CN101955943A - Influence is transcribed and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease - Google Patents

Influence is transcribed and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease Download PDF

Info

Publication number
CN101955943A
CN101955943A CN201010156318.0A CN201010156318A CN101955943A CN 101955943 A CN101955943 A CN 101955943A CN 201010156318 A CN201010156318 A CN 201010156318A CN 101955943 A CN101955943 A CN 101955943A
Authority
CN
China
Prior art keywords
dna
allelotrope
sequence
disease
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201010156318.0A
Other languages
Chinese (zh)
Inventor
D·怀特
戈登·W·达夫
纳兹尼恩·阿齐兹
谢忠明
肯尼思·S·科恩曼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Interleukin Genetics Inc
Original Assignee
Interleukin Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Interleukin Genetics Inc filed Critical Interleukin Genetics Inc
Publication of CN101955943A publication Critical patent/CN101955943A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/204—Modifications characterised by specific length of the oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00—Chemistry: analytical and immunological testing
    • Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
    • Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
    • Y10T436/143333—Saccharide [e.g., DNA, etc.]

Abstract

The invention provides the method and the reagent that are used for detecting the polymorphism relevant with interleukin-1 ' beta ' (IL-B) gene (IL-1B (3737)) upstream region, described polymorphism influences this gene transcription and to the susceptibility of inflammatory and communicable disease such as periodontopathy and Alzheimer.

Description

Influence is transcribed and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease
The application is to be November 19, application number in 2002 the dividing an application for the Chinese patent application of " influence transcribe and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease " that be 02827282.X, denomination of invention the applying date.
1. background of invention
The IL-1 gene cluster is positioned at the long-armed of karyomit(e) 2 (2ql3) and upward and in the zone of 430Kb comprises at least about IL-1 α (IL-1A), IL-1 β (IL-1B), (Nicklin waits (1994) Genomics, 19:382-4) with the gene of IL-1 receptor antagonist (IL-1RN).Antagonist molecule, IL-1 α and IL-1 β have effectively short scorching active and in the foremost of many inflammation cascades.Their effect causes leukocytic activation and raises to damaged tissue local generation vasoactive agent, brain exothermic reaction and liver acute phase reaction often by inducing other cytokine such as IL-6 and IL-8.All 3 kinds of IL-1 molecules and I type and II type IL-1 receptors bind, but only the I receptor with signal transduction to cell interior.Contrast therewith, the II receptor comes off and takes on and lure acceptor from cytolemma.Therefore receptor antagonist and II receptor all are being antiphlogistic aspect their effect.
The unsuitable production of IL-1 plays a major role in the pathology of many autoimmunizatioies and inflammatory diseases, and described disease comprises rheumatoid arthritis, inflammatory bowel disease, psoriasis etc.In addition, have stable interindividual variation aspect the throughput rate of IL-1, and in this difference some can be explained by the hereditary difference of IL-1 locus.Therefore, for the genetic sensitivity part of determining inflammatory diseases, the IL-1 gene is rational material standed for, and most of inflammatory diseases has the multiplefactor cause of disease with the polygene element.
It is known that some is relevant with specific symptom from the allelotrope of IL-1 gene cluster.For example, IL-1RN (VNTR) allelotrope 2 has shown with following relevant: osteoporosis (United States Patent (USP) 5,698,399), ephrosis in the diabetes (Blakemore, wait (1996) Hum.Genet.97 (3): 369-74), alopecia areata (Cork, Deng, (1995) J.Invest.Dermatol.104 (5 Supp.): 15S-16S; Cork etc. (1996) Dermatol Clin 14:671-8), Graves disease (Blakemore, Deng (1995) J.Clin.Endocrinol.80 (1): 111-5), systemic lupus erythematous (Blakemore, Deng (1994) Arthritis Rheum.37:1380-85), liver moss sclerosis (Clay waits (1994) Hum.Genet 94:407-10), and ulcerative colitis (Mansfield waits (1994) Gastoenterol.106 (3): 637-42).
In addition, have been found that from the IL-1A allelotrope 2 of mark-889 and IL-1B (TaqI) allelotrope 2 relevant (United States Patent (USP) 5,686,246 with periodontopathy from mark+3954; Kornman and diGiovine (1998) Ann Periodont 3:327-38; Hart and Kornman (1997) Periodontol 2000 14:202-15; Newman (1997) Compend Contin Educ Dent 18:881-4; Kornman etc. (1997) J.Clin Periodontol 24:72-77).Also have been found that IL-1A allelotrope 2 and property childhood chronic arthritis, particularly chronic iridocyclitis relevant (McDowell waits (1995) Arthritis Rheum.38:221-28) from mark-889.Have been found that also relevant with insulin-dependent diabetes with the psoriasis among the DR3/4 experimenter (di Giovine waits (1995) Cytokine 7:606 for IL-1B (TaqI) allelotrope 2 of mark+3954 from IL-1B; Pociot waits (1992) Eur J.Clin.Invest.22:396-402).In addition, have been found that IL-1RN (VNTR) allelotrope 1 relevant with diabetic retinopathy (referring to USSN 09/037472, and PCT/GB97/02790).In addition, the allelotrope 2 that has been found that IL-1RN (VNTR) with from the ulcerative colitis relevant (Mansfield, J. etc., (1994) Gastroenterology 106:637-42) among the Caucasia crowd in North America and Europe.Enjoyably, this is associated among the relevant Ashkenazi group of race strong (PCT WO97/25445) especially.In addition, in United States Patent (USP) 5,685,246,5,698,399,6,140,047,6,251, described the extensive method and composition that is used to detect with related IL-1 polymorphism and inflammatory diseases in 598 and 6,268,142, the content of these patents is hereby expressly incorporated by reference.In addition, at United States Patent (USP) 6,437, describe the transgenic models that is used for based on the inflammatory diseases of IL-1 locus in 216, its content is hereby expressly incorporated by reference.
The ordinary method that is used to screen inherited disease has depended on the evaluation of abasement gene product (for example Dresbach's anemia) or abnormal phenotype (for example mental retardation).These methods are for the inherited disease of the phenotype that has late coming and be difficult to identify, and are limited as the application of for example vascular disease.Along with the development of simple and cheap genetic screening method,, also can identify the polymorphism that shows development disease tendency at present even when disease is the polygene source.Along with the understanding to the hereditary basis of multi-factor disease increases, the disease quantity sustainable growth that can screen by molecular biology method.
Genetic screening (being also referred to as gene type or molecular screening), can be defined as widely check with determine the experimenter whether have the sudden change (allelotrope or polymorphism) that causes symptom or with the sudden change of the sudden change that causes symptom " chain ".Chain be meant wherein in genome near dna sequence dna tend to the phenomenon of heredity together.Because two sequences of selective advantage of heredity can be chain altogether for some.Yet, more typically, because the rare relatively of reduction division recombination event taken place in the zone between two polymorphisms, two polymorphic sequence heredity altogether.Because in given crowd, they tend to occur together in any special member of colony or do not occur, and the polymorphic allelotrope of heredity be it is said linkage disequilibrium each other altogether.In fact, find that a plurality of polymorphisms in given chromosomal region are linkage disequilibrium each other, they determine quasi-stationary heredity " haplotype ".Contrast is separated on the different homologous chromosomess them in the recombination event that takes place between two polymorphic locuses therewith.If the reduction division between the polymorphism of two physical linkages reorganization enough takes place continually, two polymorphisms will seem separates independently and it is said chain cloth balance.
Statistic correlation between inflammatory disease and the IL-1 polymorphism may not illustrate that polymorphism directly causes this disease.Relevant on the contrary polymorphism may be the optimum allele variant with the sudden change that causes disease chain (being linkage disequilibrium), it has occurred in recent people's the evolutionary history, so that does not also reach balance through time enough with the recombination event by the insertion chromosome segment.Therefore, for for the diagnosis of specified disease and the purpose of prediction experiment, can utilize the polymorphic allelic detection relevant and do not consider whether this polymorphism directly relates to the etiology of disease with this disease.In addition, when given optimum polymorphic locus when causing manifesting the polymorphic locus linkage disequilibrium that causes disease, the polymorphic locus that also has other and optimum polymorphic locus linkage disequilibrium also may with the polymorphic locus linkage disequilibrium that causes disease.Therefore the possibility with the polymorphic locus that causes inherited disease also will be predicted or be diagnosed to these other polymorphic locus.In fact, in case drawn association between people's haplotype of specified disease or symptom and correspondence, extensively people's haplotype of span (describing the hereditary altogether typical module of allelotrope of one group of chain polymorphic mark) can be used for diagnostic purpose.Therefore, can carry out the mensuration of the possibility of individual development specified disease or symptom, and need not to measure or characterize morbific heritable variation by the polymorphic allelotrope (or even one or more disease-related haplotype) that characterizes one or more disease-relateds.
Yet, although detect the diagnostic method that one or more chain allelotrope provide effective prevention and treatment inflammatory diseases in relevant with the tendency statistics of specific inflammatory diseases of development or symptom IL-1 haplotype, the most reliable final polymorphic indicator will be that those learn the strongest relevant allelotrope in key element basis (being pathogenic mutation or " function allelotrope ") with the formation disease pathogen.
For example, global a lot of research 3 kinds of chemical substances in the display organization all the time with multiple serious disease or to enliven PD relevant.Those chemical substances are interleukin 1 (IL-1), prostaglandin(PG)-E2 (PGE 2) and destroy the enzyme of collagen and ground substance of bone metalloprotease (MMP) (referring to Offenbacher, S. (1996), Ann.Periodontol.1:821; Page, R.C. and Kornman, K.S. (1997), Periodontology 2000 14:112).As if these chemical substances are important medium of inflammatory response, and play a major role in the bone loss.IL-1 is PGE 2Main instrumentality with matrix metalloproteinase.Recently (referring to Assuma, R. etc. (1998) J.Immunol.160:403) are presented at blocking-up IL-1 special in the gingival tissues and TNF α and do not have any bacterial plaque measure of control, stop the bone loss of signal portion in the periodontopathy model of monkey in research.IL-1 level in tissue and gingival crevice liquid (GCF) or cell IL-1 produce and with bone loss and more senior or progressive periodontitis be associated with many reports (referring to for example Gemmell, E. and Seymour, G.J. (1998), J.Dent.Res.77:16; Ishihara, Y. etc. (1997), J.Periodontal Res.32:524; McGee, J.M. etc. (1998), J.Periodontol.69:865; Okada, H. and Murakami, S. (1998), Crit.Rev.Oral Biol.Med.9:248; Roberts, F.A. etc. (1997), Oral Microbiol.Immunol.12:336; Salvi, G.E. etc. (1998), J.Periodontal Res.33:212; Stashenko, P. etc. (1991), J.Clin.Periodontol.18:548; Yavuzyilmaz, E. etc. (1995), Aust.Dent.J.40 (1): 46).For example, research recently (referring to Cavanaugh, P.F. etc. (1998), J.Periodont.Res.33:75), the seriousness of the bone loss that observation is compared with gingival crevice liquid IL-1 level shows that the higher level of IL-1 in the seam liquid is associated with relative more bone loss.
Recently, show the keying action of IL-1 in osteoclasia in mouse model, (Endocrinology 139 (6): 3022) for Lorenzo, J.A. etc. (1998).When the mouse spay that will have intact IL-1 system exhausts the bone density that the animal loss is a large amount of to stimulate oestrogenic hormon between climacteric.During the mouse of blocking in being based upon the IL-1 system, oestrogenic hormon exhausts and causes not having the bone loss.At least in mouse, the bone loss after IL-1 exhausts for oestrogenic hormon is critical in this prompting.In other research, find IL-1 be periodontitis essential part (referring to Assuma, R. etc. (1998), J.Immunol.160:403).The investigator produces periodontitis in monkey.One group of monkey of chemical substance treatment with specific inhibition IL-1 and similar compound TNF α.No matter have serious germ attack, has the bone loss of the animal development much less of the IL-1 of blocking-up and TNF α.
It is known for many years that some produce higher levels of IL-1 than other people.If certain day the high producer checks it also will will be the high producer once more on date after a while, and the height production of IL-1 is tended to carry out in the family.Do not know to exist and when individuality is exposed to germ attack, cause the high special IL-1 genovariation of producing of IL-1.About 30% Caucasian has these genes.
In some researchs, and peripheral leukocytes (referring to Mark, L.L. etc. (2000), J.Periodontal Res.35 (3): 172; DiGiovine, F.S. etc. (1995), Cytokine 7:606; Pociot, F. etc. (1992), Eur.J.Clin.Invest.22:396; Galbraith, G.M. etc. (1997), J.Periodontol.68:832), in the laboratory with from the bacterial product incubation of Gram-negative bacteria, if white corpuscle, produces significantly more IL-1 from the people's (" orthogene type ") with the variation of IL-1 gene specific.Yet, perhaps most importantly, IL-1 higher level in the periodontal tissue of orthogene type.In research recently, in orthogene type experimenter's gingival crevice liquid IL-1 α and IL-1 β level be significantly higher than negative genotype experimenter those (referring to Engebretson, S.P. etc. (1999), J.Periodontol.70 (6): 567; Shirodaria, S. etc. (2000), J.Dent.Res.79 (11): 1864).In fact, in these researchs (J.Periodontol.70 (6): 567), (maximum difference between orthogene type and the negative genotype is found in＜4mm) site having minimum cavity depth for Engebretson, S.P. etc. (1999).
In addition, when surveying, bleed and to be considered to the clinical indicator of inflammatory response.Lang and colleague (referring to Lang, N.P. etc. (2000), J.Periodontal.Res.35 (2): 102) recall in the program (clinical recall program) assessment more than 320 experimenters that select at random clinical.In 139 non-smokers, orthogene type experimenter significantly more may have the increase in hemorrhage site during four maintenance access than negative genotype experimenter.
In a word, the experimenter with IL-1 orthogene type tends to have: a) the IL-1 level of the increase that produces by their white corpuscles, 2) IL-1 and 3 that increases in the gingival crevice liquid) when surveying, increase hemorrhage.
Some aspect that diagnostic tool is used to identify the disease that has existed.The example of diagnostic test not only comprises radiography but also comprises the biochemical biomarker of bone loss initiatively.For the value assessment of particular diagnosis be based on when its physical presence how good diagnostic detection pathology and when in fact not having disease test how good avoiding " positive " assessed.
Prognosis in medical science and the odontology is to be intended to predict the risk of disease each side in the future.Because about not having in the future the fact, prognosis to relate to the probability of incident generation in the future.All experimenters are familiar with the notion of forecast.The weather-forecast of 60% probability rain do not guarantee and will rain, but considers this forecast, and most of people will select different clothes the same day.Similarly, hypercholesterolemia does not guarantee that a people will have a heart attack in future, but it will suffer from acute coronary before given age probability increases more than one times.
The people of IL-1 orthogene type more may suffer from general serious periodontitis (referring to for example Gore, E.A. etc. (1998), J.Clin.Periodontol.25:781, Kornman, K.S. and diGiovine, F.S. (1998), Ann.Periodontol.3:327; Kornman, K.S. etc. (1997), J.Clin.Periodontol.24:72; McDevitt, M.J. etc. (2000), J.Periodontal 71:156).In research recently, (McDevitt, M.J. etc. (2000), J.Periodontal 71:156,90) check the experimenter's of no smoking history or minimum smoking history periodontopathy and IL-1 genotype.Multivariate regression model proof subject age, the seriousness significant correlation connection of periodontal bone loss among former smoking history and IL-1 phenotype and the adult.For non-smoker or light smoker (＜5pk-yr), compare with the negative genotypic experimenter of IL-1, it is big three times to the possibility of serious periodontopathy that IL-1 orthogene type suffers from moderate.
The research of periodontal being safeguarded population of subjects (referring to McGuire and Nunn, McGuire, M.K. etc. (1999), J.Periodontol.70 (1): 49), check after periodontal treatment the experimenter of tracked 5-14.They attempt to determine any factor, if any, and prediction experimenter's during periodontal is safeguarded tooth loss.They find only two kinds of prediction things (predictor): IL-1 genotype and severe smoking and the loss of tooth afterwards significant correlation.Compare with negative genotype, the possibility that IL-1 orthogene type has the tooth loss is big 2.7 times, and the heavy smoker is bigger 2.9 times than the possibility that orthogene type has the tooth loss.Be the orthogene type and be that heavy smoker's experimenter is bigger 7.7 times than the possibility that negative genotypic non-smoker has the tooth loss.Only find in the negative genotype experimenter of non-smoker's IL-1 that it is valuable that tradition is used to indicate the clinical parameter of prognosis.
In another research, the prediction thing of assessment treatment result.In addition, another research is (referring to DeSanctis, M. and Zuchelli, G. (2000), J.Periodontol.71:606) being presented at guide tissue regeneration (GTR) surgical operation significantly reduces in the experimenter of orthogene type (referring to DeSanctis with the permanent stability that regeneration destructive periodontal adheres to periodontal tissues, M. and Zuchelli, G. (2000), J.Periodontol.71:606).
Importantly emphasize chronic disease, as periodontitis, the complex biological that relates to is in time rented mutually.Relation between IL-1 genetic expression and the several single nucleotide polymorphism is that this complex biological is learned crucial especially aspect.Therefore, the functional polymorphisms that causes IL-1B or IL-1A (or other IL-1 locus gene) increase to be produced is effective in predicting inflammatory diseases relevant with the production of IL-1 β or IL-1 α increase with diagnosing periodontopathy and other and symptom.For example, the production of the increase of IL-1B has been presented at rheumatoid arthritis, Alzheimer, play an important role in the nosetiology of inflammatory bowel disease and graft antagonism host (graft-versus-host) disease (referring to for example Dinarello (2000) Chest 118:503-08 summary).In addition, reducing expression function associated polymorphism with IL-1 locus gene also can play a role in inflammatory diseases.For example, causing IL-1RN (IL-1 locus receptor antagonist) to express the functional polymorphisms that reduces also can cause the interleukin-level that improves and cause inflammatory diseases.Therefore, identify that the functional polymorphisms in the IL-1 locus that influences one or more IL-1 genetic transcriptions or expression will be useful.
2. summary of the invention
On the one hand, the invention provides novel method and test kit, it is used for determining that whether or be easy to develop and the interleukin-production diseases associated or the symptom that increase of IL-1 β particularly the experimenter.In one embodiment, this method comprises the nucleic acid of determining the experimenter and whether comprises the polymorphic allelotrope of IL-1B (3737).In preferred embodiments, IL-1B (3737) allelotrope that detects is to express with the IL-1B that increases and the relevant 1 type allelotrope with inflammatory diseases, yet because its confirms that 1 type is allelic on one or two karyomit(e) of test subject and does not exist that the allelic detection of 2 types is particularly useful.
In particularly preferred embodiments, the invention provides isolating nucleic acid, it comprises about 20 continuous nucleotides from the genome sequence of people IL-1B (3737) polymorphic locus.Preferred nucleic acid comprises corresponding to those of-3737 IL-1B allelotrope 1 sequence: TCTAGACCAGGGAGGAGAATGGAATGT CCCTTGGACTCTGCA-TGT; And corresponding to those of-3737 IL-1B allelotrope 2 sequences: TCTAGACCAGGGAGGAGAATGGAATGT TCCTTGGACTCTGCATGT.
In another embodiment, the invention provides isolating nucleic acid, it comprises about 20 continuous nucleotides from the genome sequence of people IL-1B (1469) polymorphic locus.Preferred nucleic acid comprises corresponding to those of-1469 IL-1B allelotrope 1 sequence: ACAGAGGCTCACTCCCTTG CATAATGCAGAGCGAGCACGATACC-TGG; And corresponding to those of-1469 IL-1B allelotrope 2 sequences: ACAGAGGCTCACTCCCTTG TATAATGCAGAGCGAGCACGATACCTGG.
In also having another embodiment, the invention provides isolating nucleic acid, it comprises about 20 continuous nucleotides from the genome sequence of people IL-1B (999) polymorphic locus.Preferred nucleic acid comprises corresponding to those of-999 IL-1B allelotrope 1 sequence: GATCGTGCCACTgcACTCCAGCCTGGGCGACAG GGTGAGACTCTGTCTC; And corresponding to those of-999 IL-1B allelotrope 2 sequences: GATCGTGCCACTgcACTCCAGCCTGGGCGACAG GGTGAGACTCTGTCTC.And corresponding to those of-999 IL-1B allelotrope 2 sequences: GATCGTGCCACTgcACTCCAGCCTGGGCGACAG CGTGAGACTCTGTCTC.
In other embodiments, nucleic acid of the present invention comprises and above-mentioned any one complementary sequence in those, and allele specific oligonucleotide oligonucleotide is as having corresponding to-3737 ,-1469 or-3 ' terminal those of the allele variant at 999IL-1B polymorphic locus place.Particularly preferred nucleic acid is the probe that comprises one of above-mentioned sequence and detectable mark.
In another particularly preferred embodiment, the invention provides the method for the possibility of the increase that develops inflammatory diseases or symptom among prediction or the diagnosis people experimenter.Of the present invention aspect this, inflammatory diseases is a kind of and interleukin-, the particularly relevant inflammatory diseases of expression of IL-1B increase, and this method requires to obtain nucleic acid samples and analyzes with the identity of definite-3737 IL-1B allelotrope as 1 type or 2 type promoter sequences from people experimenter.The existence of 1 type IL-1B promoter sequence is the diagnosis of the development inflammatory diseases possibility of increase.This aspect of the present invention is particularly useful for diagnosing inflammatory diseases or the symptom relevant with the interleukin-production, particularly IL-1B production of increase, described disease or symptom such as periodontopathy and Alzheimer.
Can also comprise that phrase " with IL-1 polymorphism diseases associated and symptom " is meant multiple disease or symptom by other inflammatory diseases and the symptom of the inventive method diagnosis or prediction, in the experimenter, can show susceptibility these diseases or symptom based on one or more allelic evaluations in the IL-1 complex body.Example comprises: inflammatory or degenerative disease comprise: systemic inflammatory responses (SIRS); Alzheimer (comprise with relevant illness and symptom: chronic neural inflammation, neuroglia activates; The microgliacyte that increases; Neuritic plaques forms; With replying) to treatment; Amyotrophic lateral sclerosis (Amylotropic Lateral Sclerosis) (ALS), sacroiliitis is (with relevant illness and symptom, comprise: acute arthritis, the sacroiliitis of antigen induction, the sacroiliitis relevant with chronic lymphocytic thyroiditis, collagen-induced sacroiliitis, property childhood chronic arthritis; Property childhood rheumatoid arthritis, osteoarthritis, prognosis (prognosis) and suis inductive sacroiliitis), asthma (with associated conditions and symptom, comprising: bronchial asthma; Chronic obstructive airway disease, chronic obstructive pulmonary disease, property childhood asthma and occupational asthma); Cardiovascular disorder (with associated conditions and symptom, comprises atherosclerosis; Autoimmune myocarditis, the chronic cardiac anoxic, congestive heart failure, coronary artery disease, myocardosis and core cell dysfunction comprise: aortic smooth muscle cell activates; The core cell apoptosis; Immunomodulatory with the core cell function; Diabetes and associated conditions and symptom comprise autoimmune diabetes, insulin-dependent (1 type) diabetes, diabetes, diabetic retinopathy, and diabetic nephropathy); Stomach inflammation (with associated conditions and symptom, comprising celiac disease (celiac disease), relevant osteopenia, chronic colitis, regional ileitis, inflammatory bowel and ulcerative colitis); Stomach ulcer; Hepatitis disease, cholesterol cholelith and hepatic fibrosis, HIV infects (with associated conditions and symptom, comprise that degeneration replys, neurodegeneration is replied, the Hodgkin's disease relevant with HIV), kawasaki syndrome (with associated conditions and symptom, comprises kawasaki disease, the uterine cervix lymphadenopathy, coronary artery injury, edema, heating, the white corpuscle that increases, anemia, decortication, fash, conjunctiva is rubescent, thrombocythemia; Multiple sclerosis, ephrosis (with relative disease and illness, comprises diabetic nephropathy, end-stage renal disease, glomerulonephritis, the thorough syndromes of Gourde(G) Paasche, hemodialysis survival and the damage of kidney ischemia reperfusion), neurodegenerative disease is (with relative disease and symptom, comprise acute neurodegenerative, IL-1's induces the plasticity-of IL-1 inductive hypothalamus neurons and chronic stress hyperreactive in aging and the neurodegenerative disease), illness in eye (Qphthalmopathies) is (with relative disease and illness, comprise diabetic retinopathy, graves' ophthalmopathy, and uveitis, osteoporosis is (with relative disease and illness, comprise that tooth is poor, femur, radius, vertebra or carpal bone loss or fracture take place, postclimacteric bone loss, material (mass), fracture take place or bone loss speed), otitis media (adult or paediatrics), pancreatitis or pancreas acinitis, periodontopathy (with relative disease and illness, comprising the adult, early onset and diabetic); Tuberculosis comprises chronic lung disease, chronic sinusitis, hyaline membrane disease, the tuberculosis among anoxic and the SIDS; Restenosis; Rheumatosis comprises rheumatoid arthritis, rheumatosis aschoff's nodules, rheumatosis and rheumatic myocarditis; Thyroiditis comprises chronic lymphocytic thyroiditis; Urinary tract infection comprises chronic prostatitis, chronic pelvic pain syndromes and urolithiasis.Immunological diseases comprise autoimmune disease, as alopecia areata, autoimmune myocarditis, Graves disease, graves' ophthalmopathy, the liver moss sclerosis, multiple sclerosis, psoriasis, systemic lupus erythematous, systemic sclerosis, thyropathy (for example thyrocele and matrix lymphoma (Hashimoto thyroiditis, lymphoglandula sample thyrocele), somnopathy and chronic fatigue syndrome and obesity (non-diabetic or relevant) with diabetes.To the resistance of transmissible disease, described transmissible disease such as leishmaniasis, leprosy, Lyme disease, lyme carditis, malaria, cerebral malaria, meningitis, the tubulose intestines ephritis relevant with malaria), it is by bacterium, virus (cytomegalovirus for example, encephalitis, Epstein-Barr virus, human immunodeficiency virus, influenza virus) or protozoon (for example plasmodium falciparum, trypanosome) cause.To replying of the wound that comprises cerebral trauma, (comprise apoplexy and local asphyxia, encephalitis, encephalopathic, epilepsy is enclosed living phase brain injury, continue febrile seizure, SIDS and subarachnoid hemorrhage), low birthweight (for example middle cerebral artery aneurysm), injury of lung (acute hemorrhagic injury of lung, the thorough syndromes of Gourde(G) Paasche, acute ischemic is poured into again), myocardial dysfunction, it is to cause the susceptibility of the oily syndromes silicon of poison disease (for example to) by occupation and environmental pollutant, the radiation wound, efficient (for example burning or scald chronic wounds, surgical incision and Spinal injury) with the wound healing reaction.To neoplastic susceptibility, comprise the molten metastatic tumor of bone that mammary cancer is relevant, emaciation, colorectal cancer, excess proliferative disease, Hodgkin's disease, leukemia, lymphoma, metabolic disease and tumour, metastatic tumor, myelomatosis (myeolomas) and various cancer (comprise breast, prostate gland, ovary, colon, lung etc.), apositia and emaciation.Hormone regulation comprises fertility/fecundity, the possibility of gestation, incidence of preterm birth, antenatal and introduction stage complication comprises the premature labor low birthweight, middle cerebral artery aneurysm, septicemia, low thyroxine disease (hypothyroxinernia), oxygen dependence, cranial deformities, menopause is in advance.The experimenter is to the reaction of graft (repel or accept), acute phase reaction (for example exothermic reaction), and common inflammation is sent out should, the acute respiratory distress reaction, acute systemic inflammatory responses, wound healing, adhesion, immune inflammation reaction, neuroendocrine reaction, heating development and opposing, acute phase reaction, stress reaction, disease susceptibility, repeating motion stress, tennis elbow and pain management and reaction.
Another aspect of the present invention provides determines that people experimenter whether can be with the effective method of treatment of medicine, this method by detecting people experimenter nucleic acid samples and mensuration-3737 IL-1B allelotrope as the identity of 1 type or 2 type promoter sequences.In the preferred embodiment of this respect of the present invention, the existence of 1 type IL-1B promoter sequence shows that people experimenter can effectively treat with medicine.
In another embodiment, IL-1B (3737) 2 type allelotrope are elements of IL-1 inflammatory haplotype, and the II-1 β that its existence explanation increases expresses (for example IL-1 (3344146)).In the preferred embodiment of this respect of the present invention, the invention provides by detecting the existence of the IL-1 haplotype relevant with-3737 IL-1B 1 type allelotrope, diagnosis or prediction development and the interleukin-that increases are produced the method for the possibility that relevant inflammatory diseases or symptom increase, and the existence of wherein relevant with-3737 IL-1B 1 type allelotrope IL-1 haplotype is the diagnosis of the possibility of the development inflammatory diseases of increase or symptom.
Can detect the allelotrope that comprises IL-1 inflammatory haplotype by any in the multiple available technology, described technology comprises: 1) nucleic acid samples and can and the probe of allelotrope hybridization between carry out hybridization; 2) with allelic at least a portion order-checking; Or 3) electrophoretic mobility of mensuration allelotrope or its fragment (for example fragment that produces by the endonuclease enzymic digestion).Before detecting step, allelotrope randomly can be carried out amplification step.Preferred amplification method is selected from: polymerase chain reaction (PCR), ligase chain reaction (LCR) (LCR), strand displacement amplification (SDA), the group that clone and above-mentioned modification (for example RT-PCR and allele specific amplification) are formed.The required oligonucleotide that increases can be selected from for example IL-1 locus inside, itself and label side neighbour (required as pcr amplification) who is concerned about or direct overlapping mark (as in ASO hybridization).In particularly preferred embodiments, sample and one group of primer hybridization, the performing PCR of going forward side by side amplification, described primer is hybridized at 5 ' and the 3 ' allelotrope relevant with vascular disease that adopted sequence or antisense sequences are arranged.
The allelotrope that can also indirect detection comprises IL-1 inflammatory haplotype is for example by analyzing the protein by dna encoding.For example, when the mark of being considered causes the translation of mutein, can detect protein by any in the multiple proteins detection method.These methods comprise immunodetection and biochemical test, and as size fractionation, wherein protein prolongs by brachymemma, and the posttranslational modification folding or that change of change has the variation of apparent molecular weight.
On the other hand, the present invention is characterized as the test kit that is used to carry out said determination.This test kit can comprise the nucleic acid samples collection device and measure the experimenter and whether carry the allelic device that at least one comprises IL-1 inflammatory haplotype.Test kit can also comprise positive or negative control sample or standard specimen and/or be used for the calculation device of assessment result and other reagent and component, comprise: DNA cloning reagent, archaeal dna polymerase, nucleic acid amplification reagent, restriction enzyme, damping fluid, the nucleic acid sampling unit, the DNA purification devices, deoxynucleotide, oligonucleotide (for example probe and primer) etc.
As mentioned above, contrast can be the positive or negative contrast.In addition, control sample can comprise the positive (or negative) product of used allelotrope detection technique.For example, when the allelotrope detection technique was pcr amplification, behind size fractionation, control sample can comprise the dna fragmentation of suitable size.Equally, when the allelotrope detection technique related to the detection mutein, control sample can comprise the protein example of sudden change.Yet preferred control sample comprises material to be detected.For example, contrast can be genome DNA sample or clone's a part IL-1 gene cluster.Yet preferred control sample is highly purified genome DNA sample, and sample wherein to be detected is a genomic dna.
The zone that exists oligonucleotide in the described test kit can be used to increase to be concerned about or be used for allele specific oligonucleotide (ASO) and the mark hybridization of being considered.Therefore, the mark (requiring) can the side neighbour be concerned about of oligonucleotide or directly overlapping mark (as in the ASO amplification) as pcr amplification.
Use to measure and whether the information of test kit described here (separately or in conjunction with helping about another and the hereditary defect of IL-1 inflammatory haplotype diseases associated or symptom or the information of environmental factor) acquisition suffers from for definite asymptomatic experimenter that maybe may to develop specified disease or illness be useful.In addition, this information method that can allow more to customize (customized) is come the outbreak or the progress of preventing disease or symptom.For example, this information can make to face and examine the therapy that the doctor more effectively stipulates to will be referred to the molecular basis of disease or illness.
Also having on the other hand, the present invention is characterized as by using suitable therapeutical agent of the present invention to the experimenter, the method that develops with IL-1 inflammatory haplotype diseases associated or illness among treatment or the prevention experimenter.Also having on the other hand, the invention provides external or the interior mensuration of body, it is used for the therapeutical agent of filler test compound with the development of evaluation treatment or prevention and IL-1 inflammatory haplotype diseases associated or illness.In one embodiment, measure the cell comprise the pathogenic mutation that transfection and suitable promotor can be operatively connected and contact with test compounds, and be determined at the test compounds existence and do not exist under protein expression level in the cell.In preferred embodiments, pathogenic mutation causes the reduction of IL-1 receptor antagonist deposits yields, and the generation explanation compound that the IL-1 receptor antagonist increases in the presence of test compounds is the active agonist of IL-1 receptor antagonist.In another preferred embodiment, the generation that pathogenic mutagenesis causes IL-1 α or IL-1 β to increase, the generation of IL-1 α or IL-1 β reduction explanation compound is the antagonist of IL-1 α or IL-1 'beta ' activity in the presence of test compounds.In another embodiment, the present invention is characterized as genetically modified non-human animal and is identifying IL-1 α or the antagonist of IL-1 'beta ' activity or the application in the active agonist of IL-1Ra with them.
In another embodiment, the invention provides prediction and develop the method for expressing the possibility of relevant inflammatory diseases or illness with the IL-1B that changes in people experimenter, it is by detecting any following polymorphism of IL-1B in from people experimenter's nucleic acid samples: IL-1B4 allelotrope 1 (TG CATAGGGTC), IL-1B3 allelotrope 1 (T GCATAGGGTC), IL-1B7 allelotrope-1 (TGCAT AGGGTC), IL-1B15 allelotrope 1 (TGCATAGGGT C), IL-1B4 allelotrope 2 (TG TATAGGGTC), IL-1B3 allelotrope 2 (T ACATAGGGTC), IL-1B7 allelotrope-2 (TGCAT GGGGTC) and IL-1B15 allelotrope 2 (TGCATAGGGT T).Be used for detecting genotypic nucleic acid of IL-1 inflammatory such as isolating Nucleotide and be also included within the present invention, described isolating Nucleotide comprises IL-1B SNP such as IL-1B4 allelotrope 1 (TG CATAGGGTC), IL-1B3 allelotrope 1 (T GCATAGGGTC), IL-1B7 allelotrope-1 (TGCAT AGGGTC), IL-1B15 allelotrope 1 (TGCATAGGGT C), IL-1B4 allelotrope 2 (TG TATAGGGTC), IL-1B3 allelotrope 2 (T ACATAGGGTC), IL-1B7 allelotrope-2 (TGCAT GOr IL-1B15 allelotrope 2 (TGCATAGGGT GGGTC), T).
Aspect particularly preferred, the invention provides the method for the IL-1 genetic expression function associated polymorphism that is used to detect and changes, it is tested and appraised IL-1 SNP, and assessment SNP influences IL-1 genetic expression or IL-1 gene transcription factor bonded on function.By this method, when the IL-1 gene transcription factor of the IL-1 genetic expression of SNP and change or change when relevant, SNP is and the IL-1 genetic expression function associated polymorphism that changes so, and therefore relevant with the possibility of development inflammatory diseases that changes or symptom.
Other embodiment of the present invention and advantage are illustrated in following detailed specification sheets and claim.
3. accompanying drawing summary
Fig. 1 shows the sequence of IL-1B gene, and it comprises the upstream promoter zone, and-3737 allelotrope 1 are black matrixes, and corresponding detection oligonucleotide underlines (referring to GenBank registration number X04500 and AC04500);-1469 and-999 polymorphisms detect oligonucleotide and polymorphic site separately and also underline and add black.
Fig. 2 shows the variation of the IL-1B transcription rate relevant with the IL-1B genotype.
Fig. 3 shows the diagram of IL-1B proximal promoter and far-end enhanser genome area.
Fig. 4 demonstration-31 and-511 polymorphism states do not have influence to the transcriptional activity of IL1B promotor.
Fig. 5 shows the strategy in clone IL-1B upstream promoter zone.
Fig. 6 shows the transcriptional differences between-5111 types and the 2 type promotors.
Fig. 7 show dose/response relation-1 type is cloned than 2 types.
Fig. 8 shows 1 type and 2 type IL-1B clone's dosage and time response.
Fig. 9 shows combining of NF-kB p50 homodimer and DNA substrate.
Figure 10 shows the transfection analysis in-3737 (note of finding the result by SNP is also referred to as IL-1B4) SNP to RAW cell (mouse macrophage).
Figure 11 is presented at the IL-1B construct sequence that detects in the functional polymorphisms transfection analysis.
Figure 12 shows the result from the functional analysis of function SNP other in the THP-1 cell.
4. detailed Description Of The Invention
4.1 General introduction
The present invention relates to the discovery of polymorphism in the IL-1B gene, it is relevant with the IL-1 β throughput rate that changes. The determining of this Genetic polymorphism type provides the useful heredity check that IL-1 production is wherein helped pathogenetic disease susceptibility, described disease is periodontosis and other inflammatory disease for example, particularly those such as Alzheimer's (referring to McGeer and McGeer (2001) Arch Neurol 58:1790-2; With (2001) Mech Ageing Dev 122:1985-95 such as De Luigi).
4.2 Definition
For convenience's sake, be provided at below this specification, some term that uses in embodiment and the appended claim and the implication of phrase.
Term " allele " refers to the different sequence variants at the polymorphic area discover of difference. For example IL-1RN (VNTR) has at least 5 different allele. Sequence variants can be that single or multiple bases change, and unrestrictedly comprises insertion, disappearance, or substitute, maybe can be that the sequence of variable number repeats.
Term " allelotype " refers to that an allele or a plurality of allele are in the homogeneity in one or more polymorphic zones. For example, allelotype can be made up of the single allele at a polymorphic site, about IL-1RN (VNTR) allele 1, it is the allelotype that has the IL-1RN allele 1 of at least one copy at the VNTR place of IL-1RN gene locus. Alternatively, allelotype can by single polymorphic site isozygoty or heterozygous state forms. For example, IL1-RN (VNTR) allele 2,2nd, wherein there is second allele corresponding to the VNTR mark of the IL-1RN of the IL-RN that isozygotys (VNTR) allele 2 states of two copies in allelotype. Alternatively, allelotype can be by forming in the allelic homogeneity more than a polymorphic site.
Term used herein " antibody " is intended to refer to bond, and it comprises whole antibody or its binding fragment with the reaction of IL-1 polypeptid specificity. Use the routine techniques can be with antibody fragment, with the effect of above-mentioned same way as screening fragment about whole antibody. For example, by can produce F (ab) 2 fragments with pepsin antibody. Can process the F (ab) that obtains thus 2 fragments produce the Fab fragment with Reduction of Disulfide. Antibody of the present invention is intended to comprise bispecific in addition, strand and chimeric and humanization molecule, and it has the affinity to the IL-1B polypeptide of being given by at least one CDR zone of antibody.
" BA " or " biologically active " or " activity " or " biological function " refer to by IL-1 polypeptide (no matter being the natural of it or sex change conformation) or by direct or indirect effector molecules or the antigen function of implementing of its any subsequence for this paper purpose can exchange use. BA comprises and the target peptide, for example the IL-1 receptors bind. Can regulate the IL-1 biologically active by the direct IL-1 of impact polypeptide. Alternatively, by regulating the level of IL-1 polypeptide, as by regulating the expression of IL-1 gene, can regulate the IL-1 biologically active.
As used herein, term " bioactive fragment of IL-1 polypeptide " refers to the fragment of total length IL-1 polypeptide, wherein the activity of this fragments specific simulation or antagonism wild type IL-1 polypeptide. Bioactive fragment preferably can with the interactional fragment of interleukin-1 receptor.
Term " abnormal activity ", as be applied to the activity of polypeptide such as IL-1, the activity that refers to be different from the active of wild type or natural polypeptides or be different from the activity of polypeptide among the health volunteer. Because it is better than the activity of its natural homologue, so polypeptide active can be unusual. Alternatively, because it is weak or lack with respect to the activity of its natural homologue, activity can be unusual. Abnormal activity can also be active variation. For example unusual polypeptide can from different target peptide interactions. Because crossing of the IL-1 locus gene of coding IL-1 locus polypeptide expressed or expression not enough (underexpression), cell can have unusual IL-1 activity.
" cell ", " host cell " or " recombinant host cell " is the term that can exchange use in this article, not only refers to specific experimenter's cell, and refers to the offspring of this cell or potential offspring. Because because sudden change or ambient influnence cause some change to take place in the offspring, this offspring in fact can be not identical with mother cell, but still be included in the scope of term used herein.
" allogeneic chimera ", " isologous chimera ", " chimeric mammal " etc. refers to transgene mammal, it is at least some it contain to have in the genomic cell and reject or knock in (knock-in) construct.
Term " contrast " or " control sample " refer to for the suitable any sample of used detection technique. Control sample can comprise the product of used allele detection technique or material to be detected. In addition, contrast can be the positive or negative contrast. By the mode of embodiment, wherein the allele detection technique is pcr amplification, follows size fractionation, and control sample can comprise the dna fragmentation of suitable size. Equally, when the allele detection technique related to the detection mutein, control sample can comprise the sample of mutein. Yet preferred control sample comprises material to be detected. For example, contrast can be the cloned segment of genome DNA sample or IL-1 gene cluster. Yet when sample to be detected was genomic DNA, preferred control sample was highly purified genome DNA sample.
Phrase " disease and the symptom relevant with the IL-1 polymorphism " refers to various diseases or symptom, may be displayed among the experimenter sensitiveness to it based on the one or more allelic evaluation in the IL-1 complex. Example comprises: inflammatory or DD comprise: systemic inflammatory responses (SIRS); Alzheimer's (comprise with relevant illness and symptom: chronic neural inflammation, neuroglia activates; The microglia cell that increases; Neuritic plaques forms; With replying treatment); ALS (ALS), (illness and symptom with relevant comprise: acute arthritis arthritis, the arthritis of antigen induction, the arthritis relevant with chronic lymphocytic thyroiditis, collagen-induced arthritis, property childhood chornic arthritis; Property childhood rheumatoid arthritis, osteoarthritis, the arthritis that prognosis and streptococcus are induced), asthma (with associated conditions and symptom, comprising: bronchial astehma; Chronic obstructive airway disease, COPD, property childhood asthma and occupational asthma); Angiocardiopathy (with associated conditions and symptom, comprises atherosclerotic; Autoimmune myocarditis, the chronic cardiac anoxic, congestive heart failure, coronary artery disease, cardiomyopathy and core cell dysfunction comprise: aortic smooth muscle cell activates; The core cell programmed cell death; Immunological regulation with the core cell function; Diabetes and associated conditions and symptom comprise autoimmune diabetes, insulin-dependent (1 type) diabetes, diabetes periodontitis, diabetic retinopathy, and diabetic nephropathy); Stomach inflammation (with associated conditions and symptom, comprising chylous diarrhea, relevant osteopenia, chronic colitis, regional enteritis, inflammatory bowel disease and ulcerative colitis); Gastric ulcer; Hepatitis disease, cholesterol cholelith and liver fibrosis, HIV infects (with associated conditions and symptom, comprise that degeneration replys, neurodegeneration is replied, the Hodgkin's disease relevant with HIV), kawasaki syndrome (with associated conditions and symptom, comprises kawasaki disease, the cervix lymphadenopathy, coronary artery injury, edema, heating, the leucocyte that increases, anemia, decortication, fash, conjunctiva is rubescent, thrombocythemia; Multiple sclerosis, ephrosis (with relevant disease and illness, comprises diabetic nephropathy, end-stage renal disease, glomerulonephritis, the thorough syndrome of Gourde(G) Paasche, haemodialysis survival and the damage of kidney ischemia reperfusion), neurodegenerative disease is (with relevant disease and symptom, comprise acute neurodegenerative, IL-1's induces the plasticity of the hypothalamus neurons that IL-1 induces and chronic stress hyperreactive in aging and the neurodegenerative disease), illness in eye is (with relevant disease and illness, comprise diabetic retinopathy, graves' ophthalmopathy, and uveitis, osteoporosis is (with relevant disease and illness, comprise the tooth grain, femur, radius, vertebra or carpal bone loss or fracture take place, postclimacteric bone loss, material, fracture take place or bone loss speed), tympanitis (adult or paediatrics), pancreatitis or pancreas acinitis, periodontosis (with relevant disease and illness, comprising the adult, early onset and diabetic keratopathy); Tuberculosis comprises chronic lung disease, chronic sinusitis, hyaline membrane disease, the tuberculosis among anoxic and the SIDS; ISR; Rheumatism comprises rheumatoid arthritis, rheumatism Aschoff body, rheumatism and rheumatic myocarditis; Thyroiditis comprises chronic lymphocytic thyroiditis; Urinary tract infection comprises chronic prostatitis, chronic pelvic pain syndrome and uriasis. Immunological diseases comprise autoimmunity disease, such as alopecia areata, autoimmune myocarditis, Graves disease, graves' ophthalmopathy, the liver moss sclerosis, multiple sclerosis, psoriasis, systemic loupus erythematosus, systemic sclerosis, thyropathy (for example goitre and matrix lymthoma (Hashimoto thyroiditis, lymph node sample goitre), sleep-disorder and chronic fatigue syndrome and obesity (non-diabetic or relevant with diabetes). To the resistance of infectious disease, described infectious disease such as leishmaniasis, leprosy, Lyme disease, lyme carditis, malaria, brain type malaria, meningitis, the tubulose intestines ephritis relevant with malaria), it is by bacterium, virus (cytomegalovirus for example, encephalitis, Epstein-Barr virus, human immunodeficiency virus, influenza virus) or protozoan (for example plasmodium falciparum, trypanosome) cause. To replying of the wound that comprises brain trauma, (comprise apoplexy and ischaemic, encephalitis, encephalopathic, epilepsy is enclosed living phase brain damage, continue febrile seizure, SIDS and subarachnoid hemorrhage), LBW (for example cerebral paralysis), injury of lungs (acute hemorrhagic injury of lungs, the thorough syndrome of Gourde(G) Paasche, acute ischemic is poured into again), myocardial dysfunction, it is to cause the sensitiveness of the oily syndrome silicon of poison disease (for example to) by occupation and environmental contaminants, the radiation wound, efficient (for example burning or scald chronic wounds, surgical incision and spinal cord injury) with the wound healing reaction. To neoplastic sensitiveness, comprise the molten metastatic tumor of bone that breast cancer is relevant, cachexia, colorectal cancer, excess proliferative disease, Hodgkin's disease, leukaemia, lymthoma, metabolic disease and tumour, metastatic tumor, myeloma and various cancer (comprise breast, prostate, ovary, colon, lung etc.), apositia and cachexia. Hormone is regulated, and comprises fertility/fecundity, the possibility of gestation, and incidence of preterm birth, antenatal and introduction stage complication comprises Preterm low birth weight, cerebral paralysis, septicaemia, low thyroxine disease, oxygen dependence, cranial deformities, menopause is in advance. The experimenter is to the reaction of graft (repel or accept), acute phase response (for example exothermic reaction), and common inflammation is sent out should, the acute respiratory distress reaction, acute systemic inflammatory responses, wound healing, adhesion, immune inflammation reaction, neuroendocrine response, heating development and opposing, acute phase response, stress reaction, disease susceptibility, repeating motion stress, tennis elbow and pain management and reaction.
Term " gene disruption " refers to site-specific destruction natural DNA sequence in order to compare the expression that prevents this gene in cell with this gene of wild type copy with " directed destruction " or any similar phrase. Interruption can be by the disappearance to gene, and insertion or modification or its any combination cause.
Term used herein " haplotype " is intended to refer to one group of allele, and it is (p on the statistics significance levelcorr＜0.05) as one group (linkage disequilibrium) together heredity. As used herein, phrase " IL-1 haplotype " refers to the haplotype in the IL-1 locus. IL-1 inflammatory or short scorching haplotype refer to represent the haplotype of the antagonist activity of the activator that increases and/or reduction.
" homology " or " homogeneity " or " similitude " refer between two polypeptide or the sequence similarity between two nucleic acid molecules. Can determine separately homology and homogeneity by the position of comparing in each sequence, in order relatively sequence to be contrasted. When the suitable position of comparative sequences was occupied by identical base or amino acid, molecule was identical in this position so; When suitable position by same or similar amino acid residue (for example space and/or electronic property are similar) when occupying, molecule can be called this position homology (similar) so. Refer to function by the identical or similar amino acid whose quantity of the total position of comparative sequences as the expression of the percentage of homology/similitude or homogeneity. " have nothing to do " or the sequence of " non-homogeneous " and sequence of the present invention are shared less than 40% homogeneity, although preferably less than 25% homogeneity.
The sequence similarity that term " homology " is described based on algorithm compares, and it is for the identification of the gene with identity function or motif or protein. Nucleic acid of the present invention and protein sequence can be used as " search sequence " and carry out the search to public database, for example to identify other family member, correlated series or homologue. This search can be used Altschul, waits the NBLAST of (1990) J Mol.Biol.215:403-10 and XBLAST program (2.0 editions) to carry out. The BLAST nucleotide search can be used the NBLAST program, mark=100, and carry out word length=12, with the nucleotide sequence of acquisition with nucleic acid molecules homology of the present invention. The BLAST protein search can be used the XBLAST program, mark=50, and carry out word length=3, with the amino acid sequence of acquisition with protein molecule homology of the present invention. In order to obtain for the relatively jagged contrast of purpose, such as Altschul etc., (1997) Nucleic AcidsRes.25 (17): 3389-3402 is described can to use breach BLAST. When using BLAST and breach blast program, can use the default parameter of each program (for example XBLAST and BLAST). Referring to http://www.ncbi.nlm.nih.gov.
Term used herein " IL-1 gene cluster " and " IL-1 locus " comprise and are positioned at or near all nucleic acid in the 2ql3 zone of chromosome 2, comprise at least IL-1A, IL-1B and IL-1RN gene and other any chain sequence. (Nicklin etc., Genomics 19:382-84,1994). Term used herein " IL-1A ", " IL-1B " and " IL-1RN " refers to respectively the IL-1 that encodes, the gene of IL-1 and IL-1 receptor antagonist.
" IL-1 function mutation " or " pathogenic mutation " are meant the sudden change (promptly influencing IL-1 gene or proteinic function) that causes the phenotype that changes in the IL-1 gene cluster.Example comprises: IL-1A (+4845) allelotrope 2, IL-1B (+3954) allelotrope 2, IL-1B (+6912) allelotrope 2 and IL-1RN (+2018) allelotrope 2.
" IL-1X (Z) allelotrope Y " is meant specific allelotype, be called Y, it appears at the IL-1 locus polymorphic site of gene X, wherein X is IL-1A, B or RN and be positioned at or near Nucleotide Z, wherein Nucleotide Z is that it is Nucleotide+1 of specific IL-1 gene X with respect to main transcription initiation site numbering.Used in addition as this paper, term " IL-1X allelotrope (Z) " is meant and is arranged in or near all allelotrope of the gene X IL-1 polymorphic site of Nucleotide Z.For example, term " IL-1RN (+2018) allelotrope " is meant the alternative type at mark+2018 IL-1RN of place genes." IL-1RN (+2018) allelotrope 1 " is meant the IL-1RN genotype, and its position at sense strand+2018 comprise halfcystine (C).Clay etc., Hum.Genet.97:723-26,1996." IL-1RN (+2018) allelotrope 2 " is meant the IL-1RN gene, and thymus pyrimidine (T) is contained in its position in normal chain+2018.When the experimenter had two identical IL-1RN allelotrope, the experimenter is called as isozygotied, or has homozygotic state.When the experimenter had two different I L-1RN allelotrope, the experimenter was called as heterozygosis, or has heterozygous state.Term " IL-1RN (+2018) allelotrope 2,2 " is meant the IL-1RN that isozygotys (+2018) allelotrope 2 states.On the contrary, term " IL-1 RN (+2018) allelotrope 1,1 " is meant IL-1 RN (+2018) allelotrope 1 state that isozygotys.Term " IL-1 RN (+2018) allelotrope 1,2 " is meant heterozygosis allelotrope 1 and 2 states.
" IL-1 is relevant " used herein is intended to be included in human chromosome 2 (2q 12-14) and goes up all and the relevant gene of people IL-1 locus gene.These comprise the IL-1 gene of the people IL-1 gene cluster that is positioned at karyomit(e) 2 (2q 13-14), comprise: the IL-1A gene of coding interleukin 1 α, IL-1RN (or IL-1ra) gene of the IL-1B gene of coding interleukin-1 ' beta ' and coding interleukin 1 receptor antagonist.These IL-1 genes involveds comprise the I type that is positioned at human chromosome 2 (2ql2) and II type people IL-1 acceptor gene and are positioned at their the mouse homologue of mouse chromosome 1 position 19.5cM in addition.Interleukin 1 α, interleukin-1 ' beta ', it is so relevant with interleukin 1 RN that consequently they all combine with IL-1 I receptor, yet only interleukin 1 α and interleukin-1 ' beta ' are the agonist ligands that activates IL-1 I receptor, and interleukin 1 RN is naturally occurring antagonist part.When being used for term " IL-1 " with reference to gene product or polypeptide, be intended to be meant by coded all gene products of the interleukin-1 locus on the human chromosome 2 (2q 12-14) with from homologue or its functional variant of their correspondences of other species.Therefore term IL-1 comprises the excretory polypeptide that promotes inflammatory response, as IL-1 α and IL-1 β, and the excretory polypeptide of antagonism inflammatory response, as IL-1 receptor antagonist and IL-1 II type (luring) acceptor.
" IL-1 acceptor " or " IL-1R " are meant the protein acceptor in conjunction with various cytolemma, its can in conjunction with and/or transduction from the signal of the part of IL-1 locus coding.Term is applicable to any protein that can bind interleukin-1 (IL-1) molecule, described protein be their native configurations as the Mammals plasmalemma protein, may work in to cell at the signal transduction that IL-1 is provided.As used herein, term comprises the analogue with IL-1 combination or the active natural protein of signal transduction.Example is included in United States Patent (USP) 4,968, people and the mouse IL-1 acceptor described in 607.Term " IL-1 nucleic acid " is meant the proteinic nucleic acid of coding IL-1.
" IL-1 polypeptide " and " IL-1 protein " is intended to comprise the polypeptide that comprises the IL-1 genomic dna sequence amino acid sequence coded that shows among the figure that is comprised by this paper, or its fragment and its homologue, and comprises agonist and antagonist polypeptide.
" risk of increase " be meant with do not carry specific polymorphic allelic group member in disease or illness occurrence frequency compare higher disease or illness occurrence frequency on the statistics in carrying specific polymorphic allelic individuality.
Term used herein " interaction " is intended to comprise intermolecular detectable relation or association (for example biochemical the interaction), as protein-protein in essence, protein-nucleic acid, the interaction between nucleic acid-nucleic acid and protein-small molecules or the nucleic acid-small molecules.
This paper is meant other DNA from existing respectively about nucleic acid such as DNA or the used term " isolating " of RNA the macromole natural origin, or the isolating molecule of RNA.For example, the isolating nucleic acid of one of coding experimenter IL-1 polypeptide preferably includes the nucleotide sequence of IL-1 gene in the natural next-door neighbour's genomic dna that is no more than 10 kilobase (kb), more preferably no more than this naturally occurring flanking sequence of 5kb, most preferably less than this naturally occurring flanking sequence of 1.5kb.Term used herein separates and also refers to be substantially free of cellular material, viral material, substratum when producing by recombinant DNA technology maybe, or the nucleic acid of the precursor when chemosynthesis or other chemical substance or peptide.In addition, " isolating nucleic acid " to be intended to comprise natural be not to exist and at the undiscovered nucleic acid fragment of state of nature as fragment.Term " isolating " also is used in reference in this article from other cell protein isolated polypeptide, and is intended to comprise the polypeptide of purifying and reorganization.
The transgenic animal of " knocking in (knock-in) " are meant and modifying factor are imported its genomic animal, and modifying factor can be an external source or endogenic.
" rejecting " transgenic animal are meant that the animal that partially or completely suppresses that wherein exists endogenous genetic expression is (for example based on lacking the part of gene at least, replace the part of gene at least with second kind of sequence, introduce terminator codon, the sudden change of the base of coding key amino acid, or the removal of intron contact etc.).
" rejecting construct " is meant and can be used for reducing or suppresses the nucleotide sequence of cell by the protein expression of endogenous dna sequence encoding.In simple embodiment, reject construct by gene, as IL-1RN genomic constitution, the key component of gene has disappearance, so that activated protein can not therefrom be expressed.Alternatively, many terminator codons can be added to natural gene and maybe can make intron contact inactivation to cause proteinic premature termination.Reject in the construct typical, replacing some part so the gene of gene can followingly represent with selectable mark (as the neo gene): IL-1RN 5 '/neo/IL-1RN3 ', wherein IL-1RN 5 ' and IL-1RN 3 ' are meant genome or cDNA sequence, it is respectively at the upstream and downstream with respect to part IL-1 RN gene, and wherein neo is meant neomycin resistance gene.Reject in the construct at another, second kind of selectable mark adding flank position so gene can be expressed as: IL-1RN/neo/IL-1RN/TK, wherein TK is a thymidine kinase gene, and it can add to IL-1RN5 ' or the IL-1RN3 ' sequence and the selection in appropriate culture medium relatively (but being the feminine gender selective marker therefore) in addition of aforementioned construct.This double-tagging construct allows to select to remove the homologous recombination incident of flank TK mark from the non-homogeneous recombination event that typically keeps the TK sequence.Genetically deficient and/or replacement can be from exons, intron, and particularly intron contact, and/or regulation domain such as promotor are carried out.
" linkage disequilibrium " is meant the common heredity of two allelotrope with the desired frequency of the separately frequency that takes place greater than each allelotrope from given control population.The expected frequency that two allelotrope of independent inheritance take place is that first allelic frequency multiply by second allelic frequency.The allelotrope that takes place altogether with expected frequency is called " linkage disequilibrium ".The reason of linkage disequilibrium often is unclear.It can be because to the nearest mixing of the selection of specific allelotrope combination or hereditary xenogenesis colony.In addition, in mark and the very closely linked situation of disease gene, if the disease sudden change is taking place in the past recently so that also do not reaching balance through time enough with the recombination event by specific chromosomal region, expectation allelotrope (or one group of chain allelotrope) is related with disease gene.When mentioning by the allelotype formed more than an allelotrope, if all comprise the allelotrope of first allelotype and at least one allele linkage imbalance of second allelotype, then first allelotype and second allelotype linkage disequilibrium.The example of linkage disequilibrium is to take place between the allelotrope of IL-1RN (+2018) and IL-1RN (VNTR) polymorphic site.Two allelotrope of IL-1RN (+2018) and two allelotrope the most frequent of IL-1RN (VNTR), allelotrope 1 and allelotrope 2 are 100% linkage disequilibriums.
Term " mark " is meant the known genome sequence that changes between individuality.For example, the IL-1RN gene has the mark of being made up of the series connection repetition (VNTR) of variable number.
" mutator gene " or " sudden change " or " function mutation " are meant the allelotype of gene, and with respect to the experimenter who does not have mutator gene, it can change the phenotype of the experimenter with mutator gene.Can proofread and correct or compensate the phenotype of the change that causes by sudden change by some reagent.If for this sudden change experimenter must be isozygoty to have the phenotype of change, then sudden change is called recessive.If the mutator gene of a copy is enough to change experimenter's phenotype, then sudden change is called dominance.If the experimenter have the mutator gene of a copy and have isozygoty and the heterozygosis experimenter between phenotype (for this gene), the sudden change be called codominant.
" non-human animal " of the present invention comprises Mammals such as rodents, non-human primates, and sheep, dog, ox, goat, etc., batrachians, as the xenopus member, and transgenic bird (for example chicken, bird etc.).Term " chimaeric animals " is used to refer in this article and wherein finds recombination, perhaps wherein recombination animal some but be not the animal of expressing in whole cells.One of term " tissue specificity chimaeric animals " expression reorganization IL-1 gene is at some tissues but do not exist in other tissue and/or express or destruction.Term " non-human mammal " is meant any member of class of mammals except the mankind.
As used herein, term " nucleic acid " is meant polynucleotide or oligonucleotide such as thymus nucleic acid (DNA), and when in place, Yeast Nucleic Acid (RNA).Term should also be understood to include, as Equivalent, and RNA that makes by nucleotide analog or the analogue (for example peptide nucleic acid(PNA)) of DNA and as be applicable to the embodiment of description, single (justice or antisense are arranged) and double-stranded polynucleotide.
Term " polymorphism " is meant the coexistence more than a kind of form of gene or its part (for example allele variant).Exist at least two kinds multi-form, promptly the part of the gene of two kinds of different IPs nucleotide sequences is called as " the polymorphic zone of gene ".The special gene sequence in gene polymorphic zone is an allelotrope.Polymorphic zone can be a mononucleotide, and its identity is different in isoallele not.Polymorphic zone also can be that several Nucleotide are long.
Term " to the tendency of disease ", with to " tendency " or " susceptibility " of disease or any similar phrase implication be some allelotrope therefore be found relevant for or the indication experimenter develop the incidence of specified disease (for example vascular disease).Compare therefore often overexpression in diseased individuals of allelotrope with healthy individual.Therefore, these allelotrope can be used for even predict disease before symptom or in the individuality before ill.
" small molecules " used herein implication is meant composition, and it has less than about 5kD with most preferably less than the molecular weight of about 4kD.Small molecules can be a nucleic acid, peptide, peptide mimics, carbohydrate, lipid or other organic or inorganic molecule.
Used as one's own department or unit, term " specific hybrid " or " specific detection " are meant the ability at least about 6 continuous nucleotide hybridization of nucleic acid molecule and sample nucleic acid.
" transcriptional regulatory sequences " is to run through the common name that this specification sheets uses, and is meant dna sequence dna, as start signal, and enhanser, and promotor, it induces or controls transcribing of protein coding sequence that they can be operatively connected.
As used herein, term " transgenosis " is meant the nucleotide sequence of transfered cell (for example a kind of IL-1 polypeptide of encoding, or to its antisense transcript).Transgenosis can be for the transgenic animal that import it or cell allos partially or completely, it is external source, or for the transgenic animal that import it or the native gene homology of cell, but its mode to change the cellular genome of inserting it that is designed is inserted, or is inserted in the animal gene group (for example it is inserted in the site that is different from natural gene or its insertion causes rejecting).Transgenosis can also be present in the cell with episomal form.Transgenosis can comprise one or more transcriptional regulatory sequences and other any nucleic acid, and as intron, it may be required for the optimum expression of selected nucleic acid.
" transgenic animal " are meant any animal, preferred non-human mammal, and bird or Amphibians, wherein one or more zooblasts comprise the mode of intervening by the people heterologous nucleic acids introduced of transgenic technology as known in the art.Through the plan genetic manipulation, as by with the recombinant virus microinjection or by the injection, by the transfered cell precursor with the direct or indirect transfered cell of nucleic acid.The term genetic manipulation does not comprise conventional cross-breeding, or in vitro fertilization, and relates to the introducing of recombinant DNA molecules.This molecule can be incorporated in the genome, maybe can be the DNA of extrachromosomal replication.In typical transgenic animal as herein described, transgenosis causes the recombinant forms of one of cell expressing IL-1 polypeptide, for example agonist or antagonist form.Yet, consider that also wherein recombination is reticent transgenic animal, FLP for example described below or CRE recombinase dependency construct.In addition, " transgenic animal " comprise that also the gene disruption of wherein one or more genes is to intervene those recombinant animals that cause by the people, and described people intervenes and comprises reorganization and antisense technology.Term is intended to comprise all offsprings.Therefore, comprise initial animal and all F1 thereof, F2, offsprings such as F3.
Term used herein " treatment " is intended to comprise at least a symptom of curing and improving illness or disease.
Term " carrier " is meant nucleic acid molecule, and it can transport another nucleic acid that has been connected with it.One class preferred vector is an episome, promptly can be at the nucleic acid of extrachromosomal replication.Preferred vector is can self-replicating and/or express those of the nucleic acid that is connected with them.Can instruct the carrier of the genetic expression that can be operatively connected to be called as herein " expression vector " with them.Usually, the expression vector that is used for recombinant DNA technology often is " plasmid " form, and it typically refers to the circular double stranded DNA ring, their carrier format and karyomit(e) debond.In this manual, " plasmid " and " carrier " can exchange use, because plasmid is the most frequently used carrier format.Yet the present invention is intended to comprise the expression vector of this other form subsequently in this, and it plays a part suitable and known in the art.
Term " wild-type allele " is meant the allelotrope of gene, and it causes the wild-type phenotype when existing among the experimenter with two copies.Have the phenotype that two copies have the experimenter of the gene that Nucleotide changes because some Nucleotide in the gene changes not influence, can have a plurality of different wild-type alleles of specific gene.
4.3 Prospective medicine
4.3.1 IL-1 inflammatory haplotype and relative disease and illness
The present invention to small part based on identifying some inflammatory haplotype, particularly comprise IL-1B (3737) polymorphic allelic those, with related (on the statistics significant degree) of these patterns with the development of some disease or illness.Therefore, in the experimenter, combine allelotrope that detection comprises haplotype separately or with alternate manner and can show that the experimenter suffers from or tends to develop specified disease or illness.Yet, because these allelotrope and other allele linkage imbalance, detect this other chain allelotrope and can illustrate that also the experimenter contains or tend to develop specified disease or illness.For example, 44112332 haplotypes comprise following genotype:
The allelotrope 4 of 222/223 mark of IL-1A
The allelotrope 4 of the gz5/gz6 mark of IL-1A
The allelotrope 1 of-889 marks of IL-1A
IL-1B+allelotrope 1 of 3954 marks
The allelotrope 2 of-511 marks of IL-1B
The allelotrope 3 of gaat.p33330 mark
The allelotrope 3 of Y31 mark
IL-1RN+2018 allelotrope 2 IL-1A+4845 allelotrope 1
The allelotrope 2 of the VNTR mark of IL-1RN
Other 3 kinds of polymorphisms of the variable exon of IL-1RN (exon lic, it produces the gene product of form in the born of the same parents) also with allelotrope 2 linkage disequilibriums (Clay etc., (1996) Hum Genet 97:723-26) of IL-1RN (VNTR).These comprise: IL-1RN exon lic (1812) (GenBank:X77090 is 1812); IL-1RN exon lic (1868) polymorphism (GenBank:X77090 is 1868); With IL-1RN exon lic (1887) polymorphism (GenBank:X77090 is 1887).Other is about the polymorphism of the gene of form in the born of the same parents of alternative splicing in the promotor in addition, and Pic (1731) polymorphism (GenBank:X77090 is 1731) is also with allelotrope 2 linkage disequilibriums of IL-1RN (VNTR) polymorphic locus.For in these polymorphic locuses each, allelotrope 2 linkage disequilibriums (Clay etc., (1996) Hum Genet 97:723-26) of allelotrope 2 sequence variants and IL-1RN (VNTR) locus have been determined.
33221461 haplotypes comprise following genotype:
The allelotrope 3 of 222/223 mark of IL-1A
The allelotrope 3 of the gz5/gz6 mark of IL-1A
The allelotrope 2 of-889 marks of IL-1A
IL-1B+allelotrope 2 of 3954 marks
The allelotrope 1 of-511 marks of IL-1B
The allelotrope 4 of gaat.p33330 mark
The allelotrope 6 of Y31 mark
IL-1RN+2018 allelotrope 1 IL-1A+4845 allelotrope 2
The allelotrope 1 of the VNTR mark of IL-1RN
Individuality with 44112332 haplotypes excessive producer of IL-1 α and IL-1 beta protein typically after stimulating.Contrast therewith, the individuality with 33221461 haplotypes is the person under production (underproducer) of IL-1ra typically.Every kind of haplotype causes short only inflammation to be replied.Allelotrope in each haplotype may have effect and compound genotype effect.In addition, specific disease may be relevant with two kinds of haplotype patterns.
Following table 1 is listed many genotype marks and is learned relevant various diseases and the illness of significance degree with having been found that with these tokens statisticses.
Table 1
IL-1 haplotype genetic marker is related with specified disease
Genotype IL-1A (-889) IL-1A (+4845) IL-1B (-511) IL-1B (+3954) IL-1RN (+2018)
Disease
Periodontopathy ( *2) *2 *2
Coronary artery disease *2 *2
Atherosclerosis
Osteoporosis
*2
Insulin-dependent diabetes *2
Diabetic retinopathy *1
End-stage renal disease (+)
Diabetic nephropathy *2
Hepatic fibrosis (Japanese alcoholism) (+)
Alopecia areata *2
Graves disease *2
Graves' ophthalmopathy (-)
Outer thyroid disease (+)
Systemic lupus erythematous *2
The liver moss sclerosis *2
Sacroiliitis (+)
Property childhood chronic arthritis *2
Rheumatoid arthritis (+)
Insulin-dependent diabetes *2 *2?VNTR
Ulcerative colitis
*2
Asthma *2 *2
Multiple sclerosis ( *2) *2?VNTR
Menopause in advance *2
Except above-mentioned allelotype, as described herein, unbalanced other allelotrope of allele linkage (comprising polymorphism and sudden change) that those skilled in the art's evaluation easily is relevant with disease or illness.For example, can collect from there not being first group of experimenter's of specified disease nucleic acid samples, and from the second group of experimenter's who suffers from disease DNA.Can compare nucleic acid samples then to identify those allelotrope of comparing overexpression in second group with first group, wherein these allelotrope are inferred and disease-related, and described disease is caused by unsuitable interleukin 1 adjusting or promotes.Alternatively, for example by with big population gene type (genotyping) with carry out statistical analysis and seem than being more typically in together of expectation to determine which allelotrope, can identify and with the unbalanced allelotrope of the allele linkage of disease-related.The preferred cohort of selecting is to be made up of the individuality of genetic correlation.The individuality of genetic correlation comprises from mutually agnate individuality, identical ethnic group or even identical family.Along with the degree increase of the genetic correlation between control group and the test group, with the more chain polymorphic allelic predictor increase of far-end once of pathogenic allelotrope.This is because the less evolution time does not reallocate by hereditary exchange incident with the polymorphism of chromosome linkage in initial population through also not allowing.Therefore it is special to develop the race, ethnic group is special, with in addition the special diagnostic gene somatotype of family measure to allow to detect the time once nearer in the human evolution, for example after main ethnic group divergence, after ethnic group is separated into different ethnic groups and even the disease allelotrope that in the nearest history of particular home family, produces.
Between two polymorphic marks or the linkage disequilibrium between polymorphic mark and the pathogenic mutation be metastable.Lack the sporadic chain reproduction on selective pressure or formation catastrophic event basis, polymorphism will finally become separation and will reach linkage equilibrium by human evolution's process thus by the karyomit(e) recombination event.Therefore, the polymorphic allelic possibility of discovery and disease or illness linkage disequilibrium can increase with the variation of two factors at least: reduce the physical distance between polymorphic mark and the pathogenic mutation, with chain to separating the obtainable reduction division quantity from generation to generation that reduces.The consideration of latter's factor points out two individualities to be closely related more, and they may have the common parental set of chromosome more or contain the chromosomal region of chain polymorphism and this is chain to the separation that becomes of the impossible more reduction division exchange incident that takes place by per generation.As a result, two individualities are closely related more, and the polymorphism that extensively separates is more possible can be total to heredity.Therefore, for common race, the individuality that ethnic group or family are relevant can rely on the hereditary indicator of the once farther polymorphic locus that separates as chain pathogenic mutation.
Can design suitable probe with the specific gene of IL-1 locus, as IL-1A, IL-1B or IL-1RN or genes involved hybridization.These genomic dna sequences respectively at Fig. 3, shown in 4 and 5, and correspond respectively to SEQ ID No 1,2 and 3 known in the art and can obtain at www.ncbi.nlm.nih.gov. in addition.In fact about 400,000 base pairs of the IL-1 regional cross of human chromosome 2 are supposed the average independent nucleotide polymorphisms of per 1,000 base pair, comprise about 400 independent SNP locus.Also have other can obtain from various public resources for the polymorphism that the present invention uses.For example, the human genome database compiles SNP in the gene, can be by sequence search and current about 2,700 clauses and subclauses (http://hgbase.interactiva.de) that comprise.Can also obtain human polymorphism data storehouse (MIT snp database (http://www.genome.wi.mit.edu/SNP/human/index.html)) by the Massachusetts Institute of Technology maintenance.Can find SNP and other human polymorphism from these sources.
For example, the genomic IL-1 of scrutineer zone shows that IL-1 locus gene side neighbour locates to be called the polymorphic mark of kinetochore near-end (referring to GenBank registration number Z17008) of microsatellite marker AFM220ze3 and is called the polymorphic mark of far-end (referring to GenBank registration number Z16545) of little satellite grappling mark AFM087xal at the 127.9cM place at 127.4cM (centimorgan) in one of any above-mentioned database.These people's polymorphic locuses all are that the CA dinucleotides repeats microsatellite polymorphism and show height heterozygosity equally in ethnic group.For example, be 5 ' primer and be 3 ' primer that the allelotrope of AFM220ze3 produces the 211bp pcr amplification product with sequence TGGCCTCCAGAAACCTCCAA with sequence TGTACCTAAGCCCACCCTTTAGAGC.In addition, be 5 ' primer and be 3 ' primer that the allelotrope of AFM087xal produces the 177bp pcr amplification product with sequence GGCAAGAGCAAAACTCTGTC with sequence GCTGATATTCTGGTGGGAAA.Corresponding to appearing at the suitable primer that these human chromosomes 2CA dinucleotides repeats 5 ' and 3 ' unique sequence of polymorphism will be tangible for those skilled in the art.Reasonably suitable primer is included in hybridization in the appointment primer of about 1kb and in addition no matter from where beginning extremely those of about 27bp of the about 17bp of length.Be designed for general rule that the unique human chromogene of amplification organizes the primer of sequence and be them and have melting temperature(Tm) at least about 50 ℃, wherein proximate melting temperature(Tm) can be used formula T Melt=[2x (quantity of A or T)+4x (quantity of G or C)] estimates.
Repeat to exist between polymorphisms many other people's polymorphic locuses at these two CA dinucleotides, and for determining that prognosis allelotrope provides other target in the colony of family or other genetic correlation individuality.For example, biotechnology infonation center website (www.nobi.nlm.nih.gov/genemap/) is listed the polymorphism mark in many IL-1 locus zone, and the guidance that designs amplification and analyze the suitable primer of these marks is provided.
Therefore, because the complementary sequence of they and human chromosome 2q 12-13 or form the ability of duplex molecule or, can use nucleotide fragments of the present invention for providing primer from this zone DNA amplification or cDNA from this regional cDNA selectivity.Many factors are considered in the design requirements that is used for the suitable probe of this purpose.For example, discovery is had 10,15, or 18 Nucleotide is to about 20, or particularly useful to the fragment of the length of about 30 Nucleotide.For some embodiment even more preferably long sequence, for example 40,50,80,90,100 even until total length.Because be enough to allow abundant specific hybridization so that be used as molecular probe, at least about the length of the oligonucleotide of 18-20 Nucleotide be those skilled in the art generally acceptance.In addition, depend on the application of imagination, use different hybridization conditions with the selectivity of acquisition probe in various degree expectation target sequence.For the application that requires highly selective, use rigorous relatively condition to form hybridization with typically expecting.For example, low relatively salt and/or hot conditions were as what 0.02M-0.15MNaCl provided to about 70 ℃ temperature at about 50 ℃.This optionally condition can tolerate seldom, if any, the mispairing between probe and template or the target chain.
In conjunction with detecting above-mentioned allelotrope, in the experimenter, can detect or monitor the mark of other allelotrope or other disease, for example differentiate vessel wall thickness (for example passing through ultrasonic measurement), perhaps whether smoking of experimenter is drunk, and is overweight, under pressure or take exercise.
4.3.2. allelic detection
Many methods can be for the specific allelotrope that detects people's polymorphic locus.Be used to detect the molecular property that specific polymorphic allelic preferred method will partly depend on polymorphism.For example, the different allelic forms of polymorphic locus can be by the difference of dna single base pair.This single nucleotide polymorphism (or SNP) is the main contributor of heritable variation, comprises all known polymorphisms of about 80%, and their density Estimation in human genome are 1 of average per 1,000 base pair.SNP is the most frequent two equipotential genes-only with two kinds of multi-form existence (although up to four kinds of multi-form SNP, corresponding to four kinds of different nucleotide bases that occur in DNA, being possible in theory).Yet SNP is more stable than other polymorphism in sudden change, makes them be suitable for association study, wherein the linkage disequilibrium between mark and the unknown variant is used for pathogenic mutation is mapped.In addition because SNP typically only has two kinds of allelotrope, they can by simply just/negative measure rather than linear measure comes gene type, make them be easier to automatization.
Several different methods can be for detecting the polymorphic allelic existence of special single nucleotide in the individuality.The progress in this field provides accurately, easy and cheap extensive SNP gene type.Recently, several new technologies have for example been described, comprise dynamic allele-specific hybridization (DASH), microplate array diagonal angle gel electrophoresis (MADGE), tetra-sodium order-checking (pyrosequencing), the oligonucleotide specificity connects, TaqMan system and various DNA " chip " technology such as Affymetrix SNP chip.These methods require the typically amplification by PCR of target gene zones.Also have other method newly developed, it follows mass spectroscopy or immobilization locking probe and rolling circle amplification based on producing the small-signal molecule by invading cracking, finally may eliminate the needs of PCR.The following summary several method that is used to detect special single nucleotide polymorphism known in the art.Method of the present invention should be understood to comprise all available methods.
Developed several method to promote the analysis of single nucleotide polymorphism.In one embodiment, can detect single base polymorphisms by the Nucleotide that uses special anti-exonuclease, as for example Mundy, C.R. (United States Patent (USP) 4,656,127) is disclosed.According to this method, hybridize with the allelotrope sequence complementary primer permission that is right after polymorphic site 3 ' and from the target molecule of particular animals or people's acquisition.If the polymorphic site on target molecule comprises the nucleotide derivative complementary Nucleotide with the specific anti-exonuclease that exists, this derivative will be incorporated into the end of hybridized primer so.This mixes and causes the anti-exonuclease of primer, allows its detection thus.Because the identity of the derivative of the anti-exonuclease of sample is known, the become discovery of anti-exonuclease of primer shows Nucleotide and the nucleotide derivative complementation that is used for reacting in the polymorphic site have target molecule.It is that it does not require the external sequence data that mensuration is a large amount of that this method has advantage.
In another embodiment of the present invention, be used to measure the identity of polymorphic site Nucleotide based on the method for solution.Cohen, (French Patent 2,650,840 such as D.; PCT applies for No.WO91/02087).As at United States Patent (USP) 4,656, in 127 the Mundy method, use and be right after the allelotrope sequence complementary primer of polymorphic site 3 '.The dideoxyribonucleoside acid derivative of applying marking, this method is determined the identity of the Nucleotide in that site, mixes the end of primer if the Nucleotide complementation of described dideoxyribonucleoside acid derivative and polymorphic site will become.
Goelet, P. etc. (PCT application 92/15712) describe a kind of alternative approach, are called hereditary method of bit analysis (Genetic Bit Analysis) or GBA TMGoelet, the terminator of the method applying marking of P. etc. and the mixture of primer, the sequence complementation of described primer and polymorphic site 3 '.The terminator of the mark that mixes therefore by the nucleotide sequencing in the polymorphic site that is present in evaluated target molecule and with its complementation.Method (French Patent 2,650,840 with Cohen etc.; PCT applies for No.WO91/02087) form contrast, Goelet, the method for P. etc. is preferably inhomogeneous to be measured mutually, wherein primer or target molecule is fixed in solid phase.
Recently, describe several Nucleotide that are used for measuring the primer guiding of DNA polymorphic site and mixed method (Komher, J.S. etc., Nucl.Acids.Res.17:7779-7784 (1989); Sokolov, B.P., Nucl.Acids Res.18:3671 (1990); Syvanen, A.-C., etc., Genomics 8:684-692 (1990); Kuppuswamy, M.N. etc., Proc.Natl.Acad.Sci. (U.S.A.) 88:1143-1147 (1991); Prezant, T.R. etc., Hum.Mutat.1:159-164 (1992); Ugozzoli, L. etc., GATA 9:107-112 (1992); Nyren, P. etc., Anal.Biochem.208:171-175 (1993)).These methods are different from GBA TM, be that they all depend on the mixing to distinguish of deoxynucleotide of mark between the base at polymorphic site place.In this form, because signal is proportional with the quantity of the deoxynucleotide that mixes, can produce and the proportional signal of running length (Syvanen, A.-C. in the polymorphism of the emerged in operation of identical Nucleotide, Deng, Amer.J.Hum.Genet.52:46-59 (1993)).
For the too early terminated sudden change that causes protein translation, protein brachymemma test (PTT) provides effective diagnostic method, and (Roest is etc., (1993) Hum.Mol.Genet.2:1719-21; Van derLuijt, etc., (1994) Genomics 20:1-4).For PTT, RNA separates from available tissue at first and is reversed record, by pcr amplification institute purpose section.Then the product of reverse transcription PCR is used as the template of nested pcr amplification, primer comprises rna polymerase promoter and is used for the sequence of initial eukaryotic translation.After amplification purpose zone, the single motif that is incorporated into primer allows the continuous in-vitro transcription and the translation of PCR product.Through after the sodium dodecyl sulfate-polyacrylamide gel electrophoresis of translation product, the appearance of brachymemma polypeptide shows the existence that causes translating too early terminated sudden change.In the variant of this technology, when the purpose target region derives from single exon, DNA (opposite with RNA) is used as pcr template.
Can utilize any cell type or tissue to obtain to be used for the nucleic acid samples of diagnosis described herein.In preferred embodiments, the DNA sample for example passes through blood or the saliva that known technology (for example venipuncture) obtains available from body fluid.Alternatively, can on dry sample (for example hair or skin), carry out the nucleic acid check.When using RNA or protein, operable cell or tissue must be expressed the IL-1 gene.
The tissue slice (fixing and/or freezing) that can also directly organize the experimenter available from examination of living tissue or surgical blanking is gone up original position and is carried out diagnosis algorithm, does not therefore need nucleic acid purification.Can with nucleic acid reagent as the probe of this in-situ method and/or primer (referring to for example, Nuovo, G.J., 1992, PCR insitu hybridization:protocols and applications, Raven Press, NY).
Except mainly concentrating on the method that detects a nucleotide sequence, in this detection scheme, can also assess collection of illustrative plates.For example by the usage variance display packing, Northern analyzes and/or RT-PCR can produce finger printing.
Preferred detection method is to use the allele-specific hybridization of probe, at least one allelotrope zone of the short scorching haplotype of the overlapping IL-1 of described probe and have around sudden change or the polymorphic zone about 5,10,20,25, or 30 Nucleotide.In a preferred embodiment of the invention, can with other several probes of allele variant specific hybrid that relate to restenosis attached to solid phase carrier, for example " chip " (it can hold up to about 250,000 oligonucleotide).Oligonucleotide can combine with solid phase carrier by the several different methods that comprises lithography.For example in (1996) Human Mutation 7:244 such as Cronin, describe and use these to comprise the chip of oligonucleotide, be also referred to as the mutation detecting analysis of " dna probe array ".In one embodiment, chip comprises all allele variants at least one polymorphic zone of gene.Then solid phase carrier is contacted and the hybridization of detection and specific probe with check nucleic acid.Therefore, in simple hybrid experiment, can identify the identity of many allele variants of one or more genes.The step of amplification of nucleic acid before these technology can also be included in and analyze.Amplification technique is known for those skilled in the art, and include but not limited to clone, polymerase chain reaction (PCR), the polymerase chain reaction of specific alleles (ASA), ligase chain reaction (LCR) (LCR), nested polymerase chain reaction, self-sustained sequence replication (Guatelli, J.C. etc., 1990, Proc.Natl.Acad.Sci.USA 87:1874-1878), (the Kwoh of transcription amplification system, D.Y. etc., 1989, Proc.Natl.Acad.Sci.USA 86:1173-1177), with Q-Beta replicative enzyme (Lizardi, P.M. etc., 1988, Bio/Technology 6:1197).
Amplified production can be measured in many ways, comprise size analysis, restriction digestion then size is analyzed, the Oligonucleolide primers of detection specificity mark in reaction product, allele specific oligonucleotide (ASO) hybridization, allele-specific 5 ' exonuclease detects, order-checking, hybridization etc.
The detection method of PCR-based can comprise a plurality of marks of multiplex amplification simultaneously.For example, be known in the art selection PCR primer to produce the PCR product that size is not overlapping and can analyze simultaneously.The primer amplification of alternatively, can be with distinctive mark and therefore can distinguish detection is isolabeling not.Certainly, the detection method based on hybridization allows the difference of a plurality of PCR products in the sample to detect.Other technology known in the art allows the multiple analysis of a plurality of marks.
In illustrative embodiment only, method may further comprise the steps (i) from experimenter's collecting cell sample, (ii) isolating nucleic acid is (for example from sample cell, genome, mRNA or both), (iii) under various conditions nucleic acid samples is contacted with one or more primers so that allelic hybridization and amplification take place, described primer and IL-1 urge at least one allelotrope 5 ' and the 3 ' specific hybrid of scorching haplotype and (iv) detect amplified production.If these molecules exist with extremely low quantity, these detection schemes are particularly useful for detecting nucleic acid molecule.
In the preferred embodiment that the experimenter measures, identify the allelotrope of the short scorching haplotype of IL-1 by the change of restriction enzyme cutting type.For example, sample separation and contrast DNA, amplification (randomly) with one or more restriction endonuclease digestion, is determined the fragment length size by gel electrophoresis.
In also having another embodiment, any can being used in the multiple sequencing reaction known in the art directly checks order allelotrope.Exemplary sequencing reaction comprises based on by those of the technology of Maxim and Gilbert ((1977) Proc.Natl Acad Sci USA 74:560) or Sanger (Sanger etc. (1977) Proc.Nat.Acad.Sci USA 74:5463) exploitation.Also consider as any (referring to for example Biotechniques (1995) 19:448) that carry out to use when the experimenter measures in the multiple automatic sequencing method, comprise by the mass spectrum order-checking (referring to the open WO94/16101 of for example PCT; Cohen etc. (1996) Adv Chromatogr 36:127-162; With (1993) Appl Biochem Biotechnol 38:147-159 such as Griffin).To be apparent that for those skilled in the art,, only need in sequencing reaction, determine one, the appearance of two or three nucleic acid bases for some embodiment.For example, can carry out A-tracking (track) etc., as wherein only detecting a nucleic acid.
In another embodiment; can use the protection that prevents cutting agent (as nuclease; azanol or perosmic anhydride and piperidines) detect the base mismatch (Myers waits (1985) Science 230:1242) in RNA/RNA or RNA/DNA or the DNA/DNA heteroduplex.Usually, the prior art of " mispairing cutting " is initial by the heteroduplex that provides (mark) RNA by will containing wild-type allele or DNA and sample hybridization to form.Use the agent treated duplex, the strand zone of this reagent cutting duplex is as because the base-pair mismatch between contrast and the sample chain causes it to exist.For example, can handle the RNA/DNA duplex, handle DNA/DNA hybrid (hybrid) with enzymatic digestion mispairing zone with the S1 nuclease with the RNA enzyme.In other embodiments, can handle DNA/DNA or RNA/DNA duplex so that digestion mispairing zone with azanol or perosmic anhydride and piperidines.After digestion mispairing zone, then by the material that on denaturing polyacrylamide gel, obtains by size separation to determine the mutational site.Referring to (1988) Proc.Natl Acad Sci USA85:4397 such as for example Cotton; With (1992) Methods Enzymol.217:286-295 such as Saleeba.In preferred embodiments, can will contrast DNA or RNA mark to be used for detection.
In also having another embodiment, the mispairing cleavage reaction uses the right protein (so-called " dna mismatch reparation " enzyme) of the base mismatch in one or more identification double-stranded DNAs.For example intestinal bacteria mutY enzyme is at G/A mispairing place cutting A, from the thymidine DNA glycosylase of HeLa cell at G/T mispairing place cutting T (Hsu etc. (1994) Carcinogenesis 15:1657-1662).According to the embodiment that exemplifies, come the DNA product hybridization of self-checking cell based on the allelic probe of IL-1 locus haplotype and cDNA or other.Handle duplex with dna mismatch repair enzyme, can detect cleaved products from electrophoresis scheme etc., if any.Referring to for example United States Patent (USP) 5,459,039.
In other embodiments, the change of electrophoretic mobility can be used for identifying IL-1 locus allelotrope.For example, single strand conformation polymorphism (SSCP) can be used to detect the difference of the electrophoretic mobility between mutant and the wild-type nucleic acid, and (Orita etc. (1989) Proc Natl.Acad.Sci USA 86:2766 is also referring to Cotton (1993) Mutat Res 285:125-144; And Hayashi (1992) Genet Anal Tech Appl 9:73-79).With sample and contrast IL-1 locus allelic single stranded DNA fragment sex change and allow renaturation.The secondary structure of single-chain nucleic acid changes according to sequence, and the change of the electrophoretic mobility that causes allows to detect even single base changes.Can detect with the dna fragmentation mark or with label probe.By using RNA (rather than DNA) can strengthen the susceptibility of mensuration, secondary structure is more responsive to sequence variation in RNA.In preferred embodiments, based on the variation of electrophoretic mobility, subject methods uses the heteroduplex analysis to separate double-stranded heteroduplex molecule (Keen etc. (1991) Trends Genet 7:5).
In also having another embodiment, use denaturing gradient gel electrophoresis (DGGE) to be determined at allelic motion in the polyacrylamide gel that contains the gradient denaturing agent (Myers etc. (1985) Nature313:495).When with DGGE when the analytical procedure, for example add about 40bp height-fusion and be rich in the GC of the DNA of GC and press from both sides (clamp) modifying DNA to guarantee its incomplete sex change by PCR.In another embodiment, the use temperature gradient substitutes the mobility difference (Rosenbaum and Reissner (1987) Biophys Chem 265:12753) that the denaturing agent gradient is identified contrast and sample DNA.
Other example that is used to detect allelic technology includes but not limited to selectivity oligonucleotide hybridization, selective amplification, or selectivity primer extension.For example, can prepare the Oligonucleolide primers that known mutations wherein or nucleotide difference (for example in allele variant) are placed on central authorities, hybridize (Saiki etc. (1986) Nature 324:163) with target DNA having only under the condition that when finding to mate fully, allows hybridization then; Saiki etc. (1989) Proc.Natl Acad.Sci USA 86:6230).This equipotential gene specific oligonucleotide hybridization technology can be used to detect a sudden change of each reaction or polymorphic zone when the hybridization of the target DNA of oligonucleotide and pcr amplification, when oligonucleotide can be used to detect many different sudden changes or polymorphic zone attached to Hybond membrane this technology with the target DNA hybridization of mark the time.
Alternatively, the allele specific PCR that depends on the selectivity pcr amplification can be used in combination with the present invention.The oligonucleotide that is used as the primer of specific amplification can carry sudden change or polymorphic zone (therefore differential hybridization is depended in amplification) (Gibbs etc. (1989) the Nucleic Acids Res.17:2437-2448) that is concerned about in molecule central authorities, perhaps at the 3 ' end of a primer, wherein can prevent mispairing under proper condition, or reduce polymerase extension (Prossner (1993) Tibtech 11:238).In addition, can be desirably in the sudden change zone and introduce new restriction site to produce detection (Gasparini etc. (1992) Mol.Cell Probes 6:1) based on cutting.Be expected at some embodiment and can also use the Taq ligase enzyme that is used to increase increase (Barany (1991) Proc.Natl.Acad.Sci USA 88:189).In these cases, have only when 3 ' the terminal existence of 5 ' sequence to connect when mating fully, making can be by checking the existence of increasing or lacking the existence that detects in the specific site known mutations.
In another embodiment, as for example U.S. patent 4,998,617 with at Landegren, U. etc. ((1988) Science 241:1077-1080) are described, use oligonucleotide to connect mensuration (OLA) and carry out the evaluation of allele variant.The OLA scheme is used two Oligonucleolide primers, and its design comes and can hybridize with the contiguous sequence of target strand.One of oligonucleotide is connected with separation marking biological example elementization, and another can detect ground mark.If find accurate complementary sequence in target molecule, oligonucleotide will be hybridized consequently their end adjacency, and produce the connection substrate.Connect then and allow to use avidin or other vitamin H part to reclaim the oligonucleotide of mark.Nickerson, D.A. etc. have described in conjunction with the nucleic acid detection assay of PCR and OLA attribute (Nickerson, D.A. etc. (1990) Proc.Natl.Acad.Sci.USA 87:8923-27).In the method, with the index amplification that PCR is used to realize target DNA, use OLA to detect then.
Several allelotrope that also can be used to detect IL-1 locus haplotype based on the technology of this OLA method have been developed.For example, United States Patent (USP) 5,593,826 open OLA, its use has 3 '-amino oligonucleotide and 5 '-phosphorylation oligonucleotide and has the conjugate that phosphoramidate is connected with formation.In the another kind of OLA variant that ((1996) Nucleic Acids Res 24:3728) such as Tobe describes, allow in single microtiter well two allelic gene typings with PCR bonded OLA.By haptens with uniqueness, be sheep Granules glycosides and fluorescein-labelled every kind of allele-specific primers, by using hapten specificity antibody can detect every kind of OLA reaction, described hapten specificity antibody is with different enzyme reporter genes (reporter), alkaline phosphatase or horseradish peroxidase-labeled.This system allows to use the high throughput format that causes two kinds of different colours to produce to detect two allelotrope.
Another embodiment of the present invention relates to the test kit that is used to detect the tendency that develops restenosis.This test kit can comprise one or more oligonucleotide, comprises and at least one allelotrope 5 ' of IL-1 locus haplotype and 5 ' and 3 ' oligonucleotide of 3 ' hybridization.The pcr amplification oligonucleotide should be separated by between 25 and 2500 base pairs, preferably be separated by about 100 and about 500 bases between hybridize so that produce the PCR product that size is convenient to subsequent analysis.
The particularly preferred primer that is used for diagnostic method of the present invention comprises: it is polymorphic allelic to be used to detect IL-1B (3737)
TCTAGACCAGGGAGGAGAATGGAATGTCCCTTGGACTCTGCATGT and
TCTAGACCAGGGAGGAGAATGGAATGTTCCTTGGACTCTGCATGT；
It is polymorphic allelic to be used to detect IL-1B (1469)
ACAGAGGCTCACTCCCTTG CATAATGCAGAGCGAGCACGATACCTGG and
ACAGAGGCTCACTCCCTTG TATAATGCAGAGCGAGCACGATACCTGG; With
It is polymorphic allelic to be used to detect IL-1B (999)
GATCGTGCCACTgcACTCCAGCCTGGGCGACAG GGTGAGACTCTGTCTC and
GATCGTGCCACTgcACTCCAGCCTGGGCGACAG CGTGAGACTCTGTCTC。
Come the up-to-date sequence information of human chromosome 2ql3-of self-contained people IL-1 locus and up-to-date operability to promote to be used for and detect the design of the polymorphic allelic other oligonucleotide of IL-1 by the inventive method amplification about the obtainable people's polymorphism information of this locus.For example, respectively at Fig. 1 (GenBank registration number X03833), show about IL-1A the dna sequence dna of IL-1B and IL-1RN respectively among 2 (GenBank registration number X04500) and 3 (the GenBank registration number X64532).Use this sequence information and the standard technique that is used to design and optimize primer sequence known in the art, can easily be designed for the suitable primer that detects human polymorphism in these genes.For example by using commercially available primer select procedure such as Primer 2.1, Primer 3 or GeneFisher can finish the optimal design of these primer sequences (also referring to Nicklin M.H.J., Weith A.Duff G.W., " APhysical Map of the Region Encompassing the Human Interleukin-1 α; Interleukin-1 β, and Interleukin-1 Receptor Antagonist Genes " Genomics 19:382 (1995); Nothwang H.G. waits " Molecular Cloning of the Interleukin-1gene Cluster:Construction of an Integrated YAC/PAC Contig and a partialtranscriptional Map in the Region of Chromosome 2ql 3 " Genomics 41:370 (1997); Clark waits (1986) Nucl.Acids.Res., and the 14:7897-7914[Error pf publication is at Nucleic Acids Res., and the GenomeDatabase (GDB) of 15:868 (1987) and URL http://www.gdb.Org occurs in the works].
About the use in the test kit, oligonucleotide can be any in the multiple natural and/or synthetic composition, as synthetic oligonucleotide, and restricted fragment, cDNA, synthetic peptide nucleic acid(PNA) (PNA), etc.Assay kit and method can also applying marking oligonucleotide be easy to identify to allow to measure.The example of operable mark comprises radio-labeled, enzyme, fluorescent chemicals, streptavidin, avidin, vitamin H, magnetic part, melts combine part, antigen or antibody moiety etc.
Test kit can randomly also comprise the DNA sampling unit.The DNA sampling unit is known for those skilled in the art and can includes but not limited to matrix, as filter paper, and AmpliCard TM(University of Sheffield, Sheffield, England S10 2JF; Tarlow, JW, etc., J.ofInvest.Dermatol.103:387-389 (1994)) etc.; DNA purified reagent such as Nucleo TMTest kit, lysis buffer, protein enzyme solution etc.; PCR reagent, as the 10x reaction buffer, thermostability polysaccharase, dNTP etc.; With allelotrope proofing unit such as HinfI restriction enzyme, allele specific oligonucleotide is used for from the degeneracy oligonucleotide primer of the nested PCR of dried blood.
4.3.3 pharmacogenomics
Independent or combination helps the information of the hereditary defect of specified disease or illness about other, understand the specific allelotrope relevant with the susceptibility of development specified disease or illness and allow to customize prevention or treatment according to the genetic map of individuality, this is the target of " pharmacogenomics ".Therefore, individual IL-1 collection of illustrative plates and population collection of illustrative plates allow selection or design medicine or other treatment plan about the comparison of vascular disease, and its expectation is a safety and effective for particular patient or patient colony (i.e. one group of patient with identical hereditary change).
In addition, based on genetic map aiming desired display the ability of the colony of high clinical benefit make can: 1) reorientate the medicine that has gone on the market; 2) rescue is because security or effect restriction cause interrupting the specific drug candidate of patient subgroups of clinical development; With 3) quicken and develop candidate therapy more cheaply and the drug label more optimized (for example because the medicament of measuring various dosage is useful to the effect of pathogenic mutation for the optimization effective dose).
By measuring protein (for example IL-1 α, IL-1 β, or IL-1Ra), mRNA and/or transcriptional level can be monitored the individual treatment of specific therapy.According to detection level, can keep or adjust (increasing or reduce dosage) treatment plan then.In preferred embodiments, with medicament treatment experimenter's effectiveness comprises following steps: (i) obtained sample before the administration before the administration medicament from the experimenter; (ii) detect the protein in the preceding sample of administration, the level of mRNA or genomic dna or quantity; (iii) from the experimenter, obtain the sample after one or more administrations; (iv) detect protein in the sample after administration, the expression level of mRNA or genomic dna or activity; (protein in v) will the sample before administration, corresponding protein in the expression level of mRNA or genomic dna or the active sample with after administration, mRNA or genomic dna comparison; (vi) correspondingly change medicament administration to the experimenter.
Can also before the therapeutical agent administration and the cell that obtains the experimenter afterwards to detect the expression of gene level except the IL-1 gene, do not increase or reduce possible deleterious expression of gene to confirm therapeutical agent.This can finish by the method for using transcription mapping (profiling).Therefore, ex vivo can be exposed to therapeutical agent cell mRNA and from the mRNA reverse transcription of the same type cell that is not exposed to therapeutical agent and with the chip hybridization that contains from the DNA of a plurality of genes, thus relatively handle with therapeutical agent or untreated cell in expression of gene.
4.4. be used for and IL-1 polymorphism diseases associated and treatment of conditions agent
Be used for being meant and prevent or postpone the development of experimenter's specified disease or symptom or alleviate any reagent or the treatment plan (comprising medicine, trophology (nutraceuticals) and surgical method) of its symptom with IL-1 polymorphism or haplotype diseases associated and treatment of conditions agent.Therapeutical agent can be a polypeptide, peptide mimics, and nucleic acid or other inorganic or organic molecule preferably include VITAMIN, " small molecules " of mineral substance and other nutrient.By imitation or strengthen (excitement) or (antagonism) the naturally occurring polypeptide effect of inhibition, preferred therapeutic agents can be regulated at least a activity of IL-1 polypeptide, for example with the interaction of acceptor.Agonist can be that wild-type protein or its have for example derivative of receptor-binding activity of at least a wild-type biology activity.Agonist can also be the up-regulated gene expression or increase proteinic at least a bioactive compound.Agonist can also be to increase for example compound of acceptor interaction of polypeptide and another molecule.Antagonist can be to suppress or reduce for example interactional compound between the acceptor of protein and another molecule, or the reagent (for example IL-1 saccharase (ICE) inhibitor) of disabling signal transduction or translation post-treatment.Therefore, preferred antagonist is inhibition or minimizing and receptors bind and blocks the compound of receptor activation subsequently thus.Antagonist can also be down-regulation of gene expression or the compound that reduces the proteinic amount that exists.Antagonist can be the polypeptide of dominant form, for example can with the target peptide for example acceptor interaction but do not promote the polypeptide of the form of receptor activation.Antagonist can also be the nucleic acid of the polypeptide of coding dominant form, antisense nucleic acid, or can with the interactional ribozyme of RNA specificity.Other antagonist that also has is the molecule that combines and suppress its effect with polypeptide.These molecules comprise peptide, for example the various forms of target peptides of biologically active and inhibition and receptors bind not.Therefore, these peptides will combine and prevent it and target peptide interaction with the activity of proteins site.The antagonist that also has comprises and the interaction of molecule epitope specificity, so that the antibody of the biological function of polypeptide is interfered in combination.In also having another preferred embodiment, antagonist is a small molecules, as suppressing interactional molecule between polypeptide and the target acceptor.Alternatively, by interacting with site except receptor binding site, small molecules can be used as antagonist.
IL-1 (for example IL-1 α, IL-1 β or IL-1 receptor antagonist) or can comprise the compound of any kind by the proteinic instrumentality with the unbalanced genes encoding of IL-1 gene linkage comprises protein, peptide, peptide mimics, small molecules, or nucleic acid.Preferred antagonist comprises nucleic acid (gene of for example encoding IL-1 albumen or being raised or reducing by IL-1 albumen), protein (for example IL-protein or raise thus or the protein of downward modulation) or small molecules (for example regulate IL-1 protein expression or in conjunction with).The preferred antagonist that for example uses mensuration as herein described to identify, comprise nucleic acid (for example single (antisense) or double-stranded (triplex) DNA or PNA and ribozyme), protein (for example antibody) and be used to prevent or suppress that IL-1 transcribes and/or the small molecules of protein active.
4.4.1. effective dose
By in cell culture or laboratory animal, for example being used to measure the standard drug program of LD50 (the lethal dosage of 50% colony) and Ed50 (the effective dosage of 50% mass treatment), can measure the toxicity and the therapeutic efficiency of these compounds.Dosage rate between the poisonous or therapeutic action is a therapeutic index, and it can be expressed as ratio LD50/ED50.The preferred compound that shows big therapeutic index.Although can use the compound that shows toxic side effects, should the careful design transfer system, it is the position of these targeting compounds affected tissue, so that minimize the latent lesion of non-infected cells and reduce side effect thus.
Can be used to prepare the various human dosage that are used for from the data that cell cultures is measured and zooscopy obtains.The dosage of these compounds is preferably placed at and comprises that ED50 has in the very little or avirulent circulation composition scope.According to used formulation and used route of administration, dosage can change in this scope.For any compound used in the inventive method, from measuring, cell cultures can assess the treatment effective dose at first.In animal model, can prepare dosage to obtain to comprise circulating plasma concentration range as the IC50 (promptly obtaining the maximum concentration that suppresses the detection compound of half of symptom) that measures in the cell cultures.This information can be used for measuring more accurately the mankind's effective dose.For example can measure level in the blood plasma by high performance liquid chromatography.
4.4.2. preparation and use
Can use one or more physiologically acceptable carriers or vehicle to prepare composition used according to the present invention with ordinary method.Therefore, can prepare compound and their physiologically acceptable salt and solvates, be used for sucking or be blown into (by mouth or nose) administration or oral by for example injection, cheek contains (buccal), parenteral or rectal administration.
For this treatment, the The compounds of this invention preparation can be used for the administration of various loads, comprise system and part (topical) or location (localized) change administration.Technology and preparation usually can be at Remmington ' s Pharmaceutical Sciences, Meade Publishing Co., and Easton finds among the PA.For the whole body administration, preferred injection comprises intramuscular, intravenously, intraperitoneal and subcutaneous.For injection, The compounds of this invention can be formulated in the liquor, preferably at physiology compatible buffers such as Hank ' s solution or Ringer ' s solution.In addition, compound can be with solid form preparation and dissolving or suspension again before being about to use.Also comprise lyophilized form.
For oral administration, composition can adopt for example tablet or capsular form, its be by ordinary method with following every preparation: pharmaceutical excipient such as tackiness agent (for example the W-Gum of gelatinization in advance, polyvinylpyrrolidone or Vltra tears); Weighting agent (for example lactose, Microcrystalline Cellulose or secondary calcium phosphate); Lubricant (for example Magnesium Stearate, talcum or silica); Disintegrating agent (for example yam starch or sodium starch glycollate); Or wetting agent (for example sodium lauryl sulphate).Can be with method coated tablet well known in the art.The liquid preparation that is used for oral administration can be taked for example solution, the form of syrup or suspensoid, and perhaps their dryed products of can be used as before use with water or other suitable vehicle group structure exist.Can prepare these liquid preparations by ordinary method with medicinal additive, described medicinal additive such as suspension agent (for example Sorbitol Powder syrup, derivatived cellulose or hydrogenation edible-fat); Emulsifying agent (for example Yelkin TTS or gum arabic); Non-aqueous carrier (for example ationd oil, oily ester, ethanol or fractionated vegetables oil); And sanitas (for example methyl or propyl para-hydroxybenzoate or Sorbic Acid).If suitably preparation can also comprise buffering salt, seasonings, tinting material and sweeting agent.
The preparation that is used for oral administration suitably can be prepared to produce the controlled release of active compound.Containing administration composition for cheek can take with the tablet of ordinary method preparation or the form of lozenge.For passing through inhalation, used according to the present invention compound expediently since the aerosol spray of self-pressurization packing or the atomizer form of presenting use suitable propelling agent transmission, described propelling agent is Refrigerant 12 for example, trichlorofluoromethane, dichloro tetrafluoro ethane, carbonic acid gas or other suitable gas.In the situation of pressurized aerosol,, valve can measure dose unit with the amount of transmitting metering by being provided.Can prepare the capsule and the cartridge case of for example gelatin that is used for sucker or insufflator, the powdered mixture of its inclusion compound and suitable powder matrix such as lactose or starch.
Can prepare compound and be used for administered parenterally, it is for example injected or continuous infusion by bolus by injection.The preparation that is used to inject can with the sanitas that adds with unit dosage form, for example in peace is cutd open or in multi-dose container, exist.Composition can be taked such as the suspension in oiliness or aqueous carrier, the form of solution or emulsion, and can comprise reagent preparation such as suspensoid, stablizer and/or dispersion agent.Alternatively, activeconstituents can be before use with for example aseptic powder form that does not contain the water group structure of pyrogen of suitable carrier.
Compound can also be mixed with rectal compositions such as suppository or enema,retention, for example comprises conventional suppository bases such as theobroma oil or other glyceryl ester.
Except previous formulations, compound can also be mixed with depot formulation.These prolonged action preparations can be by transplanting (for example subcutaneous or intramuscular) or using by intramuscularly.Therefore, for example compound can be with suitable polymerization or lyophobic dust (for example as the emulsion that can accept in the oil) or ion exchange resin preparation, or is mixed with the slightly soluble derivative, for example slightly soluble salt.Other suitable transfer system comprises microsphere, and the possibility of medicine is transmitted in its interior local non-infringement of time that is provided at prolonging period.This technology is utilized the microsphere of metarteriole size, its can via coronary catheter be expelled to heart for example or other organ any selection part and do not cause inflammation or local asphyxia.The therapeutical agent of using discharges lentamente and is absorbed by surrounding tissue cell (for example endotheliocyte) from these microspheres.
Can also be by through mucous membrane or through the method whole body administration of skin.For through mucous membrane or percutaneous dosing, in preparation, use the permeate agent that is suitable for the barrier that permeated.This permeate agent is known in this field, and comprises and for example be used for mucosal biliary salts and fusidic acid derivatives.In addition, can use washing composition to promote infiltration.Mucosal can or use suppository by the nose spraying.For topical, oligomer of the present invention can be mixed with ointment well known in the art, ointment, gel, or emulsifiable paste.Can locally use washing lotion to handle damage or inflammation with healing acceleration.
If desired, composition may reside among packing or the dispenser device, and it can contain one or more unit dosage forms that contains activeconstituents.Packing for example can comprise metal or plastic foil, as Blister Package.Packing or dispenser device can have the administration operation instruction.
4.5. the mensuration of identify therapeutic agents
Based on causing or help evaluation with the sudden change of IL-1 polymorphism or haplotype diseases associated development, the present invention be characterised in that in addition be used for identify therapeutic agents based on cell or acellular mensuration.In one embodiment, under the test compounds Individual existence or test compounds and other proteinic in the presence of, incubation on its cytolemma outside surface, express the IL-1 acceptor or by with the cell of the proteinic acceptor of the unbalanced genes encoding of IL-1 gene linkage, and for example by use little physiograph (microphysiometer) (McConnell etc. (1992) Science 257:1906) to detect between test compounds and the acceptor or protein (preferred labelled protein) and acceptor between interaction.Detect as the acceptor of substratum acidifying variation and the interaction between test compounds or the protein by little physiograph.Therefore this mensuration system provides for example method by the molecule agonist of interfering molecule antagonist that protein-acceptor interaction works and for example working by activated receptor of evaluation.
Cell or cell-less measurement can also be used to identify regulate the IL-1 gene or with the expression of gene of its linkage disequilibrium, the compound of regulating mRNA translation or regulating mRNA or protein stability.Therefore, in one embodiment, can produce the cell of IL-1, or other protein and test compounds incubation, measure the proteinic amount of producing in the cell culture medium, and with never with cell that test compounds contact in the proteinic amount comparison of producing.By various check analysiss, for example measure the expression of one or more crt genes, can confirm that compound is with respect to proteinic specificity.Particularly, this analysis can be used to measure antisense, the effect of ribozyme and tripolymer compound.
Cell-less measurement can also be used for identifying can with protein interaction, change the compound of protein active thus.This compound can for example change the ability that proteinic structure influences it and receptors bind thus.In preferred embodiments, be used to identify that the cell-less measurement of these compounds is made up of reaction mixture basically, described reaction mixture is included in the existence of binding partner or not protein and test compounds or test compounds storehouse under the existence condition.Test compounds can be for example derivative of binding partner, for example active target peptide of lifeless matter or small molecules.
Therefore, the screening assay of the present invention of an example comprises the step that protein or its function fragment and test compounds or test compounds storehouse is contacted and detect the formation of complex body.For testing goal, molecule can come mark with special mark, and test compounds or test compounds storehouse are with different mark marks.So can detect the segmental interaction of test compounds and protein or its by the level of measuring two kinds of marks later in incubation step and washing step.The existence of two kinds of marks is represented to interact after washing step.
Detect surface plasma resonance (SPR) by using, a kind of real-time BIA of optical phenomena (biomolecular interaction analysis, Pharmacia Biosensor AB) also can identify intermolecular interaction.Detection depends on the variation in biologic specificity interface macromole mass concentration, does not need any reactant of mark.In one embodiment, the test compounds storehouse can be fixed on sensor surface, for example, it forms a pool wall of micro flow cell.The solution Continuous Flow that contains protein or its function fragment is then crossed sensor surface.The variation display interaction of the resonance angle shown in signal record takes place.This technology for example further describes in the BIA of Pharmacia technical manual.
The screening assay of another example of the present invention may further comprise the steps: (a) form reaction mixture, it comprises: (i) IL-1 or other protein, (ii) suitable acceptor and (iii) test compounds; (b) interaction of detection protein and acceptor.Compare with the interaction that lacks test compounds, the interactional statistics noticeable change of protein and acceptor under the test compounds existence condition (strengthening or inhibition) shows possible antagonist (inhibitor).The compound of this test can contact simultaneously.Alternatively, protein can at first contact the time of appropriate amount with test compounds, then acceptor is added reaction mixture.The data that obtain by the test compounds of using various concentration produce the effect that dose response curve can be assessed compound.In addition, can also carry out blank determination so that the baseline of comparison to be provided.The complex body that can detect between protein and acceptor by various technology forms.By immunoassay, or, use for example detectable labelled protein by the chromatogram detection, as radio-labeling, fluorescent mark, or the protein of enzymatic labelling or acceptor, the quantitatively adjusting of complex body formation.
Typically, expectation immobilized protein or acceptor automatization to promote from one or both protein of non-complexed forms formula, to separate complex body and adapt to mensuration.In any container that is suitable for comprising reactant, can finish the combination of protein and acceptor.Example comprises microtiter plate, test tube and miniature centrifuge tube.In one embodiment, can provide fused protein, it increases permission protein and matrix bonded structural domain.For example, the glutathione-S-transferase fused protein can be adsorbed onto glutathione agarose bead (Sigma Chemical, St.Louis, MO) or on the microtiter plate of gsh derivatize, its then with for example acceptor and the test compounds combination of 35S-mark of acceptor, although more rigorous a little condition may be better, under the condition that helps complex body to form, for example under the physiological condition of salt and pH, the incubation mixture.Behind incubation, wash bead to remove any unconjugated mark, with the fixing and direct radio-labeling (for example bead being put in the scintillator) of measuring of matrix, or after subsequently complex body being dissociated, in supernatant liquor, measure.Alternatively, complex body can dissociate from matrix, separates by SDS-PAGE, uses as the protein quantitatively found in the pearl fraction from gel in the standard electrophoretic technique described in the attached embodiment in back or the level of acceptor.Other is used for fixing the technology of protein on matrix also can measure use for theme.For example, utilize the coupling of vitamin H and streptavidin can immobilized protein or acceptor.Also can prepare transgenic animal to identify the security and the effect of agonist and antagonist or confirmation candidate therapeutic agent.Transgenic animal of the present invention can comprise the non-human animal, and it is included in the following or restenosis pathogenic mutation under the control of allogeneic promoter of control of suitable endogenesis promoter.
Transgenic animal can also be to contain transgenosis such as reporter gene or its segmental animal under the control of suitable promotor.These animals are used for for example identifying as express the medicine of regulating the proteinic production of IL-1 by regulatory gene.The method that obtains the transgenic nonhuman animal is known in this field.In preferred embodiments, use the cis acting sequence of for example expressing, the expression of restenosis pathogenic mutation is limited in specific cell subsets, tissue or etap with desired pattern control.In the present invention, this proteinic chimeric expression may be critical for many linkage analysis types, and can provide in addition and assess for example method of expression level influence, described expression level may change the growth of little block organization in the other fetal tissues fully.For this reason, can the using-system specificity regulating sequence and condition regulates sequence and is controlled at the expression that suddenlys change in the particular spatial distribution pattern.The time distribution pattern of expression can be provided by for example condition recombination system or protokaryon transcriptional regulatory sequences in addition.Genetic technique, its permission can be regulated mutation expression by locus specificity genetic manipulation in the body, is known for those skilled in the art.
Transgenic animal of the present invention all comprise pathogenic mutation transgenosis of the present invention in a plurality of their cells, this transgenosis changes the phenotype of " host cell ".In illustrative embodiment, can use cre/loxP recombinase system (Lakso etc. (1992) the PNAS 89:6232-6236 of phage P1; Orban etc. (1992) PNAS 89:6861-6865) or the FLP recombinase system of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) (O ' (1991) Science 251:1351-1355 such as Gorman; The open WO 92/15694 of PCT) produces locus specificity genetic recombination system in the body.The locus specificity reorganization of the insertion target sequence of Cre recombinase catalysis between the loxP sequence.The loxP sequence be 34 base pairs of Cre recombinase bonded trinucleotide repeat sequence and for the genetic recombination of Cre recombinase-mediated required.When the Cre recombinase existed, the cut or inversion (Abremski etc. (1984) J.Biol.Chem.259:1509-1514) of target sequence was inserted in the decision of the orientation of loxP sequence; The excision of catalysis target sequence when the loxP sequence is orientated the forward repetition, the inversion of catalysis target sequence when the loxP sequence is orientated reverse the repetition.Therefore, the genetic recombination of target sequence depends on the expression of Cre recombinase.The expression of recombinase can be regulated by promoter element, and described promotor is subjected to regulate control, tissue specificity for example, and the etap specificity, derivable or quenchable by adding reagent.The control of this adjusting will only be expressed the genetic recombination that causes target sequence in the cell that is subjected to the promoter element mediation at recombinase.Therefore, express the activation that to regulate the genetically modified expression of pathogenic mutation by the control recombinase.
The cre/loxP recombinase system is used to regulate the genetically modified expression requirement structure of pathogenic mutation contains coding Cre recombinase and the proteinic genetically modified transgenic animal of theme.Can provide and contain Cre recombinase and the genetically modified animal of restenosis pathogenic mutation by making up " two-fold " transgenic animal.The facilitated method that these animals are provided is to make two kinds to contain a kind of genetically modified animal mating separately.
Use the prokaryotic promoter sequence that similar condition transgenosis can be provided, require former nucleoprotein to express simultaneously in order to promote the described prokaryotic promoter sequence of genetically modified expression.The promotor of example and the corresponding former nucleoprotein of trans-activation be at United States Patent (USP) 4,833, provides in 080.In addition, can the genetically modified expression of inductive condition by similar gene therapy methods, the trans-activator of wherein will encoding, for example the proteinic gene of recombinase or protokaryon is delivered to tissue and makes as expressing in cell type-specific mode.By this method, transgenosis can keep silent to the Adulthood until by introducing trans-activation thing " unlatching ".
In the embodiment that exemplifies, by producing " transgenic nonhuman animal " of the present invention in the kind system that transgenosis is imported the non-human animal.Can be used for importing transgenosis the embryo target cell of different developmental phases.Etap according to the embryo target cell is used different methods.With general good health, good embryo's productive rate, good protokaryon visibility meter and good reproductive fitness select to be used for implementing the specific strain of any animal of the present invention in the embryo.In addition, haplotype is an important factor.For example, when producing transgenic mice, often use strain such as C57BL/6 or FVB strain (JacksonLaboratory, Bar Harbor, ME).Preferred strain is to have H-2b, and those of H-2d or H-2q haplotype are as C57BL/6 or DBA/1.They itself can be genetically modified to be used to implement strain of the present invention, and/or can be to reject thing (knockouts) (promptly obtaining from one or more Gene Partial or complete repressed animal).
In one embodiment, transgenic constructs is imported single stage embryo.Zygote is the best target of microinjection.In mouse, masculonucleus reach the about 20 microns size of diameter, but it allows the duplicate injection of 1-2pl dna solution.The target that zygote is used as transgenosis has a main advantage, and promptly the DNA that injects in most of situations will be incorporated into (Brinster etc. (1985) PNAS 82:4438-4442) in the host gene before the spilting of an egg first time.As a result, all transgenetic animal cells will carry the transgenosis of integration.This also will be reflected in the offspring that transgenosis effectively passes to the person of foundation (founder) usually, because 50% sexual cell will contain transgenosis.
Usually, the embryo's incubation in appropriate culture medium with fertilization occurs until protokaryon.Approximately at this moment, as described belowly will comprise genetically modified nucleotide sequence and import female or masculonucleus.In some species such as mouse, preferred masculonucleus.Most preferably before it is processed by the female proncleus of egg nucleus or zygote, exogenous genetic material is added to the male dna complement (complement) of zygote.Think that the release of egg nucleus or female proncleus influences the molecule of male dna complement, it may be by replacing the protamine of male dna with histone, and the combination that promotes female and male dna complement thus is to form diploid zygote.Therefore, preferably before it is subjected to thelyblastic the influence, exogenous genetic material added male dna complement or any other DNA complement.For example, as quickly as possible exogenous genetic material is added early stage masculonucleus after forming masculonucleus, at this moment masculonucleus separate well with female proncleus and all are positioned at nearly cytolemma.Alternatively, induced at it and carry out exogenous genetic material to be added sperm nucleus after the decondensation.The sperm that contains exogenous genetic material can add ovum then or the sperm of decondensation can be added ovum, adds transgenic constructs thereafter as quickly as possible.
As for example microinjection, electroporation or fat transfection can finish that the transgenosis nucleotide sequence is imported the embryo by any method known in the art.After the transgenosis nucleotide sequence is imported the embryo, the time that the embryo can external incubation different quantities, reimplantation is in alternate host, or the both carries out.Externally be incubated to maturation within the scope of the invention.Depend on species, a kind of ordinary method is with outer the about 1-7 of incubation days of embryoid body, then with their reimplantations in alternate host.
For the purposes of the present invention, zygote is the formation of diploid cell basically, and it can develop into complete biology.Usually zygote will be by containing by merging two haploid nucleuses from a gamete or a plurality of gametes, and the ovum of the nuclear of natural or artificial formation is formed.Therefore, gametic nucleus must be natural compatible gametic nucleus, promptly produces the viable gametic nucleus that can break up and develop into the zygote of functional biological.Usually, preferred euploid zygote.If obtain the euploid zygote, with respect to the euploid quantity of the biology of any one gamete origin, chromosomal quantity changes should be no more than one so.
Consider that except similar biology physics considers also to determine the quantity (for example volume) of exogenous genetic material, described exogenous genetic material can add the nuclear of zygote or can form the genetic material of the part of zygotonucleus.If do not remove genetic material, the amount of the exogenous genetic material that can add is subjected to and will be absorbed and the not quantitative limitation of physical damage so.Usually, the volume of the exogenous genetic material of insertion will be no more than about 10 skin liters.The physical influence that adds should the so big viability of consequently physically destroying zygote.Because the genetic material of the zygote that obtains, comprise that exogenous genetic material must biologically can initial sum keep the differentiation of zygote and develop into functional biological, the biology restriction of the value volume and range of product of dna sequence dna will change according to the function of concrete zygote and exogenous genetic material, and for those skilled in the art will be easily significantly.
The copy number that adds the transgenic constructs of zygote depends on the total amount of the exogenous genetic material of adding, and will be the amount that genetic transformation is taken place.Only need a copy in theory; Yet use many copies usually, for example 1,000-20, the transgenic constructs of 000 copy has function so that guarantee a copy.About the present invention, will be that each that advantageously have more than function copy inserted exogenous DNA array to strengthen the phenotypic expression of exogenous DNA array usually.
As long as it is pair cell not, the cell of nuclear membrane or other existence or genetic construction are destructive, can use to allow to add any technology of exogenous genetic material in the nuclear genetic material.Exogenous genetic material is preferably inserted the nuclear genetic material by micro-injection.Cell and cyto-architectural micro-injection are known and use in the art.
Use standard method to finish reimplantation.Usually, with alternate host anesthesia, the embryo is inserted uterine tube.The quantity of being transplanted to the embryo among the concrete host will change with species, but will be comparable to the species progeny size of natural production usually.
Can screen the genetically modified existence of transgenic progeny and/or the expression of alternate host by any proper method.Often use and genetically modified at least a portion complementary probe, finish screening by southern blotting technique or rna blot analysis.The method that can use utilization to exist as alternative or other screening transgene product at western blot analysis by the proteinic antibody of transgenes encoding.Typically, preparation DNA and from the tail tissue by southern blotting technique analysis or pcr analysis transgenosis.Alternatively, although any tissue or cell type can be used for this analysis, use southern blotting technique analysis or PCR check to think and exist and express so that the tissue of highest level express transgenic or cell are genetically modified.
Be used to assess the alternative or other method that transgenosis exists and unrestrictedly comprise suitable biochemical measurement such as enzyme and/or immunologic assay, at the histological stain of specific markers or enzymic activity, flow cytometry analysis etc.The analysis of blood also can be used for detecting the existence of blood transgene product, and the assessment transgenosis is to the influence of the level of various types of hemocytes and other blood ingredient.
By with transgenic animal and suitable spouse's mating, or in vitro fertilization by available from the ovum of transgenic animal and/or sperm, can obtain the offspring of transgenic animal.When carrying out with spouse's mating, the spouse is can yes or no genetically modified and/or reject thing; When it when being genetically modified, it can comprise identical or different transgenosis, or all contains.Alternatively, the spouse can be a female parent line.When using when in vitro fertilization, can be in alternate host or external incubation with the fertilization embryo transfer, or the both carries out.Use arbitrary method, use aforesaid method or other appropriate means can assess the genetically modified existence of offspring.
The transgenic animal that produce according to the present invention will comprise exogenous genetic material.In addition, in this embodiment, sequence will be attached to transcriptional control element for example on the promotor, and described promotor preferably allows express transgenic product in the cell of particular type.
Retroviral infection also can be used for transgenosis is imported the non-human animal.The non-human embryo who grows can vitro culture to blastocyst stage.During this period, can be the target (Jaenich, R. (1976) PNAS 73:1260-1264) that reverse transcription infects with the blastomere.Handle effective infection (Manipulating the Mouse Embryo, the Hogan eds. (ColdSpring Harbor Laboratory Press, Cold Spring Harbor, 1986) that the removal zona pellucida can obtain blastomere by enzyme.Be used to import retrovirus (Jahner etc. (1985) the PNAS 82:6927-6931 that genetically modified virus carrier system carries genetically modified replication defective typically; (1985) PNAS 82:6148-6152 such as Van der Putten).By on the cell monolayer of producing virus, cultivate blastomere obtain easily or effectively transfection (Van derPutten, above; Stewart etc. (1987) EMBO J.6:383-388).Alternatively, can infect in the later stage.Can or produce viral injection cell (Jahner etc. (1982) Nature 298:623-628) in segmentation cavity with virus.Take place in the cell subsets that forms the transgenic nonhuman animal because only integrate, the great majority person of foundation will be genetically modified mosaic.In addition, the person of foundation can comprise genetically modified miscellaneous retroviruses at genomic different positions and insert, and it will separate in the offspring usually.In addition, can also transgenosis be imported kind of system's (Jahner etc. (1982) above) by the conceived interval embryo of intrauterine retroviral infection.
The target cell that the 3rd class is used for the transgenosis importing is embryonic stem cell (ES).Embryo (Evans etc. (1981) Nature 292:154-156 before the transplanting that the ES cell merges available from vitro culture with the embryo; Bradley etc. (1984) Nature 309:255-258; Gossler etc. (1986) PNAS 83:9065-9069; With (1986) Nature 322:445-448 such as Robertson).Transgenosis can be imported the ES cell effectively by DNA transfection or the transduction by retrovirus-mediated method.After this ES cell of this conversion can combine with the blastocyst from the non-human animal.After this ES cell transplants (colonize) embryo, and helps the kind system of the chimaeric animals that obtains.About summarizing referring to Jaenisch R. (1988) Science 240:1468-1474.
Further illustrate the present invention by the following example, it is restrictive by any way that described embodiment should not be considered to.The content of the reference of all references (comprise and run through the bibliographic reference that the application quotes, the patent of mandate, disclosed patent application) is hereby expressly incorporated by reference especially.Unless otherwise indicated, enforcement of the present invention will be used the routine techniques in the present technique field.These technology are fully explained in the literature.Referring to for example Molecular Cloning A Laboratory Manual, (second edition, Sambrook, Fritsch and Maniatis, editor., Cold Spring Harbor LaboratoryPress:1989); DNA Cloning, volume I and II (D.N.Glover edits., 1985); Oligonucleotide Synthesis (M.J.Gait edits., 1984); U.S. patent 4,683, and 195; U.S. patent 4,683, and 202; With Nucleic Acid Hybridization (B.D.Hames﹠amp; S.J.Higgins edits., 1984).
5. embodiment
5.1. The analysis of molecules of IL-1B (3737) polymorphism
In the present embodiment, our clone checks order and has analyzed the influence of the previous unknown upstream polymorphism of IL-1B gene to the equipotential genetic transcription.We had before shown the height linkage disequilibrium between the mark that runs through the IL-1 gene cluster, this new polymorphism of-3737 with previous with the throughput rate of the IL-1 β that changes and chain to the polymorphism of the susceptibility of inflammatory and transmissible disease relevant-511 ,-31 and+3954.The genotype of determining the functional polymorphisms that this is new provides the more direct heredity test that IL-1 production is wherein helped the susceptibility of pathogenetic disease.
We study the not homoallelic transcriptional activity of interleukin 1 B (IL-1B) gene.This be concerned about, because in the population of Northern Europe, IL 1B allelotrope state is relevant with many chronic inflammatory diseases, described inflammatory diseases comprises periodontitis (Kornman, K.S. etc. (1999), J.PeriodontalRes.34:353), and cancer of the stomach (El-Omar, E. etc. (2000), Nature 404:398).
It is important illustrating the molecular mechanism that constitutes these contacts, because it can the appropriate design intervention regulate pathologic process, and will improve the performance that prognosis heredity is tested.The linkage disequilibrium widely that runs through the IL1 gene cluster is (referring to Cox, A. etc. (1998) Am.J.Hum.Genet.62:1180) can make current known ' mark ' polymorphism and itself chain with lysis causal correlation other (' polymorphism of causing a disease ').Linkage degree between ' mark ' and ' causing a disease ' polymorphism, it can change between the race, will be to use the important determinative of global performance of the heredity test of ' mark ' polymorphism.The effectiveness of the reduction that this situation can be explained commercially available ' PST test ' beyond the population of Northern Europe, Kornman, K.S. etc. (1999), J.Periodontal Res.34:353; Armitage, G.C. etc. (2000), J.Periodontol 71:164.
The function IL-1 SNP that identify to be responsible for susceptibility that chronic inflammatory disease (comprising cardiovascular diseases, periodontitis and cancer of the stomach) is increased for appropriate design intervention to regulate these pathogenic courses and improve prognosis heredity test be critical.Our research is that the influence that polymorphism is transcribed IL1B is studied in design.El-Omar and colleague are (referring to El-Omar, E. etc. (2000), Nature 404:398) relation between description IL1B-31 (TATA frame) polymorphism and the cancer of the stomach, what prompting changed may be responsible for IL1B gene transcription difference with TATA box bonded transcription factor, may get in touch (cancer of the stomach) causal correlation with the disease that they observe.Do not occur yet transcribe in the article that is determined at them.Transcriptional activity and (3737) IL-1B polymorphism of the SNP of current known IL-1B studied in this research.
We measure transcription rate (nuclear running) mensuration that IL1B mRNA extends.These experiments are to carry out on external peripheral blood lymphocytes (PBMC).Stimulate white corpuscle with LPS 1 μ g/ml, prepare nuclear extract after 2 hours.From a plurality of individualities that the different genotype that runs through IL1B bunch based on them is selected, extract cell.
Study each individuality 3 opportunitys of separating, and the average transcriptional activity of each individual calculating.This experimental design studies+influence of 3953 IL1B polymorphisms; It is relevant with this polymorphism not observe the active significant difference of IL1B.Yet when reanalysing data with research the influencing of-511 polymorphisms, allele specific oligonucleotide transcriptional differences is significantly (referring to Fig. 2).
The data of Fig. 2 support IL1B to transcribe and-511 polymorphism states between contact.They do not get rid of other, the contribution of chain polymorphism.Data set may too little so that not allow reanalysing (referring to Cox of haplotype, A. etc. (1998), Am.J.Hum.Genet.62:1180), although reported haplotype rather than individual polymorphism and several disease-related, described disease comprises rheumatoid arthritis, inflammatory bowel disease seriousness, and tuberculosis is (referring to for example Cox, A. etc. (1998), Am.J.Hum.Genet.62:1180; Wilkinson, R.J. etc. (1999), J.Exp.Med.189:1863; Heresbach, D. etc. (1997), Am.J.Gastroenterol.92:1164; Cox, A. etc. (1999), Hum.Mol.Genet.8:1707).
The IL1B promoter structure
The IL1B promotor is wide structure, extends the sub-upstream of transcription initiation 4kb at least.Below illustrate (Fig. 3) with graphics.Early stage several the researchs nineties in 20th century are by its function of mutagenesis research.This strategy is similar and by promoter fragment and reporter gene are connected to form in all scenario.Exons 1 be non-coding and ATG be arranged in exon 2; NcoI restriction site (CCATGG) comprises first codon, allows to keep exons 1 and natural splicing signal with the method for being easy to reporter gene substitute I L1B encoding sequence.
These studies have shown that the existence of two main promoter regions, and-proximal promoter extends to pact-1000bp and far-end promotor from+547 (ATG), and it is positioned at zone-4000 to-2757 (Fig. 2).This far-end promotor be meant widely ' enhanser ' in the document (as Bensi, G. etc. (1990), CellGrowth Differ.1:491; Clark, [Error pf publication appears at NucleicAcids Res 1987 to B.D. etc. (1986), January 26; 15 (2): 868], Nucleic Acids Res.14:7897; Cogswell, J.P. etc. (1994), J.Immunol.153:712; Shirakawa, F. etc. (1993), Mol.Cell Biol.13:1332 is not although also determine directed independence with experiment.
Proximal promoter
Proximal promoter comprises a plurality of possible transcription factor binding site points; The element of similar NF-kB be presented at experimentally be important (referring to Hiscott, J. etc. (1993), Mol.Cell Biol.13:6231; Monks, B.G. etc. (1994), Mol.Immunol.31:139; Zhang, Y. and Rom, W.N. (1993), Mol.Cell Biol.13:3831; Krauer, K.G. etc. (1998), Virology 252:418; Tsukada, J. etc. (1997), Blood 90:3142, NF-IL6 (C/EBP), Shirakawa, F. etc. (1993), Mol.Cell Biol.13:1332; Zhang, Y. and Rom, W.N. (1993), Mol.CellBiol.13:3831; Godambe, S.A. etc. (1994), J.Immunol.153:143; Godambe, S.A. etc. (1994), the element of DNA Cell Biol.13:561 and similar PU-1, Buras, J.A. etc. (1995), [Error pf publication comes across Mol Immunol 1995 Oct; 32 (14-15): 1175], Mol.Immunol.32:541; Kominato, Y. etc. (1995), Mol.Cell Biol.15:59; Lodie, T.A. etc. (1997), J.Immunol.158:1848; Wara-aswapati, N. etc. (1999), Mol.CellBiol.19:6803).
The far-end promotor
The far-end promotor is made up of (referring to Bensi nucleus (2982 →-2729), G. etc. (1990), Cell Growth Differ.1:491), it comprises a plurality of transcription factor binding site points (referring to Shirakawa, F. etc. (1993), Mol.Cell Biol.13:1332).This zone is that the LPS or the PMA of IL1B gene in the monocyte induces required (Bensi, G. etc. (1990), Cell Growth Differ.1:491; Shirakawa, F. etc. (1993), Mol.Cell Biol.13:1332).-2982 →-2729 the zone in C/EBP and the NF-kB binding site experimentally the demonstration be function important (referring to Cogswell, J.P. etc. (1994), J.Immunol.153:712; Shirakawa, F. etc. (1993), Mol.Cell Biol.13:1332; Gray, J.G. etc. (1993), Mol.Cell Biol.13:6678).Activity (Cogswell, J.P. etc. (1994), the J.Immunol.153:712 of the whole far-end promoter region of about 60-70% is responsible in weak point-2982 →-2729 zones of deletion mutagenesis demonstration far-end promotor; Shirakawa; F. etc. (1993), Mol.Cell Biol.13:1332), be responsible for the sequence in-3753 to-2982 zones of residue about 30% and also do not determine.
Following experiment is touched upon: whether allele specific oligonucleotide transcriptional differences shown in top can prove by the operation report gene construct; Whether-31 or-511 polymorphisms can show and the transcriptional differences causal correlation; Whether can find that other polymorphism is relevant with transcriptional differences.Think that these existence of regulating polymorphisms in institute's survey region do not get rid of other chain existence that is positioned at the outer polymorphism relevant with physiological regulation of survey region.
Method
The clay that contains IL1B
This clay pCOS-IL1 Bus1 is provided by our breadboard doctor M.Nicklin.It is to be separated by hybridization from the EMBL genome dna library in 1993 by doctor Nicklin.The ethnic group source of individuality that is used to make up this library is unknown.Restriction endonuclease map is provided by doctor Nicklin.It is transformed into DH5 α intestinal bacteria and remains on the kantlex 50 μ g/ml LB agar plates.Containing the 2xYT substratum of 5 μ g/ml kantlex, 20ml increasing under 37 ℃ from single bacterium colony.
Derive from the reporter gene construct of the clay that contains IL1B
Make up a series of these plasmids.Preliminary experiment shows the transfection experiment that carrier pGL3-fundamental mode (basic) rather than pGL3-enhanser (both are from Promega) are suitable for planning.At first, with NcoI and BamHI cut vector pGL3-fundamental mode, the NcoI-BamHI fragment connection from the clay pCOS-IL1 BusI that contains near-end IL1B promotor (1815 →+547) produces plasmid pILG-A1.Prepare second plasmid subsequently, it also comprises the far-end promotor.This is to make up by being connected in the pILG-A1 carrier of cutting to-1815 with Asp718I and HindIII digestion clay pCOS-IL1 Bus1 and pILG-A1 with far-end promotor-4000, produces pILG-S1.Utilize single internal limitations site digestion pILG-S1 and pILG-A1, then fill up with the Klenow archaeal dna polymerase, intramolecularly reconnects the deletion mutant that is used to produce a series of IL1B promotors.So the plasmid that produces shows in following table 1.
Table 1: the plasmid that is derived from clay pCOS-IL1 Bus1
Plasmid Insert fragment Used restriction enzyme The source plasmid
pILG-S1 -4200→+547 Asp718-HindIII， HindIII-NcoI pCOS-IL1Bus1， pILG-A1
pILG-T1 -2729→+547 Asp718I，XhoI pILG-S1
pILG-A1 -1815→+547 BamHI-NcoI PCOS-IL1Bus1, the PGL3-fundamental mode
pILG-E1 -1604→+547 NheI+EcoRV pILG-A1
pILG-F1 -1063→+547 SmaI pILG-A1
pILG-G1 -548→+547 BstXI+NheI pILG-A1
pILG-H1 -516→+547 SacI pILG-A1
pILG-J1 -131→+547 NheI+HindIII pILG-A1
The PGL3-fundamental mode Do not have Do not have Promega
The mutagenesis of IL1B promotor
On clone S1, carry out double-stranded automatic sequencing.Use the sequence information that obtains, and design oligonucleotides change-511 and-31 residues (referring to El-Omar, E. etc. (2000), Nature 404:398; With di Giovine, F.S. etc. (1992) Hum.Mol.Genet.1:450) are alternative base.These oligonucleotide are called as ' 31 probe 1 ' and ' 511 probes 1 '.The sequence of these oligonucleotide shows (underlining) below in Fig. 1.According to the recommendation of manufacturers, use GeneEditor system (Promega) that they are used for mutagenesis pILG-A1 plasmid.Use oligonucleotide individually and together so that generation-31 and all possible combination of-511 states.Confirm successful mutagenesis and lack second sudden change by the double-stranded DNA order-checking.
The pILG-A1 derivative only comprises IL1B promotor-1815 →+547 fragments, therefore contain these with Asp718I and XmaI (SmaI) digestion and insert segmental carrier, the pILG-S1 Asp718I → XmaI fragment that contains 2 type far-end promotors is connected on proximal promoter of sudden change.The promotor that obtains shows in following table 2.
Table 2 mutant 2IL1B promotor--31 and the genotype of-511 site mutation
-1815→+547 -4000→+547 -31 genotype -511 genotype
pILG-A1 pILG-S1 2 2
pILG-V1 pILG-AA1 1 2
pILG-W1 pILG-AC1 2 1
pILG-X1 pILG-AE1 1 1
From human blood and clone, extract DNA, and gene type
This is to use Gentra PureGene blood test kit to carry out according to the recommendation of manufacturers.Be resuspended in DNA in the 50 μ l TE damping fluids and be kept at-20 ℃.Recommend culturing cell system as ATCC, as follows: HL60, A549 cell, U937, MonoMac6, EHEB-1.All these clones are Caucasia blood lineages.Extract 1x10 7Individual cell.From a people volunteer's PBMC, extract DNA.The unique people volunteer who uses, Ken doctor Kornman (R﹠amp; D is responsible for, interleukin-heredity company) him is provided the Informed Consent Form to experiment.The genotype of clone is as discussed previously to be measured by the TaqMan method.The genotype that obtains is displayed in Table 3.
The genotype of the used clone of table 3
Clone -2018?IL1A -511?IL1B
KK?PBMC?DNA 1.2 2.2
EHEB-1 1.2 1.1
MonoMac6 2.2 1.2
U937 Undetermined 1.1
A549 1.1 2.2
HL60 1.1 1.2
The PCR clone of people IL1B promotor
Optimize the condition that is used for PCR human cloning IL1B promotor.Research is check and correction enzyme (Pfu and Pfx) separately, but only observe check and correction/Taq combination product is arranged.The final condition of using is the Trioblock temperature cycler, thin-walled tube, oil, 25 μ l reactants, 500pg template, 200nM dNTPs, 1mM primer I LG-9 and ILG-18, the 1xHerculase polymerase buffer that manufacturers (Stratagene) provides.Herculase is the mixture of Pfu-turbo and Taq archaeal dna polymerase.It is as follows to circulate: 94 ℃ 2 minutes, use 0.5 μ l Herculase polysaccharase heat initial then, 30 circulations then (94 ℃ 30 seconds, 66 ℃ 30 seconds, 72 ℃ 6 minutes).Product is diluted to 50 μ l, uses according to the scheme (Clontech) of manufacturer and use Chromospin 200 gel-filtration columns to remove polysaccharase and damping fluid.With following enzymic digestion eluted product: 10U Asp718I, 0.02U NcoI.This realizes the part digestion in inner and 3 ' NcoI site.Be connected to the pGL3-fundamental mode carrier of Asp718I-NcoI digestion with the hot deactivation of mixture and with adequate rate, and be transformed into library efficient DH5 α cell (LifeTechnologies).By at the PCR of far-end enhanser screening and/or by restriction enzyme Molecular Identification positive colony.
Obtain every kind of genotypic at least two clones from each template.These clones are from the reaction of PCR fully independently, even it is early stage therefore to occur in the PCR round-robin, the PCR sudden change can based on they in a plurality of strain isolateds existence and distinguish over polymorphism.
In the LB substratum, cultivate plasmid.For a large amount of preparations, use the 150ml culture.And be stored in and do not contain endotoxic TE damping fluid (Qiagen) and pipe (Cryovials, the plasmid of being useful on transcription analysis is carried out ElutioPlasmid to be prepared in a large number, and use Qiagen not contain endotoxic a large amount of preparation system, recommend as manufacturer, except not containing in the endotoxic disposable centrifuge tube at 50ml 3, carry out last isopropanol precipitating step under the 500rpm in the outward opening tissue culture whizzer of Sanyo, this method produces fabulous precipitation.Nalgene)。Under at least two opportunitys, quantitatively confirm by UV spectrophotometry concentration and by restriction enzyme analysis and gel.
Polymorphism is identified
Separating clone also uses one group of inside primer for this purpose design to check order by automatic sequencing.(ABI) assess and have＞2% blur level if call algorithm (base calling algorithm) with the Factura base, sequence is not accepted.After with Factura 1.1 blur level marks, the sequence track is assembled into single contig by one step completed AutoAssembler 2.1 (ABI).Carrying out bad zone and the base of edit assembling calls.The contig of acquisition and the color atlas of note are attached on the CD.Use default parameter to calculate consensus sequence by automatic assembler, use from Http:// www.ncbi.nlm.nih.govThe sequence that executable Genetyx-Mac 7.3 of free-standing Mac (Software Development Corp.) that obtains and/or ClustalX contrast and inspection obtain.In the contrast sequence, search for polymorphism by visual inspection, and think that be discrepant in more than a sequence between the sequence that same position occurs.Single base pair difference of finding in sequence only is considered to may sudden change of PCR inductive and same mark.
Clone
In the RPMI1640 that contains penbritin-Streptomycin sulphate and 10% heat-inactivated foetal calf serum, cultivate RAW264.7 cell (ECACC 91062702).Use low endotoxin (＜10mIU/ml) serum (Life Technologies).By every 3-4 days scraping 1: 6 (area: isolated cell area).
Transfection and transcribe mensuration
Will be at the RAW264.7 cell in the 100 μ l perfect mediums with 2.5x10 4The density shop of cells/well is to 96 hole flat boards.After 24 hours with 400ng drive expression vector that Photinus pyralis LUC expresses and 100ng drive pTK-rLuc (Promega) transfection that the Renilla luciferase expresses under constitutive promoter they.This scheme according to manufacturers uses 2.5 μ l Superfect (Qiagen) to carry out.Back 2.5 hours of adding with substratum/DNA/ liposome mixture sucking-off and replace with the pre-heated perfect medium of 150 μ l.Thereafter 24 hours, add agonist, carry out two kinds of uciferase activities (Dual-Luciferase, mensuration Promega) after 6 hours at the adding agonist.Standardized uciferase activity is expressed as Lampyridea/renilla luciferase light and produces.
﹠amp as a result; Discuss
The clone of RAW cell-be suitable for ILIB research
The RAW264 cell is used in this research, the clone of the similar scavenger cell of differentiation, and it had before shown it is the model that is suitable for studying the IL1B promotor.Shirakawa, F. etc. (1993), Mol.Cell Biol.13:1332.The result shows that the far-end promotor is essential (seeing figure) for effectively inducing the IL1B promotor that imports plasmid.
-31 or the sudden change of-511 polymorphisms to the influence of 2 type promotors
The polymorphism that has proposed-31 TATA boxes of IL1B promotor is responsible for the transcriptional differences between allelotrope and the pathological effect (referring to El-Omar, E. etc. (2000), Nature 404:398) of consequential and IL1B phenotypic correlation.For several other genes are verified should mechanism (referring to for example Antonarakis, S.E. etc. (1984), Proc.Natl.Acad.Sci.USA 81:1154; Humphries, A. etc. (1999), Blood Cells Mol.Dis.25:210; Peltoketo, H. etc. (1994), Genomics 23:250; Takihara, Y. etc. (1986), Blood 67:547).Described in method, by site-directed mutagenesis sudden change-511 promoter constructs available from genome dna library, with obtain to have-31 and-511 position polymorphisms the 2 type constructs that might make up.Should distinguish that by this technology independent or combination is attributable to the transcriptional activity of these polymorphisms.Wherein 1 type promotor has the data complement (referring to Fig. 4) of 2 type promotors of the opposite experiment in these sites of sudden change and demonstration.
Fig. 4 shows 3 representational experiments carrying out, and wherein none is observed and-31 or-511 relevant transcriptional differences of allelotrope state.Leftward in the picture, for mutant strain (31=2 ,-511=2) and wild-type (31=1 ,-511=1) promotor show the LPS concentration used and the dose-response relationship between the promotor reaction.The equivalence of transcribing between two promotors under the concentration of all tests is tangible.
The allelic clone of the IL1B of different sources
Use the long range PCR IL1B promotor that increases.This requires to optimize, but realizes specific amplification.The trial of the initial check and correction of use separately polysaccharase is unsuccessful (referring to Fig. 5).In order to clone product, with Asp718I and NcoI digestion PCR product and be connected in the reporter gene carrier pGL3-fundamental mode.Independently cloning process of sequence is not used in decision, because extremely low and do not have selective system to come the positive fragment of selecting to insert from these productive rate.This has the accidental sudden change (oddmutation) that helps in the disadvantageous sequence, and is difficult to control.
Obtain the clone by PCR
Although obtain product from all tried pcr templates, the clone is only with certain proportion (in aproportion) success.Obtain two independently reactions from the product of KK template and EHEB-1 template; Obtain one from MonoMac6 DNA.From clone of each reaction picking.Table 4 shows the clone who obtains.In a word, there are two 1 type clones (both is from EHEB-1 clone), two 2 types clones that derive from KK DNA, 2 a types clone from MonoMac6 DNA.
The genomic clone that table 4 obtains by the PCR clone
Source PCR-1 PCR-2
Ken K 2,2 AN1 should clone also with-31 AM1 of place-511
Do not check order in genotype=2
MonoMac6 1,2 AI3 genotype
-511＝2，-31＝2
AI13 is measuring ability not also
Eheb1 1,1 AJ2 1 type AT1 1 type
Clay 2 S1 genotype=2
The assessment of the transcriptional differences between-511 1 types and the 2 type promotors
With above-mentioned construct transfection RAW264 cell, measure transcriptional activity later at the lipopolysaccharides that adds various dose.Attempt two kinds of preparation-commercial formulation and highly purified preparation, the latter is the present of Dr S.Vogel.Obtain similar result with two kinds of preparations in morning in the experiment, and in these experiments, only use the preparation of height repurity with pILG-S1 and its mutant.Carrying out 3 groups tests and studies that IL1B is allelic to transcribe.All 3 times experiments show the difference between 1 type and the 2 type promoter activities.
Fig. 6 shows one of three experiments.With isoallele transfection hole not.Three holes of each promotor transfection.The transfection mixture in each hole is provided with separately.The left hand picture shows the transcriptional activity in each hole when with 300pg/ml LPS irritation cell.Compare with 2 type promotors, 1 type is observed the transcriptional activity of increase.1 type than the difference of the geometrical mean of 2 type promotors be significantly different (P＜0.01, Kruskall-Wallis).Right figure only shows that this phenomenon is obvious when low dosage LPS.This figure shows the mean value in three parts hole of three transfections under each dosage.Error bar does not show (for clear) but deviation is put about 15-20% of mean value for each.The difference that (at 6 hours, this tested used time point) shows under low dosage under higher dosage is not obvious.
In second experiment (Fig. 7), check the relation between dosage and the genotype in more detail.Only pILG-AJ2 (2 types are from KK) and pILG-AM1 (1 type is from EHEB-1) (referring to Fig. 6) are cloned in check.The result shows and the identical pattern of above-mentioned experiment.Particularly, the plasmid that contains new IL-1B (3737) polymorphism is showing 2-3 difference doubly aspect the transcription rate between allelotrope 1 and allelotrope 2, and allelotrope 1 is relevant with higher transcription rate.This influence is remarkable under LPS dosage＜10ng/ml.Confirm the differences affects of promoter activity by the allelic specific mutant of new SNP.Therefore as if this new IL-1B (3737) polymorphism in enhanser zone, the far upstream of IL-1B gene causes the function difference of transcribing that LPS is replied.
In the 3rd experiment (Fig. 8), as the relation between the difference of minute and observation, check dose-response relationship once more.In this experiment, between AM1 and AJ2 (1 type and 2 types) clone, also there are differences, but the shape of dose response curve is slightly different.The reason of this difference is unclear.All experiments are carried out in mode identical on the surface, but possibility technological disparity may change cell behavior as accurate cell density.
Figure below of Fig. 8 shows sample time to the influence 6 hours observed difference, and 6 hours is the time of using in other experiment at all.Time is not the determinative of viewed difference.With the parallel adding control wells of carrier: the (not shown) of inducing of in these experiments, not observing reporter gene.In a word, experimental results show that and exist in evincible clear and transcriptional activity difference (1 type＞2 types) repeatably in all experiments of carrying out.
Clone's Ce Xu ﹠amp; The assessment of the function potentiality of new polymorphism
The function difference that arrives according to the observation checks order the genomic clone that obtains and analysis described in method.Detect 5 polymorphisms; 2 is known, and is-31 and-511 polymorphisms.3 is new.
By BLSAT search ( Http:// www.ncbi.nlm.nih.gov/blast), the genome of the about 20bp upstream and downstream of polymorphism that these are new and nonredundancy people DNA database are relatively.Use be positioned at ( Http:// transfac.gbfbraunschweig.de/TRANSFAC/index.html) the information biology server use TRANSFAC 4.0 databases in same clip, to search for to transcribe binding site.
Used sequence is represented below:
For in-3737 polymorphism:
5’TCTAGACCAGGGAGGAGAATGGAATGT( C/T)CCTTGGACTCTGCATGT?3’
Shown in sequence cross over-3737 C/T polymorphism in the IL-1B promotor.Allelotrope 1 is C, and allelotrope 2 is T.
For in-1469 polymorphism:
5’ACAGAGGCTCACTCCCTTG( C/T)ATAATGCAGAGCGAGCACGATACCTGG3’
Shown in sequence cross over-1469 C/T polymorphism in the IL-1B promotor.Allelotrope 1 is C, and allelotrope 2 is T.
For in-999 polymorphism:
5’GATCGTGCCACTgcACTCCAGCCTGGGCGACAG( G/C)GTGAGACTCTGTCTC?3’
Shown in sequence cross over-999 G/C polymorphism in the IL-1B promotor.Allelotrope 1 is G, and allelotrope 2 is C.
Only discovery-3737 and-1469 fragments in people IL-1B gene.Find-999 fragments in＞200 genes, pointing out it is the part of repeat element.In-999 repeat element, do not identify the transcription factor binding site point, but other two fragments all contain the consensus sequence at short scorching transcription factor.-3737 polymorphisms are in the total binding sequence of NF-kB, and the-the 1469th, in the total binding sequence of NF-IL6 (C/EBP).In two kinds of situations, contrast with minus strand.Show the output of search engine.The code on the left side is connected with the Transfac clauses and subclauses.The goodness of the probability reflection coupling that shows uses two kinds of algorithms of different to calculate, and represents good coupling.
-3737 5’TCTAGACCAGGGAGGAGAATGGAATGT( C/T)CCTTGGACTCTGCATGT?3’
The initial P1 P2 of matrix code
V$NFKB_Q6 |19(-)|1.000|0.927| aaGG GAcattccat-1469?5’
ACAGAGGCTCACTCCCTTG(C/T)ATAATGCAGAGCGAGCACGATACCTGG?3’
The initial P1 P2 of matrix code
V$CEBP_C |11(-)|0.992|0.901|tgcattat GCAAGggagt
V$CEBPB_01 |14(-)|1.000|0.967|gcattat GCAAggg
The result sums up in following table 5.
The polymorphism that table 5 detects by this clone/order-checking scheme
The SN polymorphism Relevant with-511 and transcribe mensuration Find that transcription factor is in conjunction with consensus sequence
-31 Be TATA
-511 Be Do not have
-999 Not Do not have
-1469 Not C/EBP/NF-IL6 family
-3737 Be NF-κ B family
Conclusion
The previous unknown candidate NF-kB binding site of-3737 polymorphic positions in the far-end promoter region, described far-end promotor had before shown by mutagenesis is responsible for whole promotor up to 30% activity.When being placed on the upstream of reporter gene, the not isoallele with this promotor finds repeatably and significant difference.Run through this regional linkage disequilibrium and produce haplotype, have previously known at-31 and-511 SNP, it shows in these experiments detectablely independently influences transcribing of reporter gene is no.The result proof disease relevant with these near-end upstream polymorphisms can not mechanically explain by the changing function that they cause itself by these polymorphisms, and-3737 polymorphisms of they and the newfound change function in the far-end upstream promoter are chain to be more possible explanation.
Experimental summary
1.RAW264.7 the cell of class scavenger cell is to the fragment reaction of people I-L1B promotor.Maximum reactivity need comprise the segmental fragment of Asp718I (4000) → NcoI (+547).This result meets the data of announcement.
2. by can clone people this zone of IL1B promotor of long range PCR.
3. use Caucasian blood lineage's DNA to be template, from independently obtaining allelic two allelotrope of 1 type (-511) IL-1B and three 2 types (at-511 places) allelotrope in the PCR experiment.
4. these clones' transcription analysis is presented at the statistically-significant difference of inducing the back transcription rate with LPS.In all experiments of carrying out, all find these differences.
5.IL-1B the LPS of promotor induces different between transfection and transfection aspect the dose-response relationship.Its reason is not clear.In some experiments, obviously, the about 2-3 of transcription rate difference between 1 type and the 2 type allelotrope doubly at this moment under the LPS dosage of inferior maximum (submaximal) for the difference between 1 type and the 2 type allelotrope.
6. do not influence the transcriptional activity of promotor in-31 and-511 the allelic mutagenesis of 2 types.
7.1 the transcriptional differences between type and the 2 type promotors therefore should be since except find so far those polymorphism cause.The clone's who obtains automatic double-stranded order-checking is so that identify unknown polymorphism.
8. polymorphism is defined as the variation that the same position in the difference clone occurs.Observed single base pair changes and is considered to the sudden change of PCR inductive in clone only.In this segment DNA (IL-1BAsp718I (4000) → NcoI (+547)) sequence, detect 5 polymorphisms.2 polymorphisms-511 and-31 are known, also do not describe in the literature for other 3.
Single nucleotide polymorphism Relevant with-511 and transcribe mensuration Find that transcription factor is in conjunction with consensus sequence
-31 Be The TATA box
-511 Be Do not have
-999 Not Do not have
-1469 Not C/EBP/NF-IL6 family
-3737 Be NF-kB family
9. the previous unknown candidate NF-kB binding site of-3737 polymorphic positions in the far-end promoter region, described far-end promotor had before shown by mutagenesis is responsible for promotor up to 30% activity.
5.2 IL-1B (3737) polymorphism is relevant with the periodontitis of Chinese population
Although some IL-1 gene pleiomorphism as IL-1A (+4845) and IL-1B (+3954), is associated with the seriousness of periodontopathy among the Caucasian, they comprise among the Chinese some populations once in a while finds.Before also do not study new single nucleotide polymorphism (SNP) in this respect, had the IL-1B (3737) in the enhanser zone, upstream far away of IL-1b gene.Especially, the allelotrope 1 of IL-1B (3737) polymorphism has shown increases transcription rate (referring to more than).In this research, we assess the dependency that the genotypic population of IL-1B (3737) distributes and determines the disease in the hereditary individuality of it and Chinese.
Method
Carry out the gene type of IL-1B (3737) and other IL-1 SNP by the TaqMan method.The distribution of assessment IL-1B (3737) in the Caucasian colony of 500 adults' (age 27-77 year) unknown periodontopathy state and in 300 Chinese's heredity individual (age 21-69 year).If their breeder mother and father grand parents and great grand-parent are to come from the China's Mainland, Taiwan, Macao or Hong Kong, the experimenter is considered to Chinese's heredity.In order to be included in this research, the experimenter must be in good health and be had at least 14 natural teeth.Determine the related of IL-1B in the Chinese population (3737) and periodontopathy by the method for multivariate Logic Regression Models.
The result
IL-1B (3737) genotype distributes as shown in the table:
The IL-1B3 genotype Caucasian % (N) Chinese % (N)
1.1 ?30.2(151) 22.3(67)
1.2 ?49.0(245) 54.0(162)
2.2 ?20.8(104) 23.7(71)
In the Caucasian, carrying low open gene type, among the experimenter of IL-1B (3737)=2.2 (n=97), 88.3% for compound IL-1 genotype (PST
Figure GSA00000080605300651
) also bear described compound IL-1 genotype (PST
Figure GSA00000080605300652
) be included in the allelotrope 2 that IL-1A (+4845) and IL-1B (+3954) locate.In compound IL-1 genotype was positive experimenter ((n=201)), 94% located to carry allelotrope 1 at IL-1B (3737), and height is transcribed allelotrope.In non-smoker's Chinese experimenter (n=163), IL-1B (3737) genotype and disease significant correlation (OR=3.027; 95%CI:1.139-8.046; The risk that p=0.026), increase is arranged in carrying those of high open gene type 1.1.
Conclusion
In the Caucasian, great majority are positive individuality for IL-1B (3737) genotype of newfound increase transcription rate for just for compound IL-1 genotype.Find that IL-1B (3737) gene pleiomorphism frequently occurs in Chinese, genotypic be distributed among Chinese and the Caucasian similar.In Chinese's individuality, high open gene type of IL-1B (3737) and periodontopathy significant correlation.
5.3. NF-κ B and-3737 and other functional polymorphisms bonded Biacore binding analysis
The interactional dynamic analysis of p50 homodimer and DNA
Use BIAcore research NF-κ B p50 in conjunction with to obtain protein and the interactional kinetic parameter of DNA substrate (substrate) attached to the streptavidin sensor chip.Duplex 1 contains total NF-κ B binding site, and duplex 2 and 3 is different from the single nucleotide polymorphism (referring to table 6) in the consensus sequence.Protein with various concentration under low-salt conditions (75mM NaCl) and high salt concentration (150mM NaCl) passes through sensor chip surface.Hart, wait ((1999) NucleicAcids Res.27,1063-1069).The previous salt concn that shown influences the avidity and the specificity of DNA identification.In Fig. 9 A, be presented at combining of NF-κ B p50 and DNA substrate under the low salt concn.Fig. 9 shows combining of NF-κ B p50 homodimer and DNA substrate.(A) be presented at NF-κ B p50 (17.5nM) and different duplex DNA substrate bonded sensing figure (sensorgram) under the 75mMNaCl.(B) be presented at NF-κ B p50 (17.5nM) and different duplex DNA substrate bonded sensing figure under the 150mM NaCl.In conjunction with whole 3 DNA substrates are observed, yet can be clear that dissociation rate constant (gradient of dissociating) is different 3 species complexs from sensing figure.Calculate the association and the rate constant of dissociating from the association of sensing figure and the stage of dissociating respectively, and expression in table 7.These results show that NF-κ B p50 is with similar 1-5X10 6(M -1s -1) the association rate constant of the order of magnitude and different DNA substrate combinations.Yet the dissociation rate constant of various DNA-protein complexes is significantly different.The total dna complex (duplex 1) of NF-κ B p50-has minimum dissociation rate constant (the most stable complex body).Use experiment k aAnd k dValue calculated equilibrium dissociation constant and expression in table 7.Show that NF-κ B p50 combines (under the salt of 75mM) with its consensus sequence with the avidity of 15pM, this meets previous SPR analysis (Hart etc., 1999), and the avidity of duplex 2 is 130pM, and duplex 3 is 2000pM.
Repeating SPR then under the higher salt concn of similar more physiological conditions (0.15M NaCl) analyzes.Being combined among Fig. 9 B of NF-κ B p50 and DNA substrate shows.Result's demonstration is not observed under these conditions with duplex 3 and is combined.In addition, but duplex 1 and 2 shows similar association the different kinetics of dissociating, and compares with the combination under 75mM NaCl, and protein combines the level of (as finding by the level of reacting) with duplex 2 much lower.The bonded dynamics data is displayed in Table 7 under 150mM NaCl.The result shows similar association rate constant once more, but remarkable different dissociation rate constant.Compare with the speed under 75mM NaCl, higher for the dissociation rate constant of two kinds of protein-dna complexs, be presented at the stability that complex body reduces under the higher salt concentrations.In addition, and comparing than 4 times of differences seeing under the low salt concn, there are 36 times of differences now in the dissociation rate constant of duplex 1/2-NF-κ Bp50 complex body.Consensus sequence-NF-κ B p50 bonded equilibrium dissociation constant is respectively 0.2nM and 12nM, compares with 9 times of avidity differences seeing under low-salt conditions, shows 60 times avidity difference.Total avidity that these results are presented under the higher salt concentrations the DNA substrate reduces, however the specificity of DNA identification improve, do not observe combination for duplex 3, with consensus sequence and duplex 2 60 times avidity difference relatively.
The molecular recognition of IF-KB binding site
For the interaction in conjunction with the NF-κ B p50 homodimer of DNA substrate obtained two crystalline structure (referring to M ü ller, wait (1995) Nature, 373,311-317; Ghosh waits (1995) Nature, and 373,303-310).Although two eutectic structures comprise the DNA substrate of different lengths and sequence, there are many similaritys.Two Arg side chains are offered the guanine (G2 and G3 see Table 6) that a pair of hydrogen bond is given two central authorities in each p50 homodimer subunit.These contact expectations are elements (M ü ller etc., 1995) of the most critical of DNA identification.Although because the unconfined relatively character specificity of Lys side chain is more unpredictable, also known Lys residue carries out specific the contact with inner most G4.Also, determine outmost G in 1995 the structure from M ü ller etc. 1Contact with the His side chain.Have many other specific interactions between side chain and base, it is slightly different in two eutectic structures.This points out some DNA binding members is the interior different sequences of variable part flexible and that therefore can discern consensus sequence.By relatively in the SPR experiment, using duplex 2 and 3 dynamics datas that obtain, check the influence of SNP to the DNA identification of p50 homodimer.Compare with the G/C base pair in the duplex 2, duplex 3 comprises the A/T base pair in+4 positions.G 4Show with crystalline structure in Lys (numbering 241, from Ghosh etc., 1995) carry out important interaction (seeing Fig. 9 B).Yet, replace guanine with VITAMIN B4 and cancelled this interaction, and between the N6 of Lys side chain and VITAMIN B4 amino, produce possible space conflict.Clearly this interactional influence of proof in the affinity data that provides herein, it is presented at, and avidity reduces by 15 times under the low-salt conditions.Because because the disengaging speed that is exceedingly fast and the unstable of protein-dna complex cause duplex 3 is not found combination that this difference is estimated much bigger under higher salt condition.These results prove the remarkably influenced of SNP to the molecular recognition of NF-κ B p50.The result also shows G in the consensus sequence 1The influence of the change of position.Compare with duplex 1 (consensus sequence), duplex 21 and 12 contains the A/T base pair in the position.Crystalline structure (M ü ller etc., 1995) shows the G of His 67 and each p50 subunit 1Contact (seeing Fig. 9 D) is replaced G with VITAMIN B4 1Eliminate this interaction once more.This influence proves in affinity data once more.Under low-salt conditions, there be reducing of 9 times of avidity, this is increased to 60 times difference under high salt.Affinity data provided herein in a word shows, with G 1To A 1Change compare, with G 4Change over A 4Cause the influence of the much bigger interactional avidity of DNA to NF-κ B p50.These influences to avidity can be easily consistent with structured data.
Material and method
The oligonucleotide substrate
Cyanoethyl phosphoramidite chemistry carries out the synthetic of oligonucleotide on Applied Biosystems 394 dna synthesizers.Obtain biotin phosphoramidite from Glen Research.By annealing length is 3 kinds of duplex DNA substrates of complementary oligonucleotide generation of 23 bases, and wherein a chain is terminal by biotinylation 5 '.By be heated to 95 ℃ 5 minutes and be cooled to 25 ℃ 35 minutes, with at 10mM Tris-HCl (pH.7.4), 0.1M NaCl, the final DNA concentration of 1 μ M is annealed among the 3mM EDTA.The sequence of using in making up duplex DNA is:
Duplex 1
Figure GSA00000080605300681
And complementary strand
Figure GSA00000080605300682
Duplex 2,
Figure GSA00000080605300683
And complementary strand
Figure GSA00000080605300684
Duplex 3, And complementary strand
Figure GSA00000080605300686
The underscore zone is the p50 binding site, and bold-faced letter is illustrated in the SNP that analyzes in this research.
Surface plasma resonance
Use BIAcore 2000 TM(Uppsala, Sweden) carries out surface plasma resonance (SPR).Oligonucleotide is diluted in HBS damping fluid (10mM HEPES pH 7.4,75-150mM NaCl, 3mM EDTA, 0.05% (v/v) tensio-active agent P20) in to final concentration be 1ng/ml, and with 10 μ l/ minutes flow velocity through oligonucleotide and the sensing chip surface bonding of streptavidin sensing chip (SA) until about 50 reactons (RU).(people) NF-κ B p50 (Promega) that also will recombinate is diluted in the HBS damping fluid that contains 150mM or 75mM NaCl, and various concentration (2-100nM) are expelled to last 3 minute of sensing chip of band DNA with 20 μ l/ minutes flow velocity, and allows to dissociate 5 minutes.Remove bonded protein by injecting 10 μ l 1M NaCl.This renovation process does not change the ability of NF-κ B p50 to DNA.Use the BIA assessment software to carry out data analysis.In order to remove the influence of volume (bulk) variations in refractive index when injection begins and finish (it is owing to the difference of mobile damping fluid with the proteic composition of injection takes place), from each protein injection, deduct contrast sensing figure in the acquisition of streptavidin surface.All are determined under 25 ℃ carries out.
Dynamic analysis
Forming speed at binary association mesocomplex is described by following formula:
dR/dt＝k aC(R max-R)-k dR (1)
Wherein dR/dt is the speed that spr signal changes, and C is the concentration of analyte, R MaxBe maximum analysis thing binding capacity in RU, R is the spr signal in t moment RU.Can rearrange equation provides:
dR/dT＝k aCR max-(k aC+k d)R
Record sensing figure maps dR/dT for each concentration to R under at least 5 different analyte concentrations.Each slope (k of these straight lines aC+k d) the observed association rate of expression ,-k ObsGeneral-k ObsMapping allows to determine k from following equation to C a
-k obs＝k aC+k d
When the sample injection finishes, replace protein by the damping fluid that flows, bonded protein dissociates from DNA.Because the protein concn in the damping fluid that flows is zero, and hypothesis is heavy in conjunction with ignoring, and the hypothesis zero level that establishes an equation under using so disassociation uses linear regression analysis can calculate dissociation rate constant:
dR / dt = - k d R 0 e - kd ( t - t 0 )
Wherein dR/dt is the rate of change of spr signal, R and R 0Be at time t and t 0Response, k dIt is dissociation rate constant.
Can obtain equilibrium dissociation constant (K from the ratio of rate constant D):
K D＝k d/k a
DNA Sequence 5 '-3 '
Duplex 1 AGTTGA GGGGACTTTCCCAGGC TCAACT CCCCTGAAAGGGTCCG
Duplex
2 AGTCCA AGGGACATTCCATTCTC TCAGGT TCCCTGTAAGGTAAGAG
Duplex
3 AGTCCA AGGAACATTCCATTCTC TCAGGT TCCTTGTAAGGT AAGAG
Consensus sequence
1?2?3?4?5?6?7?8?9?10?11?12 GGGGXNYYYCCC CCCCYNXXXGGG
Table 6. is used for the oligodeoxynucleotide substrate of SPR binding analysis.Consensus sequence and numbering plan show that below wherein X represents purine, the Y pyrimidine.
Figure GSA00000080605300702
Table 7.p50 and oligodeoxynucleotide substrate bonded kinetic rate constant (k aAnd k d) and the equilibrium association constant (K that calculates D).
5.4. The discovery of other functional polymorphisms
Heredity discovery group is verified to be (referring to Figure 10) that function is arranged by dye analysis IL-1B4 SNP (3737) at the RAW transit cell, finds in following the mensuration it also is other polymorphism that function is arranged in addition.The construction strategy and the sequence information of function snp analysis show that in Figure 11 this figure shows the title of the construct of all generations and analysis.
Identify three other function SNP, be called IL-1B3, IL-1B7 and IL-1B15 (these SNP titles are used for the naming system of independent allelotrope 2 polymorphisms that show at Figure 11).
IL-1B3 allelotrope 2 and IL-1B15 allelotrope-2 reduce the transcription rate (referring to the experimental data among the sequence data among Figure 11 and Figure 10 and Figure 12) in RAW (mouse macrophage) and the THP-1 cell (person monocytic cell).IL-1B7 allelotrope-2 (genotype TGCAT GGGGTC) reduce transcription rate (see figure 10) in the RAW cell, IL-1B7 allelotrope-2 increases the transcription rate (seeing Figure 12) (allelotrope 1SNP) in the THP-1 cell.Figure 10 also shows IL-1B3 (genotype T ACATAGGGTC) and IL-1B15 (genotype TGCATAGGGT T) significantly reduce the expression of IL-1B in the RAW cell.
In conjunction with reference
All patents and publication that this paper quotes are incorporated herein by reference.
Equivalent
Those skilled in the art will recognize that or can only use normal experiment to determine, many Equivalents of specific embodiments of the present invention described here.These Equivalents are intended to be comprised in the accompanying Claim.
Sequence table
＜110〉Interleukin Genetics Inc.
＜120〉influence is transcribed and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease
<130>24299-520-061
<140>PCT/US02/37222
<141>2002-11-19
<150>60/331681
<151>2001-11-19
<150>60/386020
<151>2002-06-05
<160>78
<170>PatentIn?Ver.?2.1
<210>1
<211>45
<212>DNA
＜213〉people
<400>1
tctagaccag?ggaggagaat?ggaatgtccc?ttggactctg?catgt 45
<210>2
<211>45
<212>DNA
＜213〉people
<400>2
tctagaccag?ggaggagaat?ggaatgttcc?ttggactctg?catgt 45
<210>3
<211>47
<212>DNA
＜213〉people
<400>3
acagaggctc?actcccttgc?ataatgcaga?gcgagcacga?tacctgg 47
<210>4
<211>47
<212>DNA
＜213〉people
<400>4
acagaggctc?actcccttgt?ataatgcaga?gcgagcacga?tacctgg 47
<210>5
<211>49
<212>DNA
＜213〉people
<400>5
gatcgtgcca?ctgcactcca?gcctgggcga?cagggtgaga?ctctgtctc?49
<210>6
<211>49
<212>DNA
＜213〉people
<400>6
gatcgtgcca?ctgcactcca?gcctgggcga?cagcgtgaga?ctctgtctc 49
<210>7
<211>11
<212>DNA
＜213〉people
<400>7
tgcatagggt?c 11
<210>8
<211>11
<212>DNA
＜213〉people
<400>8
tgcatagggt?c 11
<210>9
<211>11
<212>DNA
＜213〉people
<400>9
tgcatagggt?c 11
<210>10
<211>11
<212>DNA
＜213〉people
<400>10
tgcatagggt?c 11
<210>11
<211>11
<212>DNA
＜213〉people
<400>11
tgtatagggt?c 11
<210>12
<211>11
<212>DNA
＜213〉people
<400>12
tacatagggt?c 11
<210>13
<211>11
<212>DNA
＜213〉people
<400>13
tgcatggggt?c 11
<210>14
<211>11
<212>DNA
＜213〉people
<400>14
tgcatagggt?t 11
<210>15
<211>11
<212>DNA
＜213〉people
<400>15
tgcatagggt c 11
<210>16
<211>11
<212>DNA
＜213〉people
<400>16
tgcatagggt?c 11
<210>17
<211>11
<212>DNA
＜213〉people
<400>17
tgcatagggt?c 11
<210>18
<211>11
<212>DNA
＜213〉people
<400>18
tgcatagggt?c 11
<210>19
<211>11
<212>DNA
＜213〉people
<400>19
tgtatagggt?c 11
<210>20
<21t>11
<212>DNA
＜213〉people
<400>20
tacatagggt?c 11
<210>21
<211>11
<212>DNA
＜213〉people
<400>21
tgcatggggt?c 11
<210>22
<211>11
<212>DNA
＜213〉people
<400>22
tgcatagggt?t 11
<210>23
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: primer
<400>23
tgtacctaag?cccacccttt?agag 24
<210>24
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: primer
<400>24
tggcctccag?aaacctccaa 20
<210>25
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: primer
<400>25
gctgatattc?tggtgggaaa 20
<210>26
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: primer
<400>26
ggcaagagca?aaactctgtc 20
<210>27
<211>45
<212>DNA
＜213〉people
<400>27
tctagaccag?ggaggagaat?ggaatgtycc?ttggactctg?catgt 45
<210>28
<211>47
<212>DNA
＜213〉people
<400>28
acagaggctc?actcccttgy?ataatgcaga?gcgagcacga?tacctgg 47
<210>29
<211>49
<212>DNA
＜213〉people
<400>29
gatcgtgcca?ctgcactcca?gcctgggcga?cagsgtgaga?ctctgtctc 49
<210>30
<211>45
<212>DNA
＜213〉people
<400>30
tctagaccag?ggaggagaat?ggaatgtycc?ttggactctg?catgt 45
<210>31
<211>14
<212>DNA
＜213〉people
<400>31
aagggacatt?ccat 14
<210>32
<211>47
<212>DNA
＜213〉people
<400>32
acagaggctc?actcccttgy?ataatgcaga?gcgagcacga?tacctgg 47
<210>33
<211>18
<212>DNA
＜213〉people
<400>33
tgcattatgc?aagggagt 18
<210>34
<211>14
<212>DNA
＜213〉people
<400>34
gcattatgca?aggg 14
<210>35
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic oligonucleotide
<400>35
agttgagggg?actttcccag?gc 22
<210>36
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic oligonucleotide
<400>36
gcctgggaaa?gtcccctcaa?ct 22
<210>37
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic oligonucleotide
<400>37
gagaatggaa?tgtcccttgg?act 23
<210>38
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic oligonucleotide
<400>38
agtccaaggg?acattccatt?ctc 23
<210>39
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic oligonucleotide
<400>39
gagaatggaa?tgttccttgg?act 23
<210>40
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic oligonucleotide
<400>40
agtccaagga?acattccatt?ctc 23
<210>41
<211>15402
<212>DNA
＜213〉people
<220>
＜221〉base of Xiu Shiing
<222>(5816)..(5817)
＜223〉a, t, g, c, other or unknown
<400>41
gcaaaagtaa?tcacggtttt?tgtcattaaa?agttttgcca?ttacttttaa?tgataaaaac?60
cacgattact?tttgcgccaa?cttaatagct?cactgcagcc?tcaaaattcc?tggtctcagg?120
gaatcctcct?gcctcagctt?cctgaatagc?tgggactaca?ggcacatgca?atcctacctg?180
gctaattttt?taaaaatttt?ttttgtaaag?atagaaactc?attttgttgt?ccaggctggt?240
ttcaaactct?tgtctttgtg?cctccctctg?ccctgtgcaa?gaccttctgg?atgcccacta?300
atgaagactt?ccagggagag?gaaaagtaaa?cataggtccc?tgatcaaggg?accagggttt?360
atcgaccaca?aacagcatgc?ccagattcca?ctggcagtcc?tagaggtcgc?atttgcccca?420
agtgtgtgtg?gaaggcctct?ccctagcagt?tggtttatac?accagccaca?gcacagcata?480
ttctcttaaa?ttgtgaacat?ttgcaaaacc?tccttgagga?caactatcat?gtcttgtgta?540
cttttgtttc?ccttccccta?tgtacacgca?cgcgcgcgca?cacacacaca?cacacacacc?600
cctcaaactg?aatgcctggt?gtgctgaatg?gatgaatggc?taatgtaagt?cattctaaaa?660
gctactttct?ttggcatacc?atcacctttg?atttcatctt?tctggaactc?ctatgttccc?720
agatgaattt?ggaaagccct?caggaaacat?ttcaaaattg?ctatatggga?gaaatgggag?780
ggtctctcta?gaaatttacc?tgccacaggt?atttctggta?agacacagca?aaggtggcac?840
cacccattcc?tcgttacaat?gtcaatgcca?gtcaccttcc?tgtcccataa?aactttatta?900
aaggtgcaga?attcccatgg?aagcaggtgg?acaccatctg?cttccagcca?gccaggggag?960
caaggtgtcc?actgtgcctt?tgtggcagga?actgcgcttc?tctactctcc?cactttgagg?1020
cctctggggc?tggcctgctg?cctcctcatt?gacaaggctg?cttactgagc?agttcattct?1080
gagctggaca?tagtgcttct?ggtgagtctc?tacttctatt?taacccaaag?atattctttc?1140
ctaaggaaac?gctttcctgt?cgggggaggt?tagctccaga?tggaagtcac?aagtgatggc?1200
atggtagctc?tcatccgttt?gggtggatga?tattcacgga?gcaccaccat?gagccagtca?1260
tggaggtgaa?cagtatatgc?cagccctgaa?tcaggtgcat?tgacagcaag?ggagacaagc?1320
aaacaaagct?gaggtttgct?gaggatgttc?aagactcaca?cagcacagag?gagcatccac?1380
cacccagctt?gggaaaggac?ttgttataga?gggggtgaag?catgagctga?gtcttgaaag?1440
actagaaatt?agccaaacta?caaggaggag?aaggagtttc?cagtcaggaa?gaacaggtta?1500
tgcaaaagca?cagagactag?aaagaatatc?acattcaagg?aactgcaaat?agacaggaaa?1560
ggttgatgcg?tgggatagga?gaggagggca?ggggattcca?ggtgggccct?gcttgccaca?1620
ctcaggagct?tgaacttatc?cacaaaggag?atgtggaacc?agtaatgaat?gggttttgtg?1680
caagggcttc?atgtcaccag?atttgctttt?tggagatact?tctgtggctg?atatgtgagg?1740
aagggatgga?ggaagtttcc?gtggcaatca?ggaaaaccaa?ttagcagatg?attcaaatgg?1800
cctaggggaa?aagggaggag?gacttggact?accatgcagc?agcagaaatg?gagagaaata?1860
acagatccca?ggcactcagg?aagcgctcag?aatgagccct?tcaaagaact?tatggtaggt?1920
gatggatgga?tggagtgtga?gtcctgggat?agcattgcct?gggaaaatac?tttctagttg?1980
agacagggaa?gtgggccagc?agaaatggag?ggcttcttct?ttttgcttta?aatactttta?2040
taatatttgg?aactttgaaa?atgagcagat?atattagcaa?aaagcctaaa?agggatattt?2100
ttgaaatcac?tgctagttct?aacatataac?tttcagcttg?cacacatcat?caattaactt?2160
tgatagcgcc?tttctgaaac?tatcatccca?aatagcaatc?cttgtaaaaa?cctattttga?2220
aaaacgggcc?ttgtaggata?gcctcacaga?tgttttgtgg?tagattttct?aacattctaa?2280
tgtcagggag?tgaaaggaat?cccgttagaa?gttggaaaat?tctggaatct?ctattcatgg?2340
tattaaagtt?ttgccgtcac?acaaaagttt?aacaccttta?cacaatcaga?cttcctcatt?2400
ttacattgct?cggtaattag?aggaaatcag?tcacccagag?cctgggtcct?agacttgaca?2460
aaatgcaccc?aacaaatcct?gagtggcctt?gctgaggact?tctcccagaa?gatagaaaac?2520
tcagttccag?ccaacaaggg?ggaagcagct?gaagaagtga?aattaacaaa?gtcctggaag?2580
gaaatgacca?aatcatcttt?gattgtgtaa?taaccagaga?gtagaataca?gcaacgacag?2640
acattttggg?agagaagcat?tttatcatag?cttttagaag?agaagtattt?ttcagcatca?2700
taagcacaca?attccaagga?cagatacctt?caagggattg?cttttgacag?ttatgacaaa?2760
gtcttaaaga?agaataaaag?gacaaaggaa?atcctccagc?aacaaagctg?ccacttatag?2820
atgagaaagt?gaatgggaat?aaggaagaaa?ctcagaaaag?ggaagagaga?tcactaaaaa?2880
ccctgatttg?gaaagtccca?gtactaccct?gagaggagaa?agaaacaaat?tcacacagca?2940
cgtcaccgcc?agaagaagaa?aggagggaag?acaagggaac?agagaggatc?tcaatcctaa?3000
aaggacaatg?tggaaacatt?taggggacag?aggtgaatct?gccaggccaa?tgtagtttag?3060
aatgtcactc?aatcactgag?aatgagaaag?gagtctgccg?atgggcacca?tgtggacagg?3120
agatgaggca?ataaacatat?gtaacaatta?aaagtgagaa?ataaagatct?ggttttggtt?3180
cagttaaccc?atatttgagt?cgtagttcca?gcatttactg?tttgtgcggt?cttaaataat?3240
ttattgtctc?aacctcagtt?tctgcatagg?tcaaatggtt?caatattatc?tactttaaag?3300
gttattatga?agagttaata?agataatgag?ggaaaaaaag?gtacctggca?cttagtaggt?3360
gctcaataaa?ggacggcttt?ttttttttaa?gtattgcttc?taaatttgta?tgtaagaaaa?3420
aatgatataa?tacaatgata?taagacaggg?gaccgcagga?caagtccagc?cacacccatt?3480
catttatgta?ttatctgact?gcttttctga?aatgatgcaa?ggttgagtag?ttgtacctga?3540
aacatttatt?atctggccct?ttacagaaaa?tgtttccaga?ccctggataa?gtggtaccag?3600
agccccctct?gtttgtggtc?ccctctctta?tacccactag?gtgtgagaaa?agacatagag?3660
taggagagcc?ctgccatcca?tcttacccac?ccaggggctt?tttctgatgg?atccaaagga?3720
aggacaaggt?cttattggtc?tcccagaact?gacataacaa?ctccgacatc?agggaaaagc?3780
cattggagac?tacatagctc?gccagcccca?gccacctgct?catatatcta?agccctcctt?3840
gttctagacc?agggaggaga?atggaatgtc?ccttggactc?tgcatgtccc?caatctgaga?3900
acctggatcc?aagagggaga?agaagcccat?tggagatgat?gccataaagg?aagtggaagc?3960
gatatgataa?aaatcatagt?gcccattccc?aaataatccc?agaagcagaa?gggaaaggag?4020
agaaatatcc?acaaagacag?gtgtgggtac?acacaacatt?tttcatactt?taagatccca?4080
gagggactca?tggaaatgat?acaagaaaat?gactcataag?aacaaatatt?aggaagccag?4140
tgccaagaat?gagatgggaa?attggggaaa?atgttggggg?cagattgctt?agttctgttc?4200
taagcaagag?ggtgaacaag?gaaggaacag?ctcactacaa?agaacagaca?tcactgcatg?4260
tacacacaat?aatataagaa?ctaacccatg?attattttgc?ttgtcttctt?gttcaaaatg?4320
attgaagacc?aatgagatga?gatcaacctt?gataactggc?tgcgaagccc?atgattagac?4380
acaagatggt?atcagggcac?ttgctgcttt?gaataaatgt?cagtctcctg?tcttggaaga?4440
atgacctgac?agggtaaaga?ggaacttgca?gctgagaaag?gctttagtga?ctcaagagct?4500
gaataattcc?ccaaaagctg?gagcatcctg?gcatttccag?ctccccatct?ctgcttgttc?4560
cacttccttg?gggctacatc?accatctaca?tcatcatcac?tcttccactc?cctcccttag?4620
tgccaactat?gtttatagcg?agatattttc?tgctcattgg?ggatcggaag?gaagtgctgt?4680
ggcctgagcg?gtctccttgg?gaagacagga?tctgatacat?acgttgcaca?acctatttga?4740
cataagaggt?ttcacttcct?gagatggatg?ggatggtagc?agatttgggt?ccaggttaca?4800
gggccaggat?gagacatggc?agaactgtgg?agactgttac?gtcagggggc?attgccccat?4860
ggctccaaaa?tttccctcga?gcgaaagcat?caggggctca?tgcaacctgg?atactagtgc?4920
tgcttcaacc?acactgtgct?attggatgag?tcacttccac?cctcctagcc?ttgatttctt?4980
cgtctgctgt?tcacattcaa?atagctattc?atgtcttcat?ctctgtggtc?ccaccatatc?5040
ccaccagaca?atcattaggg?ctcctcttag?ctggcagatt?ctgaggtcct?ggatgctaca?5100
attggaagat?ggagaagtag?aagctcaagg?tttctgacct?gtatcccaag?tcccagaagc?5160
agaatggact?aactcagagc?tgatgctcgg?gtcccttgca?tatctccctt?cctgtcactg?5220
gctttgatcc?tccttcgttc?agcttgtaat?cacatcaaca?gaccaaagac?atctctgtgt?5280
tctgtcagga?gagttcacag?agccaccaac?cctccagacc?ctgctggttg?ccgcataaag?5340
actctgagga?agggtttgag?gctgctgtga?tcatgcaatg?aatgcatgat?tgtaccactg?5400
cactccagcc?tgggggataa?aggtagatcc?tgtctaggag?agagagagag?agaaagagaa?5460
agagagagag?aagggaggga?gagacaaaga?aaaagagaga?gagggaggga?gaaagaaaga?5520
gagaaagaaa?agagaaaaga?aagaaaaaga?aagaaagaga?gagagggagg?gagggagaga?5580
gaaagaaaga?aagaaagaga?aagagagaaa?gagagaaaga?gaaagaaagg?aagaaagaaa?5640
gaaagaaaga?aagaaagaaa?gaaagaaaga?aagaaaagaa?aagaaagaaa?gagagagaga?5700
aagaaaagaa?agaggaagga?aggaaggaag?gaagaaagac?aggctctgag?gaaggtggca?5760
gttcctacaa?cgggagaacc?agtggttaat?ttgcaaagtg?gatcctgtgg?aggcanncag?5820
aggagtcccc?taggccaccc?agacagggct?tttagctatc?tgcaggccag?acaccaaatt?5880
tcaggagggc?tcagtgttag?gaatggatta?tggcttatca?aattcacagg?aaactaacat?5940
gttgaacagc?ttttagattt?cctgtggaaa?atataactta?ctaaagatgg?agttcttgtg?6000
actgactcct?gatatcaaga?tactgggagc?caaattaaaa?atcagaaggc?tgcttggaga?6060
gcaagtccat?gaaatgctct?ttttcccaca?gtagaaccta?tttccctcgt?gtctcaaata?6120
cttgcacaga?ggctcactcc?cttggataat?gcagagcgag?cacgatacct?ggcacatact?6180
aatttgaata?aaatgctgtc?aaattcccat?tcacccattc?aagcagcaaa?ctctatctca?6240
cctgaatgta?catgccaggc?actgtgctag?acttggctca?aaaagatttc?agtttcctgg?6300
aggaaccagg?agggcaaggt?ttcaactcag?tgctataaga?agtgttacag?gctggacacg?6360
gtggctcacg?cctgtaatcc?caacatttgg?gaggccgagg?cgggcagatc?acaaggtcag?6420
gagatcgaga?ccatcctggc?taacatggtg?aaaccctgtc?tctactaaaa?atacaaaaaa?6480
ttagccgggc?gttggcggca?ggtgcctgta?gtcccagctg?ctggggaggc?tgaggcagga?6540
gaatggtgtg?aacccgggag?gcggaacttg?cagggggccg?agatcgtgcc?actgcactcc?6600
agcctgggcg?acagagtgag?actctgtctc?aaaaaaaaaa?aaaaagtgtt?atgatgcaga?6660
cctgtcaaag?aggcaaagga?gggtgttcct?acactccagg?cactgttcat?aacctggact?6720
ctcattcatt?ctacaaatgg?agggctcccc?tgggcagatc?cctggagcag?gcactttgct?6780
ggtgtctcgg?ttaaagagaa?actgataact?cttggtatta?ccaagagata?gagtctcaga?6840
tggatattct?tacagaaaca?atattcccac?ttttcagagt?tcaccaaaaa?atcattttag?6900
gcagagctca?tctggcattg?atctggttca?tccatgagat?tggctagggt?aacagcacct?6960
ggtcttgcag?ggttgtgtga?gcttatctcc?agggttgccc?caactccgtc?aggagcctga?7020
accctgcata?ccgtatgttc?tctgccccag?ccaagaaagg?tcaattttct?cctcagaggc?7080
tcctgcaatt?gacagagagc?tcccgaggca?gagaacagca?cccaaggtag?agacccacac?7140
cctcaataca?gacagggagg?gctattggcc?cttcattgta?cccatttatc?catctgtaag?7200
tgggaagatt?cctaaactta?agtacaaaga?agtgaatgaa?gaaaagtatg?tgcatgtata?7260
aatctgtgtg?tcttccactt?tgtcccacat?atactaaatt?taaacattct?tctaacgtgg?7320
gaaaatccag?tattttaatg?tggacatcaa?ctgcacaacg?attgtcagga?aaacaatgca?7380
tatttgcatg?gtgatacatt?tgcaaaatgt?gtcatagttt?gctactcctt?gcccttccat?7440
gaaccagaga?attatctcag?tttattagtc?ccctccccta?agaagcttcc?accaatactc?7500
ttttcccctt?tcctttaact?tgattgtgaa?atcaggtatt?caacagagaa?atttctcagc?7560
ctcctacttc?tgcttttgaa?agctataaaa?acagcgaggg?agaaactggc?agataccaaa?7620
cctcttcgag?gcacaaggca?caacaggctg?ctctgggatt?ctcttcagcc?aatcttcatt?7680
gctcaagtat?gactttaatc?ttccttacaa?ctaggtgcta?agggagtctc?tctgtctctc?7740
tgcctctttg?tgtgtatgca?tattctctct?ctctctctct?ttctttctct?gtctctcctc?7800
tccttcctct?ctgcctcctc?tctcagcttt?ttgcaaaaat?gccaggtgta?atataatgct?7860
tatgactcgg?gaaatattct?gggaatggat?actgcttatc?taacagctga?caccctaaag?7920
gttagtgtca?aagcctctgc?tccagctctc?ctagccaata?cattgctagt?tggggtttgg?7980
tttagcaaat?gcttttctct?agacccaaag?gacttctctt?tcacacattc?attcatttac?8040
tcagagatca?tttctttgca?tgactgccat?gcactggatg?ctgagagaaa?tcacacatga?8100
acgtagccgt?catggggaag?tcactcattt?tctccttttt?acacaggtgt?ctgaagcagc?8160
catggcagaa?gtacctgagc?tcgccagtga?aatgatggct?tattacaggt?cagtggagac?8220
gctgagacca?gtaacatgag?caggtctcct?ctttcaagag?tagagtgtta?tctgtgcttg?8280
gagaccagat?ttttccccta?aattgcctct?ttcagtggca?aacagggtgc?caagtaaatc?8340
tgatttaaag?actactttcc?cattacaagt?ccctccagcc?ttgggacctg?gaggctatcc?8400
agatgtgttg?ttgcaagggc?ttcctgcaga?ggcaaatggg?gagaaaagat?tccaagccca?8460
caatacaagg?aatccctttg?caaagtgtgg?cttggaggga?gagggagagc?tcagatttta?8520
gctgactctg?ctgggctaga?ggttaggcct?caagatccaa?cagggagcac?cagggtgccc?8580
acctgccagg?cctagaatct?gccttctgga?ctgttctgcg?catatcactg?tgaaacttgc?8640
caggtgtttc?aggcagcttt?gagaggcagg?ctgtttgcag?tttcttatga?acagtcaagt?8700
cttgtacaca?gggaaggaaa?aataaacctg?tttagaagac?ataattgaga?catgtccctg?8760
tttttattac?agtggcaatg?aggatgactt?gttctttgaa?gctgatggcc?ctaaacagat?8820
gaaggtaaga?ctatgggttt?aactcccaac?ccaaggaagg?gctctaacac?agggaaagct?8880
caaagaaggg?agttctgggc?cactttgatg?ccatggtatt?ttgttttaga?aagactttaa?8940
cctcttccag?tgagacacag?gctgcaccac?ttgctgacct?ggccacttgg?tcatcatatc?9000
accacagtca?ctcactaacg?ttggtggtgg?tggccacact?tggtggtgac?aggggaggag?9060
tagtgataat?gttcccattt?catagtagga?agacaaccaa?gtcttcaaca?taaatttgat?9120
tatcctttta?agagatggat?tcagcctatg?ccaatcactt?gagttaaact?ctgaaaccaa?9180
gagatgatct?tgagaactaa?catatgtcta?ccccttttga?gtagaatagt?tttttgctac?9240
ctggggtgaa?gcttataaca?acaagacata?gatgatataa?acaaaaagat?gaattgagac?9300
ttgaaagaaa?accattcact?tgctgtttga?ccttgacaag?tcattttacc?cgctttggac?9360
ctcatctgaa?aaataaaggg?ctgagctgga?tgatctctga?gattccagca?tcctgcaacc?9420
tccagttctg?aaatattttc?agttgtagct?aagggcattt?gggcagcaaa?tggtcatttt?9480
tcagactcat?ccttacaaag?agccatgtta?tattcctgct?gtcccttctg?ttttatatga?9540
tgctcagtag?ccttcctagg?tgcccagcca?tcagcctagc?taggtcagtt?gtgcaggttg?9600
gaggcagcca?cttttctctg?gctttatttt?attccagttt?gtgatagcct?cccctagcct?9660
cataatccag?tcctcaatct?tgttaaaaac?atatttcttt?agaagtttta?agactggcat?9720
aacttcttgg?ctgcagctgt?gggaggagcc?cattggcttg?tctgcctggc?ctttgccccc?9780
cattgcctct?tccagcagct?tggctctgct?ccaggcagga?aattctctcc?tgctcaactt?9840
tcttttgtgc?acttacaggt?ctctttaact?gtctttcaag?cctttgaacc?attatcagcc?9900
ttaaggcaac?ctcagtgaag?ccttaatacg?gagcttctct?gaataagagg?aaagtggtaa?9960
catttcacaa?aaagtactct?cacaggattt?gcagaatgcc?tatgagacag?tgttatgaaa?10020
aaggaaaaaa?aagaacagtg?tagaaaaatt?gaatacttgc?tgagtgagca?taggtgaatg?10080
gaaaatgtta?tggtcatctg?catgaaaaag?caaatcatag?tgtgacagca?ttagggatac?10140
aaaaagatat?agagaaggta?tacatgtatg?gtgtaggtgg?ggcatgtaca?aaaagatgac?10200
aagtagaatc?gggatttatt?ctaaagaata?gcctgtaagg?tgtccagaag?ccacattcta?10260
gtcttgagtc?tgcctctacc?tgctgtgtgc?ccttgagtac?acccttaacc?tccttgagct?10320
tcagagaggg?ataatctttt?tattttattt?tattttattt?tgttttgttt?tgttttgttt?10380
tgttttatga?gacagagtct?cactctgttg?cccaggctgg?agtgcagtgg?tacaatcttg?10440
gcttactgca?tcctccacct?cctgagttca?agcgattctc?cttcctcagt?ctcctgaata?10500
gctaggatta?caggtgcacc?ccaccacacc?cagctaattt?ttgtattttt?agtagagaag?10560
gggtttcgcc?atgttggcca?ggctggtttt?gaagtcctga?cctaaatgat?tcatccacct?10620
cggcttccca?aagtgctggg?attacaggca?tgagccacca?cgcctggccc?agagagggat?10680
gatctttaga?agctcgggat?tctttcaagc?cctttcctcc?tctctgagct?ttctactctc?10740
tgatgtcaaa?gcatggttcc?tggcaggacc?acctcaccag?gctccctccc?tcgctctctc?10800
cgcagtgctc?cttccaggac?ctggacctct?gccctctgga?tggcggcatc?cagctacgaa?10860
tctccgacca?ccactacagc?aagggcttca?ggcaggccgc?gtcagttgtt?gtggccatgg?10920
acaagctgag?gaagatgctg?gttccctgcc?cacagacctt?ccaggagaat?gacctgagca?10980
ccttctttcc?cttcatcttt?gaagaaggta?gttagccaag?agcaggcagt?agatctccac?11040
ttgtgtcctc?ttggaagtca?tcaagcccca?gccaactcaa?ttcccccaga?gccaaagccc?11100
tttaaaggta?gaaggcccag?cggggagaca?aaacaaagaa?ggctggaaac?caaagcaatc?11160
atctctttag?tggaaactat?tcttaaagaa?gatcttgatg?gctactgaca?tttgcaactc?11220
cctcactctt?tctcaggggc?ctttcactta?cattgtcacc?agaggttcgt?aacctccctg?11280
tgggctagtg?ttatgaccat?caccatttta?cctaagtagc?tctgttgctc?ggccacagtg?11340
agcagtaata?gacctgaagc?tggaacccat?gtctaatagt?gtcaggtcca?gtgttcttag?11400
ccaccccact?cccagcttca?tccctactgg?tgttgtcatc?agactttgac?cgtatatgct?11460
caggtgtcct?ccaagaaatc?aaattttgcc?acctcgcctc?acgaggcctg?cccttctgat?11520
tttataccta?aacaacatgt?gctccacatt?tcagaaccta?tcttcttcga?cacatgggat?11580
aacgaggctt?atgtgcacga?tgcacctgta?cgatcactga?actgcacgct?ccgggactca?11640
cagcaaaaaa?gcttggtgat?gtctggtcca?tatgaactga?aagctctcca?cctccaggga?11700
caggatatgg?agcaacaagg?taaatggaaa?catcctggtt?tccctgcctg?gcctcctggc?11760
agcttgctaa?ttctccatgt?tttaaacaaa?gtagaaagtt?aatttaaggc?aaatgatcaa?11820
cacaagtgaa?aaaaaatatt?aaaaaggaat?atacaaactt?tggtcctaga?aatggcacat?11880
ttgattgcac?tggccagtgc?atttgttaac?aggagtgtga?ccctgagaaa?ttagacggct?11940
caagcactcc?caggaccatg?tccacccaag?tctcttgggc?atagtgcagt?gtcaattctt?12000
ccacaatatg?gggtcatttg?atggacatgg?cctaactgcc?tgtgggttct?ctcttcctgt?12060
tgttgaggct?gaaacaagag?tgctggagcg?ataatgtgtc?catccccctc?cccagtcttc?12120
cccccttgcc?ccaacatccg?tcccacccaa?tgccaggtgg?ttccttgtag?ggaaatttta?12180
ccgcccagca?ggaacttata?tctctccgct?gtaacgggca?aaagtttcaa?gtgcggtgaa?12240
cccatcatta?gctgtggtga?tctgcctggc?atcgtgccac?agtagccaaa?gcctctgcac?12300
aggagtgtgg?gcaactaagg?ctgctgactt?tgaaggacag?cctcactcag?ggggaagcta?12360
tttgctctca?gccaggccaa?gaaaatcctg?tttctttgga?atcgggtagt?aagagtgatc?12420
ccagggcctc?caattgacac?tgctgtgact?gaggaagatc?aaaatgagtg?tctctctttg?12480
gagccacttt?cccagctcag?cctctcctct?cccagtttct?tcccatgggc?tactctctgt?12540
tcctgaaaca?gttctggtgc?ctgatttctg?gcagaagtac?agcttcacct?ctttcctttc?12600
cttccacatt?gatcaagttg?ttccgctcct?gtggatgggc?acattgccag?ccagtgacac?12660
aatggcttcc?ttccttcctt?ccttcagcat?ttaaaatgta?gaccctcttt?cattctccgt?12720
tcctactgct?atgaggctct?gagaaaccct?caggcctttg?aggggaaacc?ctaaatcaac?12780
aaaatgaccc?tgctattgtc?tgtgagaagt?caagttatcc?tgtgtcttag?gccaaggaac?12840
ctcactgtgg?gttcccacag?aggctaccaa?ttacatgtat?cctactctcg?gggctagggg?12900
ttggggtgac?cctgcatgct?gtgtccctaa?ccacaagacc?cccttctttc?ttcagtggtg?12960
ttctccatgt?cctttgtaca?aggagaagaa?agtaatgaca?aaatacctgt?ggccttgggc?13020
ctcaaggaaa?agaatctgta?cctgtcctgc?gtgttgaaag?atgataagcc?cactctacag?13080
ctggaggtaa?gtgaatgcta?tggaatgaag?cccttctcag?cctcctgcta?ccacttattc?13140
ccagacaatt?caccttctcc?ccgcccccat?ccctaggaaa?agctgggaac?aggtctattt?13200
gacaagtttt?gcattaatgt?aaataaattt?aacataattt?ttaactgcgt?gcaaccttca?13260
atcctgctgc?agaaaattaa?atcattttgc?cgatgttatt?atgtcctacc?atagttacaa?13320
ccccaacaga?ttatatattg?ttagggctgc?tctcatttga?tagacacctt?gggaaataga?13380
tgacttaaag?ggtcccatta?tcacgtccac?tccactccca?aaatcaccac?cactatcacc?13440
tccagctttc?tcagcaaaag?cttcatttcc?aagttgatgt?cattctagga?ccataaggaa?13500
aaatacaata?aaaagcccct?ggaaactagg?tacttcaaga?agctctagct?taattttcac?13560
ccccccaaaa?aaaaaaaatt?ctcacctaca?ttatgctcct?cagcatttgg?cactaagttt?13620
tagaaaagaa?gaagggctct?tttaataatc?acacagaaag?ttgggggccc?agttacaact?13680
caggagtctg?gctcctgatc?atgtgacctg?ctcgtcagtt?tcctttctgg?ccaacccaaa?13740
gaacatcttt?cccataggca?tctttgtccc?ttgccccaca?aaaattcttc?tttctctttc?13800
gctgcagagt?gtagatccca?aaaattaccc?aaagaagaag?atggaaaagc?gatttgtctt?13860
caacaagata?gaaatcaata?acaagctgga?atttgagtct?gcccagttcc?ccaactggta?13920
catcagcacc?tctcaagcag?aaaacatgcc?cgtcttcctg?ggagggacca?aaggcggcca?13980
ggatataact?gacttcacca?tgcaatttgt?gtcttcctaa?agagagctgt?acccagagag?14040
tcctgtgctg?aatgtggact?caatccctag?ggctggcaga?aagggaacag?aaaggttttt?14100
gagtacggct?atagcctgga?ctttcctgtt?gtctacacca?atgcccaact?gcctgcctta?14160
gggtagtgct?aagaggatct?cctgtccatc?agccaggaca?gtcagctctc?tcctttcagg?14220
gccaatcccc?agcccttttg?ttgagccagg?cctctctcac?ctctcctact?cacttaaagc?14280
ccgcctgaca?gaaaccacgg?ccacatttgg?ttctaagaaa?ccctctgtca?ttcgctccca?14340
cattctgatg?agcaaccgct?tccctattta?tttatttatt?tgtttgtttg?ttttgattca?14400
ttggtctaat?ttattcaaag?ggggcaagaa?gtagcagtgt?ctgtaaaaga?gcctagtttt?14460
taatagctat?ggaatcaatt?caatttggac?tggtgtgctc?tctttaaatc?aagtccttta?14520
attaagactg?aaaatatata?agctcagatt?atttaaatgg?gaatatttat?aaatgagcaa?14580
atatcatact?gttcaatggt?tctgaaataa?acttcactga?agaaaaaaaa?aaaagggtct?14640
ctcctgatca?ttgactgtct?ggattgacac?tgacagtaag?caaacaggct?gtgagagttc?14700
ttgggactaa?gcccactcct?cattgctgag?tgctgcaagt?acctagaaat?atccttggcc?14760
accgaagact?atcctcctca?cccatcccct?ttatttcgtt?gttcaacaga?aggatattca?14820
gtgcacatct?ggaacaggat?cagctgaagc?actgcaggga?gtcaggactg?gtagtaacag?14880
ctaccatgat?ttatctatca?atgcaccaaa?catctgttga?gcaagcgcta?tgtactagga?14940
gctgggagta?cagagatgag?aacagtcaca?agtccctcct?cagataggag?aggcagctag?15000
ttataagcag?aacaaggtaa?catgacaagt?agagtaagat?agaagaacga?agaggagtag?15060
ccaggaagga?gggaggagaa?cgacataaga?atcaagccta?aagggataaa?cagaagattt?15120
ccacacatgg?gctgggccaa?ttgggtgtcg?gttacgcctg?taatcccagc?actttgggtg?15180
gcaggggcag?aaagatcgct?tgagcccagg?agttcaagac?cagcctgggc?aacatagtga?15240
gactcccatc?tctacaaaaa?ataaataaat?aaataaaaca?atcagccagg?catgctggca?15300
tgcacctgta?gtcctagcta?cttgggaagc?tgacactgga?ggattgcttg?agcccagaag?15360
ttcaagactg?cagtgagctt?atccgttgac?ctgcaggtcg?ac 15402
<210>42
<211>13
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>42
ttgcataggg?tct 13
<210>43
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>43
ttgcataggg?tc 12
<210>44
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>44
tgcatagggt?ct 12
<210>45
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>45
tgcatagggt?c 11
<210>46
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>46
ttgcataggg?tc 12
<210>47
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>47
ctgcataggg?tc 12
<210>48
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>48
tgcatagggt?c 11
<210>49
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>49
cgcatagggt?c 11
<210>50
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>50
tacatagggt?c 11
<210>51
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>51
tgtatagggt?c 11
<210>52
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>52
tgcgtagggt?c 11
<210>53
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>53
tgcacagggt?c 11
<210>54
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>54
tgcatggggt?c 11
<210>55
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>55
tgcataaggt?c 11
<210>56
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>56
tgcatagagt?c 11
<210>57
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>57
tgcataggct?c 11
<210>58
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>58
tgcatagggc?c 11
<210>59
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>59
tgcatagggt?t 11
<210>60
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>60
tgcatagggt?ct 12
<210>61
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>61
tgcatagggt?cc 12
<210>62
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>62
ttgcataggg?tc 12
<210>63
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>63
ctgcataggg?tc 12
<210>64
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>64
tgcatagggt?c 11
<210>65
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>65
cgcatagggt?c 11
<210>66
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>66
tacatagggt?c 11
<210>67
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>67
tgtatagggt?c 11
<210>68
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>68
tgcgtagggt?c 11
<210>69
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>69
tgcacagggt?c 11
<210>70
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>70
tgcatggggt?c 11
<210>71
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>71
tgcataaggt?c 11
<210>72
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>72
tgcatagagt?c 11
<210>73
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>73
tgcataggcc?t 11
<210>74
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>74
tgcatagggt?t 11
<210>75
<211>11
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>75
tgcatagggc?c 11
<210>76
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>76
tgcatagggc?tc 12
<210>77
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<400>77
tgcatagggc?tt 12
<210>78
<211>12
<212>DNA
＜213〉artificial sequence
<220>
＜223〉description of artificial sequence: synthetic construct sequence
<220>
＜221〉base of Xiu Shiing
<222>(6)
＜223〉a, t, c or g
<400>78
ggggrnyyyc?cc 12

Claims (7)

1. isolating nucleic acid, it comprises the Nucleotide of 20 adjacency of people's gene group sequence, and described Nucleotide comprises the polymorphic allelotrope of-1469 interleukin 1 β.
2. the isolating nucleic acid of claim 1, the Nucleotide correspondence of wherein said 20 adjacency are in-1469 interleukin 1 β allelotrope 1 sequence:
ACAGAGGCTCACTCCCTTGCATAATGCAGAGCGAGCACGATACCTGG。
3. the isolating nucleic acid of claim 1, the Nucleotide correspondence of wherein said 20 adjacency are in-1469 interleukin 1 β allelotrope 2 sequences:
ACAGAGGCTCACTCCCTTGTATAATGCAGAGCGAGCACGATACCTGG。
4. isolating nucleic acid, it comprises the complementary sequence of arbitrary nucleic acid of claim 1-3.
5. the isolating nucleic acid of claim 1, wherein said-1469 Nucleotide corresponding to interleukin 1 β is positioned at 3 ' end of described nucleic acid molecule.
6. the isolating nucleic acid of any one among the claim 1-3 and 5, it comprises detectable mark in addition.
7. the isolating nucleic acid of claim 4, it comprises detectable mark in addition.
CN201010156318.0A 2001-11-19 2002-11-19 Influence is transcribed and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease Pending CN101955943A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US33168101P 2001-11-19 2001-11-19
US60/331,681 2001-11-19
US38602002P 2002-06-05 2002-06-05
US60/386,020 2002-06-05

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN02827282.XA Division CN1753903B (en) 2001-11-19 2002-11-19 Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases

Publications (1)

Publication Number Publication Date
CN101955943A true CN101955943A (en) 2011-01-26

Family

ID=26987865

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201010156318.0A Pending CN101955943A (en) 2001-11-19 2002-11-19 Influence is transcribed and to the functional polymorphisms of the interleukin-1 locus of the susceptibility of inflammatory and communicable disease
CN02827282.XA Expired - Fee Related CN1753903B (en) 2001-11-19 2002-11-19 Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN02827282.XA Expired - Fee Related CN1753903B (en) 2001-11-19 2002-11-19 Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases

Country Status (8)

Country Link
US (2) US20030235890A1 (en)
EP (1) EP1463745A4 (en)
JP (2) JP4492849B2 (en)
KR (2) KR101059898B1 (en)
CN (2) CN101955943A (en)
AU (1) AU2002359431A1 (en)
CA (1) CA2467717A1 (en)
WO (1) WO2003044176A2 (en)

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7820383B2 (en) 1997-03-10 2010-10-26 Interleukin Genetics, Inc. Method for diagnosing myocardial infarction
GB9711040D0 (en) * 1997-05-29 1997-07-23 Duff Gordon W Prediction of inflammatory disease
CA2378221A1 (en) * 1999-06-30 2001-01-04 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an il-1 inflammatory haplotype
US20080311581A1 (en) * 2001-11-19 2008-12-18 David Wyllie Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
US20070264645A1 (en) * 2002-01-25 2007-11-15 Kenneth Kornman IL-1 gene cluster and associated inflammatory polymorphisms and haplotypes
US7732134B2 (en) * 2002-09-30 2010-06-08 Novartis Ag Methods to predict cholesterol elevation during immunosuppressant therapy
US20050175721A1 (en) * 2004-02-06 2005-08-11 Brovelli Ernesto A. Method of augmenting the immune-modulatory activity of standardized Echinacea preparations
EP1720893B1 (en) * 2004-02-26 2014-08-13 Baylor Research Institute Compositions and methods for the systemic treatment of arthritis
WO2005108619A2 (en) * 2004-05-03 2005-11-17 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an il-1 inflammatory haplotype
JP4664298B2 (en) * 2004-08-24 2011-04-06 富士フイルム株式会社 Calculation method of dissociation constant in surface plasmon resonance analysis
JP2006262826A (en) * 2005-03-25 2006-10-05 Institute Of Physical & Chemical Research Method for examining inflammatory disease on basis of polymorphism of interleukin-1 receptor 2 gene
EP1951903A2 (en) * 2005-10-25 2008-08-06 Interleukin Genetics, Inc. The il-1 gene cluster and associated inflammatory polymorphisms and haplotypes
JP4870976B2 (en) * 2005-11-10 2012-02-08 株式会社Ｄｎａチップ研究所 Test method for autoimmune disease using whole blood
US8101360B2 (en) * 2006-11-15 2012-01-24 Interleukin Genetics, Inc. IL-1 gene cluster, insulin resistance and coronary artery disease associated polymorphisms and haplotypes and methods of using same
WO2009061506A2 (en) * 2007-11-08 2009-05-14 Interleukin Genetics, Inc. Diagnostics for aging-related dermatologic disorders
US10894985B2 (en) 2016-01-12 2021-01-19 Sitokine Limited Methods for predicting response to treatment
KR102543907B1 (en) * 2016-06-17 2023-06-15 서울대학교산학협력단 A genetic marker for evaluating risk of periodontitis
US10337070B2 (en) 2017-01-12 2019-07-02 Cardioforecast Ltd. Methods and kits for treating cardiovascular disease
JP7097855B2 (en) * 2019-04-24 2022-07-08 ジェネシスヘルスケア株式会社 How to determine the risk of periodontal disease
CA3142662A1 (en) 2019-06-06 2020-12-10 Sitokine Limited Compositions and methods for treating lung, colorectal and breast cancer
WO2021028469A1 (en) 2019-08-12 2021-02-18 Sitokine Limited Compositions and methods for treating cytokine release syndrome and neurotoxicity
WO2021205013A1 (en) 2020-04-09 2021-10-14 Sitokine Limited Compositions and methods for treating covid-19
US20230277634A1 (en) * 2020-08-17 2023-09-07 The Regents Of The University Of California Application of microbial glycosidase as an anti-viral therapeutic, prognostic, and diagnostic

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8311018D0 (en) * 1983-04-22 1983-05-25 Amersham Int Plc Detecting mutations in dna
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4833080A (en) * 1985-12-12 1989-05-23 President And Fellows Of Harvard College Regulation of eucaryotic gene expression
US4998617A (en) * 1986-09-15 1991-03-12 Laura Lupton Inc Facial cosmetic liquid make up kit
US4968607A (en) * 1987-11-25 1990-11-06 Immunex Corporation Interleukin-1 receptors
US5459039A (en) * 1989-05-12 1995-10-17 Duke University Methods for mapping genetic mutations
US5593826A (en) * 1993-03-22 1997-01-14 Perkin-Elmer Corporation, Applied Biosystems, Inc. Enzymatic ligation of 3'amino-substituted oligonucleotides
US5747498A (en) * 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
US5686246A (en) * 1995-08-03 1997-11-11 Kornman; Kenneth S. Detecting genetic predisposition to periodontal disease
GB9603095D0 (en) * 1996-02-14 1996-04-10 Zeneca Ltd Quinazoline derivatives
US5698399A (en) * 1996-04-05 1997-12-16 Duff; Gordon W. Detecting genetic predisposition for osteoporosis
GB9621129D0 (en) * 1996-10-10 1996-11-27 Duff Gordon W Detecting genetic predisposition to sight-threatening diabetic retinopathy
US6524795B1 (en) 1997-03-10 2003-02-25 Interleukin Genetics, Inc. Diagnostics for cardiovascular disorders
US6210877B1 (en) * 1997-03-10 2001-04-03 Interleukin Genetics, Inc. Prediction of coronary artery disease
GB9711040D0 (en) * 1997-05-29 1997-07-23 Duff Gordon W Prediction of inflammatory disease
GB9723553D0 (en) * 1997-11-07 1998-01-07 Duff Gordon W Prediction of the risk of chronic obstructive airway disease
US6437216B1 (en) * 1997-11-13 2002-08-20 Interleukin Genetics Inc. Transgenic models of inflammatory disease
US6251598B1 (en) * 1998-10-30 2001-06-26 Interleukin Genetics, Inc. Methods for diagnosing sepsis
CA2378221A1 (en) 1999-06-30 2001-01-04 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an il-1 inflammatory haplotype
EP1218356A1 (en) * 1999-09-21 2002-07-03 AstraZeneca AB Quinazoline compounds and pharmaceutical compositions containing them
US6656946B2 (en) * 2000-08-26 2003-12-02 Boehringer Ingelheim Pharma Kg Aminoquinazolines which inhibit signal transduction mediated by tyrosine kinases
US6617329B2 (en) * 2000-08-26 2003-09-09 Boehringer Ingelheim Pharma Kg Aminoquinazolines and their use as medicaments
AU2002320100A1 (en) 2001-06-15 2003-01-02 Interleukin Genetics, Inc. Methods for detecting and treating the early onset of aging-related conditions
TW200813014A (en) * 2002-03-28 2008-03-16 Astrazeneca Ab Quinazoline derivatives
US6924285B2 (en) * 2002-03-30 2005-08-02 Boehringer Ingelheim Pharma Gmbh & Co. Bicyclic heterocyclic compounds, pharmaceutical compositions containing these compounds, their use and process for preparing them
US8071304B2 (en) * 2003-04-05 2011-12-06 The Johns Hopkins University Methods for detecting a polymorphism in the NFKB1 gene promoter

Also Published As

Publication number Publication date
KR101019131B1 (en) 2011-03-07
KR101059898B1 (en) 2011-08-29
AU2002359431A1 (en) 2003-06-10
WO2003044176A8 (en) 2003-08-21
JP2010029220A (en) 2010-02-12
CN1753903B (en) 2010-05-12
US20100279280A1 (en) 2010-11-04
US20030235890A1 (en) 2003-12-25
EP1463745A2 (en) 2004-10-06
CN1753903A (en) 2006-03-29
EP1463745A4 (en) 2007-11-07
KR20100095652A (en) 2010-08-31
WO2003044176A9 (en) 2003-10-16
WO2003044176A3 (en) 2004-07-29
JP4492849B2 (en) 2010-06-30
CA2467717A1 (en) 2003-05-30
AU2002359431A8 (en) 2003-06-10
KR20040066832A (en) 2004-07-27
JP2005509432A (en) 2005-04-14
WO2003044176A2 (en) 2003-05-30

Similar Documents

Publication Publication Date Title
CN1753903B (en) Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
CN101238222B (en) Genetic variants in the TCF7L2 gene as diagnostic markers for risk of type 2 diabetes mellitus
US20020146700A1 (en) Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US20050282198A1 (en) Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
AU784224B2 (en) Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
CN103547680B (en) Improved method and kit for determining severity and progression of periodontal disease
US8105775B2 (en) IL-1 gene cluster and associated inflammatory polymorphisms and haplotypes
WO2006128042A2 (en) Methods of identifying mutations in nucleic acid
US20080254477A1 (en) il-1 gene cluster and associated inflammatory polymorphisms and haplotypes
ES2261239T3 (en) DIAGNOSIS AND THERAPY FOR OSTEOPOROSIS.
ES2356167T3 (en) METHOD OF DIAGNOSIS AND THERAPY FOR DISEASES ASSOCIATED WITH AN IL-1 INFLAMMATORY HOPLOTIPO.
US20080118920A1 (en) Diagnostics And Therapeutics For Diseases Associated With An Il-1 Inflammatory Haplotype
US20080311581A1 (en) Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
KR100924468B1 (en) The il-1 gene cluster and associated inflammatory polymorphisms and haplotypes
Klar Positional Cloning of Disease Causing Genes: A Genetic Study of Obesity, Ichthyosis Prematurity Syndrome and Meniere's Disease

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1153504

Country of ref document: HK

C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20110126

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1153504

Country of ref document: HK