proteinase and its gene and application | |
| LIU et al. | “Past and Present” Species Name of Bacillus velezensis | |
| CN111705045B (en) | Endo-xylanase mutant S35F07 and preparation method and application thereof | |
| Sankar et al. | Isolation and characterization of solventogenic, cellulase-free xylanolytic Clostridia from cow rumen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120104 Termination date: 20150909 |
|
| EXPY | Termination of patent right or utility model |