CN101932595A - Phage phi-mru polynucleotides and polypeptide and application thereof - Google Patents

Abstract

The present invention includes the phage that contains phage induction, phage particle and phage genome

Description

Phage phi-mru polynucleotides and polypeptide and application thereof

Related application

The application requires the U. S. application submitted on September 25th, 2007 number 60/975, the U. S. application that the U. S. application of submitting on September 22nd, 104,2007 is submitted to number on November 22nd, 60/989,840 and 2007 number 60/989,841 right of priority, it is for referencial use to include above-mentioned all content whole in this paper.

Technical field

The present invention relates to the inhibition molecule is delivered to microorganism cells, is the composition and the method for methanogen cell specifically.Specifically, the present invention relates to new phage of identifying The polynucleotide that comprise phage induction, phage particle, phage genome, phage polypeptide and these polypeptide of encoding.The invention still further relates to and be used to produce these polypeptide expression carrier and host cells.The invention still further relates to and use disclosed phage, polypeptide, polynucleotide, expression vector and host cell is surveyed, target and suppress microorganism cells, especially the method for methanogen cell.

Background of invention

In New Zealand, rural activity is the main source of greenhouse gas emission.Therefore, reducing the agricultural greenhouse gaseous emission is important for the obligation that New Zealand finishes the Kyoto Protocol.Protocol call before commitment period (2008-2012) first finishes reduction of greenhouse gas discharge to the nineteen ninety level.For this reason, agricultural sector and Government Of New Zealand have been set up the rural area greenhouse gases and have been studied the method that Zelanian agricultural greenhouse gaseous emission is sought to reduce by federations (PGGRC).

Integral part of PGGRC active is that research reduces the discharge of methane amount of herding ruminating animal from New Zealand.For two reasons, reducing the methane discharge of ruminant measurer has commercial benefits.At first, failing to carry out Kyoto Protocol promise will force government to buy the carbon emission amount.Estimate that at present this will spend 300,015,000 U.S. dollars.The second, the generation of methane causes the total energy loss 8-12% that produces in the cud.Can utilize this energy to improve the production performance of ruminating animal.

By the microorganisms that is called methanogen, this microorganism belongs to the part of archeobacteria (Archaea) the wide ancient bacterium door in boundary (euryarchaeota) to methane in cud.Most methanogens rely on CO ₂And H ₂As they unique energy derives, but some can use acetate or methyl compound growth.Exist multiple not generic to produce the ancient bacterium of methane in the cud, but the kind in the methane brevibacterium sp, especially ruminate methane tyrothricin (M.ruminantium) and Shi Shi methane tyrothricin (M.smithii) is considered to methanogen main in the New Zealand ruminating animal, ruminate the research object that the methane tyrothricin is PGGRC fund assistance gene order-checking project at present.This project checks order for the genome of knurl position methanogen for the first time, is intended to the biology of methane tyrothricin (Methanobrevibacter) is set up better understanding, to find to suppress the target spot that methane produces.

Methane produces in the minimizing cud needs to suppress methanogen or makes its methane generate the path inactivation.A kind of method that suppresses the methane generation is specificity to be suppressed molecule be delivered in the methanogen cell.Can use the reagent such as the phage of selectively targeted methanogen to reach this purpose by (for example).Phage to several non-cud methanogens characterizes, but not have to report about infecting or the phage of cracking cud methanogen.Therefore, the evaluation phage very advantageous that can infect the methanogen cell and/or send inhibitor.

Summary of the invention

The present invention relates to a kind of isolating phage Comprise phage particle and/or phage genome that this paper describes in detail with form production in whole or in part, and isolating phage polynucleotide and polypeptide.

The invention still further relates to a kind of isolated polypeptide, it comprises at least one phage aminoacid sequence that is selected from SEQ ID NO:1-69.One concrete aspect, described polypeptide comprises the aminoacid sequence that is selected from SEQ ID NO:2-5 and 62-68.On the other hand, described polypeptide comprises the aminoacid sequence of SEQ ID NO:63.On the other hand, described polypeptide is a fragment, for example comprises the aminoacid sequence that at least one extends residue 32-186 in SEQ IDNO:63.

The invention still further relates to a kind of isolating polynucleotide, it comprises the encoding sequence of at least a phage polypeptide.In one aspect, described polynucleotide comprise the encoding sequence that at least one is selected from the aminoacid sequence of SEQ ID NO:1-69.One concrete aspect, described polynucleotide comprise the encoding sequence of the sequence that is selected from SEQ IDNO:2-5 and 62-68.On the other hand, described polynucleotide comprise the encoding sequence of SEQ IDNO:63.On the other hand, described polynucleotide comprise the fragment of certain encoding sequence, this encoding sequence coding, and for example, at least one extends the aminoacid sequence of residue 32-186 in SEQ ID NO:63.

On the other hand, the present invention relates to a kind of isolating polynucleotide, it comprises the bacteriophage nucleic acid sequence that is selected from SEQ IDNO:74-142.. in particular aspects, described polynucleotide comprise and are selected from SEQ IDNO:75-78 and 135-141, or more specifically are the nucleotide sequences of SEQ ID NO:136.On the other hand, described polynucleotide are to comprise fragment or the oligonucleotide that for example extends the nucleotide sequence of Nucleotide 94-558 in SEQ ID NO:136.In addition, the present invention includes a kind of isolating polynucleotide or its fragment, these polynucleotide or its fragment can with arbitrary nucleic acid array hybridizing among the SEQ ID NO:74-142.The present invention also comprises a kind of isolating polynucleotide, and these polynucleotide contain complement, reverse complemental thing, reverse sequence or its fragment of arbitrary described nucleotide sequence.

The present invention relates to a kind of expression vector, it comprises the polynucleotide of the encoding sequence that contains at least a phage polypeptide.In one aspect, described expression vector comprises the encoding sequence that at least one is selected from the aminoacid sequence of SEQ IDNO:1-69.A particular aspects, described expression vector comprises the encoding sequence of at least one aminoacid sequence among SEQ ID NO:2-5 and the 62-68.On the other hand, described expression vector comprises the encoding sequence of the aminoacid sequence of at least one SEQ ID NO:63.On the other hand, described expression vector comprises the encoding sequence that at least one extends the aminoacid sequence of residue 32-186 in SEQ ID NO:63.

One concrete aspect, the present invention relates to produce phage as detailed in this article with complete or portion-form Expression vector.Specifically, described expression vector can produce the phage of phage particle, phage genome or modification, comprises its any version, derivative, variant or fragment.

The invention still further relates to the host cell that comprises at least a expression vector, for example microbial host cell.

The invention particularly relates to the antibody of polypeptide disclosed herein or polynucleotide.In some aspects, described antibody is selected from peptide sequence or its fragment of SEQ ID NO:1-69 at least one.On the other hand, described antibody is at least one fragment or its complementation or the modification sequence of the polynucleotide that are selected from SEQ ID NO:74-142.On the other hand, described antibody comprises and at least a cytostatics, example is anti-as detailed in this article-and methane generates one or more fusions or the conjugate that compound (as, bromo ethyl sulfonic acid), antibody and antibody fragment, lyase, peptide nucleic acid(PNA), antimicrobial peptide and other microbiotic produce.

The invention still further relates among the SEQ ID NO:1-69 for example the phage polypeptide of at least one modification, it comprises biologic activity version, fragment, variant and derivative as described herein.For example the invention still further relates at least one the antibody of modification among the SEQ ID NO:1-69, it comprises biologic activity version, fragment, variant and derivative as described herein.The invention still further relates to the polynucleotide of these modified polypeptides of coding, and the version of disclosed polynucleotide, fragment, variant and derivative, the host cell that comprises the expression vector of these polynucleotide and comprise these carriers.Aspect concrete, the compositions and methods of the invention use the polynucleotide or the polypeptide of these modifications, or corresponding expression vector or host cell.

In addition, the present invention relates to phage polypeptide, as at least a or its modification sequence among the SEQ ID NO:1-69, comprise and at least a cytostatics, anti-as detailed in this article-methane generates fusions or the conjugate that compound (as, bromo ethyl sulfonic acid), antibody and antibody fragment, lyase, peptide nucleic acid(PNA), antimicrobial peptide and other microbiotic form.

The present invention relates to a kind of composition, said composition comprises at least a or its modification sequence among isolated polypeptide such as the SEQ ID NO:1-69.The invention still further relates to a kind of composition, said composition comprises at, the antibody of at least a or its modification sequence among the SEQ ID NO:1-69 for example.The invention still further relates to a kind of composition, said composition comprises isolating polynucleotide, as at least a among the SEQ ID NO:74-142 or it is complementary or modification sequence.The invention still further relates to a kind of composition, said composition comprises the host cell that expression vector of the present invention or the present invention contain expression vector.Described composition can comprise any in biologic activity version described herein, fragment, variant and the derivative.Described composition can comprise at least a cytostatics (as, as fusions or conjugate) and can be mixed with, for example, pharmaceutical composition or food supplement specifically are ruminant feed components.

The invention still further relates to conduct according to disclosed method target and/or inhibition microorganism cells, the particularly present composition of the part of the test kit of methanogen cell.This test kit comprises: a) the listed composition of at least a this paper; And b) randomly comprises, with its (for example) targeted cells or suppress methanogen or growth of other microbial cell or the working instructions that duplicate.

The present invention relates to a kind of method that produces phage, described method comprises: a) be fit to produce culture expression carrier under the phage condition or containing the host cell of expression vector, described expression vector comprises at least a portion of phage genome; And b) from culture, reclaims this phage.In particular aspects, this phage comprises at least one polypeptide that is selected from SEQ ID NO:1-69 or its modification sequence.Aspect other, this phage comprises at least one polynucleotide that are selected from SEQ ID NO:74-142 or its modification sequence.

The invention still further relates to a kind of method that produces phage polypeptide, described method comprises: a) be fit to culture expression carrier under the expression of polypeptides condition or containing the host cell of expression vector, described expression vector comprises at least a portion of the encoding sequence of at least a phage polypeptide; And b) from culture, reclaims this polypeptide.In particular aspects, described polypeptide comprises at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its modification sequence.

In addition, the invention still further relates to a kind of method that produces phage polypeptide, at least a among this polypeptide such as the SEQ IDNO:1-69, comprise and at least a cytostatics, anti-as detailed in this article-methane generates fusions or the conjugate that compound (as, bromo ethyl sulfonic acid), antibody and antibody fragment, lyase, peptide nucleic acid(PNA), antimicrobial peptide and other microbiotic form.These class methods comprise: a) be fit to culture expression carrier under the condition of expression of polypeptides or comprising the host cell of expression vector, described expression vector comprises the encoding sequence of at least a phage polypeptide; B) form phage fusions or conjugate (as, by express fusion sequence or with the cytostatics chemical coupling); And c) reclaims this fusions or conjugate.In particular aspects, described polypeptide comprises at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its modification sequence.

In addition, the present invention relates to a kind of inhibition microorganism cells (as suppressing its growth or duplicating), specifically is the method for methanogen cell, and this method comprises: a) the optional generation or the separating at least one phage polypeptide; And b) described cell is contacted with described phage polypeptide.A particular aspects, described polypeptide comprises at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its modification sequence.

In addition, the present invention also comprises a kind of inhibition microorganism cells (as suppressing its growth or duplicating), specifically is the method for methanogen cell, and this method comprises: a) the optional generation or the separating at least one phage polypeptide, and it also comprises at least a cytostatics; And b) described cell is contacted with described phage polypeptide.A particular aspects, described polypeptide comprises at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its modification sequence.

The invention still further relates to a kind of detect and/or measure phage level or the phage polypeptide of correspondence or the method for polynucleotide level, this method comprises: 1) will contact with antibody from the sample of object, described antibody is at phage polypeptide (as, at least a or its modification sequence among the SEQ ID NO:1-69) or corresponding polynucleotide; With 2) detect with sample in the existence or the level of the antibody complex that forms of polypeptide or polynucleotide.These class methods also can be used for detecting and/or measuring microorganism cells, specifically are the levels of methanogen cell.

The invention still further relates to a kind of the more method of Nucleotide (as the phage encoded sequence) level of phage level or corresponding phage that detects and/or measure, this method comprises: 1) will from the sample of object and complementary polynucleotide (as with SEQ ID NO:74-142 in each or its modification sequence complementary sequence) contact; And 2) existence or the level of the hybridization complex of mensuration and sample pnagus medius polynucleotide formation.These class methods also can be used for detecting and/or measuring microorganism cells, specifically are the levels of methanogen cell.

In particular aspects, method of the present invention is used in the body or the vivoexpression assembly.In others, the present invention uses reorganization, synthetic or polypeptide that semisynthesis produces, or the polypeptide that produces of endogenous method.

Others of the present invention and embodiment are as mentioned below.

Brief Description Of Drawings

Present invention is described as a reference with specific implementations of the present invention and accompanying drawing.

Figure 1A-1B. ruminates methane tyrothricin prophage

Show the phage functional module and the gene structure (Figure 1B) of inferring integration site sequence attL and attR (Figure 1A) and prediction.

Fig. 1 C: carry out phage induction with sterile air (oxygen pressure).

Fig. 1 D: phage is initially induced with ametycin.

Fig. 1 E: induce (oxygen stimulation) and not inductive ruminate the agarose gel electrophoresis of the pcr amplification product of methane tyrothricin.The the 2nd and the 4th swimming lane: the 1kb dna ladder marker of Ying Jun company (Invitrogen).The 1st with the 3rd swimming lane represent respectively use primer to R1F-L2R to separate self-induction and not the inductive DNA that ruminates methane tyrothricin culture carry out the product of PCR.

Fig. 2. prophage

Open reading frame note and note.

Fig. 3. prophage

Open reading frame note, function prediction and note.

Fig. 4 A-4B. ruminates methane tyrothricin prophage

Sequence information comprises phage

Encoding sequence (Fig. 4 A) and aminoacid sequence (Fig. 4 B).

Fig. 5. phage

The sequence alignment of the PeiP of ORF 2058 and Marburg methagen (M.marburgensis) and the PeiW of Wo Shi methagen (M.wolfeii).

Fig. 6: the protein sequence sign from the signal peptide sequence of ruminating the methane tyrothricin of using LogoBar to create has shown the core shared signal.

Fig. 7: ORF2058 is to ruminating the retarding effect of methane tyrothricin resting cell.

Fig. 8: ORF2058 is to ruminating the retarding effect that growth of methane tyrothricin cell and methane produce.

Embodiment

Definition

As described herein, the nucleotide sequence of " change " coding phage polypeptide comprises that those have different nucleotide deletions, insertion or replacement, obtains the nucleic acid of the polynucleotide of the identical or functional equivalent polypeptide of optimized encoding.Encoded polypeptides or antibody can be " changes " also, and comprise disappearance, insertion or the replacement of amino-acid residue, produce the reticent polypeptide that changes and obtain functional equivalent.As long as the biologic activity of polypeptide (as cell in conjunction with, cell is penetrating or lysis) or immunologic competence (as one or more antibody combining sites) kept, can on the similar basis of polarity, electric charge, solvability, hydrophobicity, wetting ability and/or the amphiphilic nature of residue, have a mind to carry out aminoacid replacement.For example, electronegative amino acid can comprise aspartic acid and L-glutamic acid; The amino acid of positively charged can comprise Methionin and arginine; The amino acid of the uncharged polar head group that the possess hydrophilic property value is similar comprises leucine, Isoleucine and Xie Ansuan, glycine and L-Ala, l-asparagine and glutamine, Serine and Threonine and phenylalanine and tyrosine.

" aminoacid sequence " as used herein refers to oligopeptides, peptide, polypeptide or protein sequence and any fragment thereof, and refers to natural generation, reorganization, synthetic or semisynthetic molecule.Sequence of the present invention comprises at least 5,10,15,20,25,30,35,40,45,50,100,150,200,250 amino acid, preferred 5-10,10-20,20-30,30-40,40-50,50-100,100-150, a 150-200 or 200-250 or 250-4000 amino acid at least, and preferably keep original series biologic activity (as cell in conjunction with, cell is penetrating or lysis) or immunologic competence (as one or more antibody combining sites).When this paper quotes aminoacid sequence, the aminoacid sequence that " aminoacid sequence " refers to natural generation peptide molecule, and during similar terms, be not intended to aminoacid sequence is restricted to the complete original amino acid relevant with full-length molecule.

" amplification " used herein refers to produce other copy of nucleotide sequence, common polymerase chain reaction (PCR) technological operation (Dieffenbach that uses the present invention to know, C.W. and G.S.Dveksler (1995) " PCR primer, laboratory manual, cold spring port press, New York Plainview " (PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, NY)).

Term " antibody " is interpreted as possibility implication the most widely, and is intended to comprise complete monoclonal antibody and polyclonal antibody.Also be intended to cover antibody fragment and derivative, as long as it shows biologic activity.Antibody comprises the active part of immunoglobulin molecules and immunoglobulin (Ig) (Ig) molecule, promptly comprises the molecule of the antigen binding site of specificity conjugated antigen (with its immune response).These include but not limited to: polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fc, Fab, Fab ' and Fab ₂Fragment and Fab expression library.

Antibody molecule relates to any kind of of IgG, IgM, IgA, IgE and IgD, and the difference between them is the characteristic of heavy chain in the molecule.They also comprise subclass, as IgG1, IgG2 and other.Light chain can be κ chain or λ chain.When mentioning antibody, this paper comprises all classes, subclass and type.Also comprise chimeric antibody, for example have specific monoclonal antibody or its fragment as one or more mouse, people or ruminating animal sequence for more than a kind of source.Also comprise alpaca antibody or nano antibody.Should be understood that herein and mention " antibody " or any similar terms comprises complete antibody, and any fragment, version, derivative or variant.

Term as used herein " biologic activity " or " functional " refer to keep one or more structures, immunology or biochemical function (as cell in conjunction with, cell is penetrating or lysis) polypeptide.

Term used herein " cytostatics " or " inhibitor " refer to reduce or hinder the reagent that microorganism cells, especially methanogen cell are grown or duplicated.Cytostatics can be used for reducing or hindering as cell fission.Inhibitor for example can reduce or block that DNA is synthetic, RNA is synthetic, protein synthesis or posttranslational modification.Inhibitor also can reduce or block the activity of the enzyme that participates in methane generation path.But inhibitor is targeted cells also, so that the immunity system component recognition.Suppress cell and also comprise cell killing and necrocytosis, for example by realizations such as cracking, apoptosis, necrosis.Useful inhibitor comprises but is not limited to: anti-as detailed in this article methane generates compound (as the bromo ethyl sulfonic acid), antibody and antibody fragment, lyase, peptide nucleic acid(PNA), antimicrobial peptide and other microbiotic.

Term used herein " complementary " or " complementarity " refer to that polynucleotide are by the base pairing natural combination under salt that allows and temperature condition.For sequence A-G-T, complementary sequence is T-C-A, and reverse complemental is A-C-T and reverse sequence is T-G-A.Article two, the complementarity between single chain molecule can be a part, and some nucleic acid combinations are promptly only arranged, and perhaps is complementary fully, promptly when existence between single chain molecule is complementary fully.The complementary degree of nucleic acid interchain has the significance influence for the efficient and the intensity of nucleic acid chains intermolecular hybrid.This is even more important for the design and use that rely on nucleic acid chains bonded amplified reaction and pna molecule.

Term used herein " derivative " refers to the coding nucleic acid of phage polypeptide or the chemically modified form of complementary nucleic acid with it.This type of modification for example comprises, with alkyl, acyl group or the amino hydrogen that replaces.Aspect preferred, the nucleic acid derivative encoded polypeptides keeps the biology or the immunologic function of natural molecule.

The polypeptide of deriving is by glycosylation, pegization or any similar process modified polypeptides, it kept its one or more biological functions that come source sequence (as cell in conjunction with, cell is penetrating or lysis) or immunologic function.

Term used herein " homology " refers to complementarity to a certain degree.Can be portion homologous (that is, 1 is identical) or complete homology (that is, 100% is identical).Functions of use term " basic homology " refers to the part complementary sequence of small part inhibitory phase with sequence and target nucleic acid hybridization.Can under low preciseness condition, use the inhibition of hybrid experiment (Southern or northern trace, solution hybridization etc.) check to fully-complementary sequence and target sequence hybridization.Basic homologous sequence or hybridization probe will compete and suppress combining of complete homologous sequence and target sequence under low preciseness condition.This is not low preciseness conditions permit non-specific binding; It is that specificity (selectivity) interacts that low preciseness condition needs mutually combining of two sequences.

Term as used herein " hybridization " refers to that nucleic acid chains is by base pairing and any process of complementary strand bonded.

" insertion " used herein or " adding " refer to amino acid or nucleotide sequence are changed, and compare with the molecule of natural generation, cause adding one or more amino-acid residues or Nucleotide.

" methanogen " used herein refers to produce the microorganism of methane gas, comprises methane tyrothricin (Methanobrevibacter), methane thermophilic bacteria (Methanothermobacter), methane germ (Methanomicrobium), methagen (Methanobacterium) and sarcina methanica (Methanosarcina).Concrete methanogen includes but not limited to: ruminate methane quarter butt (Methanobrevibacter ruminantium), Shi Shi methane tyrothricin (Methanobrevibactersmithii), acid methane tyrothricin (Methanobrevibacter acididurans), Chao Shi methane tyrothricin (Methanobrevibacter thaueri), Bu Shi methagen (Methanobacterium bryantii), formic acid methagen (Methanobacterium formicicum), Marburg methane thermophilic bacteria (Methanothermobacter marburgensis), Wo Shi methane thermophilic bacteria (Methanothermobacter wolfeii), Si Shi methane ball bacteria (Methanosphaerastadtmanae), motion methane germ (Methanomicrobium mobile), Pasteur's sarcina methanica (Methanosarcina barkeri), Mei Shi sarcina methanica (Methanosarcina mazei), Bu Shi intends methane coccus (Methanococcoides burtonii) and Tai Shi methane leaf bacterium (Methanolobustaylorii).The genus of all methanogens and kind are all in this term covering scope.

" microorganism cells " used herein refers to the microorganism cells of natural generation or genetic modification, comprise archeobacteria such as methanogen, halophilic microorganism and have a liking for sour thermophile bacteria, and eubacterium, as blue-green algae, spirochete, bacteroid and gram-positive and gram-negative bacteria.

Term " modification " refers to sequence and sequence fragment, variant and the derivative of change as described herein.

" nucleotide sequence " used herein or " nucleotide sequence " refer to polynucleotide sequence, oligonucleotide or its fragment, and the DNA or the RNA in natural, reorganization, synthetic or semi-synthetic source, they can be strand or two strands, and can represent justice or instead with chain and coding or non-coding region.Sequence of the present invention most preferably comprises and comprises at least 12,15,30,45,60,75,90,105,120,135,150,300,450,600,750 Nucleotide, the polypeptid coding sequence of preferred 15-30,30-60,60-90,90-120,120-150,150-300,300-450, a 450-600 or 600-750 Nucleotide at least or at least 1000 Nucleotide or at least 1500 Nucleotide.Be understood that the everywhere mentions that " nucleotide sequence " or " nucleotide sequence " will comprise original, full length sequence herein, and any complementary sequence, fragment, version, derivative or variant.

Term " oligonucleotide " refers to comprise at least 6,8,10,12,15,18,21,25,27,30 or 36 Nucleotide or 12-36 the Nucleotide or the nucleotide sequence of 15-30 Nucleotide at least at least, can be used for for example pcr amplification, order-checking or hybrid experiment.As used herein, " oligonucleotide " is equal to " amplified material ", " primer ", " oligomer ", " oligonucleotide " and " probe " substantially, as this area defines usually.

" polypeptide " used herein refers to isolated polypeptide of the present invention, and it is available from any species, preferred microorganism, and the source of any natural, synthetic, semi-synthetic or reorganization.Specifically, phage polypeptide can as methane tyrothricin (Methanobrevibacter) cell, specifically be to ruminate methane tyrothricin or Shi Shi methane tyrothricin cell available from the methanogen cell.Produce for reorganization, polypeptide of the present invention can be available from microorganism or eukaryotic cell, for example intestinal bacteria (Escherichia), suis (Streptomyces), genus bacillus (Bacillus), salmonella (Salmonella), yeast, insect cell such as fruit bat cell, zooblast such as COS and Chinese hamster ovary celI or vegetable cell.Be understood that the everywhere mentions that " polypeptide " will comprise original, full length sequence herein, and any fragment, version, derivative or variant.

The term " polynucleotide " of used herein odd number or plural form refers generally to any nucleotide sequence, for example, any poly-ribonucleotide or poly-deoxyribonucleotide, it can be the RNA or the DNA of unmodified, perhaps RNA of Xiu Shiing or DNA.Include but not limited to: strand and double-stranded DNA, comprise the DNA of strand and double stranded region, strand and double-stranded RNA and comprise strand and the RNA of double stranded region comprise the hybrid molecule (can be strand or (more typical) double-stranded or comprise strand and double stranded region) of DNA and RNA.Also comprise three sequences that contain RNA or DNA or RNA and DNA.Specifically, comprise mRNA, cDNA and genomic dna and any fragment thereof.This term comprises and contains one or more modified bases as containing the DNA and the RNA of tritium base or non-common base such as inosine.Polynucleotide of the present invention can be contained coding or non-coding sequence, or justice or antisense sequences or iRNA such as siRNA.Be understood that the everywhere mentions that " polynucleotide " or similar terms will comprise full length sequence herein, and any complementary sequence, fragment, version, derivative or variant.

" peptide nucleic acid(PNA) " used herein or " PNA " refer to antisense molecule or anti--gene reagent, and it comprises the base that connects by the peptide main chain.

Term used herein " ruminating animal " refers to have cud as the Alimentary animal of specific type.Ruminating animal includes but not limited to: ox, sheep, goat, buffalo, elk, antelope, caribou and deer.

Term used herein " rigorous condition " or " preciseness " refer to the hybridization conditions that nucleic acid, salt and temperature limit.These conditions are known in the art, can change these conditions to identify or to detect identical or relevant polynucleotide sequence.Referring to for example Sambrook, J. etc. (1989) " molecular cloning, laboratory manual " cold spring port press, New York Plainview (Molecular Cloning, A LaboratoryManual, Cold Spring Harbor Press, Plainview, NY), and Ausubel, the newly organized molecular biology experiment guide of F.M. etc. (1989), John Wei Lisen press, New York (CurrentProtocols in Molecular Biology, John Wiley﹠amp; Sons, New York, NY).Several equal conditions that comprise low or high preciseness depend on following factor, as the concentration of the length of sequence and characteristic (DNA, RNA, based composition), target spot characteristic (DNA, RNA, based composition), environment (in solution or be fixed on the solid substrate), salt and other composition (as methane amide, sulfuric acid dextran and/or polyoxyethylene glycol) and temperature of reaction (from being lower than 5 ℃ of probe melting temperature(Tm)s to being lower than in about 20 ℃-25 ℃ scope of melting temperature(Tm)).Can change one or more factors are different from or are equal to above-mentioned condition with generation low or high preciseness.

Term " object " comprises people or non-human animal.The non-human animal includes but not limited to: birds and Mammals as ruminating animal, specifically are mouse, rabbit, cat, dog, pig, sheep, goat, ox and horse.

Term used herein " basic purifying " or " separation " refer to the nucleic acid or the aminoacid sequence that shift out from cell, reorganization or synthetic environment, and at least 60%, preferred 75% and most preferably at least 90% or at least 99% does not contain other component that they are associated in cell, reorganization or synthetic environment at least.

" conversion " defined herein refers to that foreign DNA enters and changes the process of accepting cell.Can use several different methods known in the art under natural or artificial condition, to transform.Transform the responsible any currently known methods that exogenous nucleic acid sequences is inserted protokaryon or eukaryotic host cell.Based on need transformed host cells type selection method, can include but not limited to virus infection, electroporation, heat-shocked, lipofection and particle bombardment.This type of " conversion " cell comprises stable transformed cells, and wherein the DNA of Cha Ruing can duplicate as autonomously replicating plasmid or as the part of host chromosome.They also are included in transient expression inserts during the limiting time DNA or the cell of RNA.

Polypeptide as used herein " variant " refers to the aminoacid sequence of one or more amino acid changes.Change one or more Nucleotide of variant polynucleotide.Variant can cause " conservative property " to change, and wherein the amino acid of Qu Daiing has analog structure or chemical property, as replacing leucine with Isoleucine.More rare, variant can cause " non-conservation " to change, as replacing glycine with tryptophane.Similar little variation can comprise that also aminoacid deletion or insertion or both all have.Use well known computer program such as LASERGENE software (DNASTAR) can find how to determine can which aminoacid replacement, insertion or disappearance not destroyed the guide of biology or immunologic competence.

The present invention also contain at least a biologic activity that keeps polypeptide (as cell in conjunction with, cell is penetrating or lysis) or the variant of immunologic competence.Preferred variant is to have variant basic identical or the functional equivalent sequence, for example with openly sequence at least 80% and the more preferably identical variant of at least 90% sequence.Most preferred variant is and open sequence at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8% or at least 99.9% identical variant of sequence of this paper.As described below by to relatively two sequences comparison of need, determine the identical residue number of comparison part, divided by the total residue number of the present invention's (inquiry) sequence and multiply by 100, thereby definite homogeny percentage ratio.Useful comparison program is AlignX (carrier NTI).

Detailed Description Of The Invention

Methane is produced by methanogen in the ruminating animal anterior intestine, and it is the end last reduzate of carbon in the cud system.A plurality of steps of methane generation path are set forth, mainly come from research, but still do not understand for the adaptability that makes methanogen in cud, grow and continue to exist to non-cud methanogen.Ruminating methane tyrothricin (Methanobrevibacter ruminantium) is main methanogen in New Zealand's ruminating animal body.As described herein, the genome of ruminating the methane tyrothricin is checked order, show the about 3.0Mb of size, GC content is 33.68%.A unexpected discovery is to ruminate methane tyrothricin genome to comprise that the prophage sequence (is called

), this sequence has the unique function module of the integration of coding phage, dna replication dna and packing, capsid protein matter, cracking and lysogeny transition function.

When carrying out high-flux sequence, find that genomic 30-40kb zone excessively occurs, and therefore finds to ruminate methane tyrothricin phage in the order-checking clone.This shows that a genomic part occurs with the copy number that is higher than common level, and this may duplicating owing to resident phage.Zone to excessive appearance is studied, and the detailed bioinformatic analysis of prediction open reading frame shows that it contains phage sample gene.Proved that low GC district that phage sequence (lysogeny conversion) far-end is found contains the DNA sulfur modification system (dnd) of prediction, other modification that provides of host or foreign DNA may be provided for it.This paper has described in detail and has ruminated methane tyrothricin prophage sequence.At different aspect of the present invention, can use prophage polynucleotide and polypeptide as the means that in cud, suppress methanogen and/or methane generation, and further illustrate the effect of methane tyrothricin in methane forms of ruminating.

Therefore, the present invention includes phage polypeptide, comprise the those polypeptides that contains at least a or its fragment, variant and derivative among the SEQ ID NO:1-69 at least.The present invention also comprises the application of these polypeptide in target and inhibition microorganism cells, especially methanogen cell.The present invention also comprises the application of this polypeptide in suppressing this type of cell growth or duplicating.Can express polypeptide of the present invention and be used for different experiments to measure its biologic activity.This polypeptide can be used for extensive synthetic and separating experiment scheme, for example, is used for commercial production.Can use this type of polypeptide to produce antibody, to separate amino acid sequence corresponding and amino acid sequence level is carried out quantitative assay.Polypeptide of the present invention also can be used as composition, and for example pharmaceutical composition and food supplement are as ruminant feed components.Polypeptide of the present invention also has health advantages.In healthy related fields, the methanogen inhibitor can be used for recovering usually with the energy of methane form from the individuality loss.In particular aspects, slowly-releasing cud device can with polypeptide of the present invention and composition (as pharmaceutical composition and food supplement) coupling.

Polypeptide of the present invention comprises at least one sequence that is selected from down group: (a) comprise the polypeptide that at least one is selected from the aminoacid sequence of SEQID NO:1-69 or its fragment, variant or derivative; (b) comprise the polypeptide that at least one is selected from the SEQ ID NO:1-69 and the functional structure territory of the aminoacid sequence of its fragment, variant; And at least one fixed number purpose of at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its variant or derivative that (c) comprises is adjoined the polypeptide of residue.In one embodiment, the present invention includes the isolated polypeptide that contains at least one aminoacid sequence among the SEQ ID NO:1-69.All these sequences are referred to as polypeptide of the present invention.

The present invention also comprises at least a phage polypeptide of coding, comprises the polynucleotide of SEQ ID NO:1-69 and fragment thereof, variant and derivative.The present invention comprises that also these polynucleotide are in preparation target and the inhibition microorganism cells especially expression vector of methanogen cell and the application in the host cell.The present invention also comprises the application of polynucleotide in suppressing this type of cell growth or duplicating.Isolating polynucleotide of the present invention also can be used for more or less relevant phage is carried out genomic mapping, physical mapping and gene clone.By well known technology such as slit engram technology or microarray technology, can use polynucleotide designed probe in cell, to have existence and the expression pattern that detects gene in any organism of abundant homologous dna and RNA sequence according to the present invention.Use the primer of polynucleotide design of the present invention to can be used for order-checking and pcr amplification.Polynucleotide of the present invention also can be used as composition, for example pharmaceutical composition and food supplement, as, ruminant feed components.Polynucleotide of the present invention also have health advantages.For this type of benefit, the host cell that polynucleotide can be used as expression vector or contain expression vector provides.In particular aspects, slowly-releasing cud device can with polynucleotide of the present invention, carrier, host cell and composition (as pharmaceutical composition and food supplement) coupling.

Polynucleotide of the present invention comprise at least one sequence that is selected from down group: the sequence that (a) comprises the encoding sequence of at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its fragment or variant; (b) at least one is selected from complementary sequence, reverse sequence and the reverse complementary sequence of encoding sequence of the aminoacid sequence of SEQ ID NO:1-69 or its fragment or variant; (c) at least one is selected from contained open reading frame in the encoding sequence of aminoacid sequence of SEQ ID NO:1-69 or its fragment or variant; (d) at least one is selected from the functional structure territory of encoding sequence of the aminoacid sequence of SEQ ID NO:1-69 or its fragment or variant; And at least one fixed number purpose that (e) contains the encoding sequence of at least one aminoacid sequence that is selected from SEQ ID NO:1-69 or its variant sequence of adjoining residue.In one aspect, the present invention includes the separation polynucleotide of the encoding sequence that comprises at least one aminoacid sequence that is selected from SEQ ID NO:1-69.

Polynucleotide of the present invention comprise at least one sequence that is selected from down group: (a) comprise the sequence that at least one is selected from the nucleotide sequence of SEQ ID NO:74-142 or its fragment or variant; (b) at least one is selected from complementary sequence, reverse sequence and the reverse complementary sequence of encoding sequence of the nucleotide sequence of SEQ ID NO:74-142 or its fragment or variant; (c) be selected from contained open reading frame in the nucleotide sequence of SEQ ID NO:74-142 or its fragment or variant; (d) at least one is selected from the functional structure territory of encoding sequence of the nucleotide sequence of SEQ ID NO:74-142 or its fragment or variant; And at least one fixed number purpose that (e) contains at least one nucleotide sequence that is selected from SEQ ID NO:74-142 or its variant sequence of adjoining residue.Oligonucleotide probe and primer and variant thereof available from any open sequence also are provided.All these polynucleotide and oligonucleotide are referred to as polynucleotide of the present invention in this article.

Those skilled in the art should be understood that, as the result of genetic code degeneracy, can produce the coding nucleotide sequence of a large amount of polypeptide of the present invention, and wherein the nucleotide sequence homology of the gene of some sequence and any known and natural generation is very little.Therefore, the present invention considers the nucleotide sequence variation that each and each are possible, and these variations can be by selecting the codon combination to produce according to the possibility codon.Standard bacterium three genetic codes according to the aminoacid sequence that is applied to natural generation produce these combinations, and all these type of variations all are considered specifically open.

The nucleotide sequence of coding phage polypeptide or its fragment or variant preferably under the rigorous condition of suitably selecting can with the nucleotide sequence hybridization of natural generation sequence.Yet what have advantage is to produce nucleotide sequence coded polypeptide or its fragment or derivative, that have obvious different codon uses.Use the frequency of specific cryptosystem according to the host, can select codon to improve the expression of polypeptides speed in specific protokaryon or the eucaryon host.For example, according to currently known methods, can be according to the escherichia coli expression optimizing codon.Other reason that changes the coding nucleotide sequence of polypeptide and derivative thereof and do not change amino acid sequence coded comprises producing to have more advantageous feature, the rna transcription thing the long half-lift of having more as the transcript that produces than natural generation sequence.

The present invention also comprises dna sequence dna or its fragment that produces coded polypeptide or its fragment or variant fully by synthetic chemistry.After composition sequence produces, utilize well known reagent, can be inserted in any available expression vector and the cell system.And, can use synthetic chemistry in coded polypeptide or its any variant or fragments sequence, to introduce sudden change.The present invention also is included in as Wahl, G.M and S.L.Berger (1987; Methods Enzymol.152:399-407) and Kimmel, A.R. (1987; Methods Enzymol.152:507-511) under the various rigorous condition of being instructed, can with those and the complementary sequence thereof that show among polynucleotide sequence, especially the SEQ ID NO:74-149 of the nucleotide sequence hybridization of prescription.

Dna sequencing method well known and commonly used can be used for putting into practice any embodiment of the present invention.These class methods can be used the Klenow fragment as dna polymerase i, SEQUENASE (U.S. biological chemistry group (U.S.Biochemical Corp.), Ohio Ke Lifu orchid) (U.S.BiochemicalCorp, Cleveland, OH), Taq polysaccharase (perkin elmer) (Perkin Elmer), thermally-stabilised T7 polysaccharase (An Fama West Asia biotech company, the New Jersey Piscataway) (AmershamPharmacia Biotech Piscataway, NJ), the perhaps combination of polysaccharase and check and correction exonuclease, those that find in the ELONGASE amplification system as Life Technologies, Inc. (Life Technologies) (Gaithersburg, the Maryland State) sale.Preferably, this method is undertaken by the machine automatization, as Hamilton microscale experiment chamber 2200 (Hamilton Micro Lab 2200) (state of Nevada Reynolds Hamilton) (Hamilton, Reno, NV), send and special thermal cycler (Peltier Thermal Cycler) (PTC200; MJ research company, the Massachusetts water is honest) (MJ Research, Watertown, MA); ABI catalysis instrument (ABI Catalyst) and 373 and 377DNA sequenator (perkin elmer) (Perkin Elmer) or gene order-checking instrument 20 ^TM(Luo Shi diagnostic companies) (Roche Diagnostics).

Can use partial nucleotide sequence and utilize detection upstream sequence known in the art such as the method for promotor and controlling element and downstream components such as terminator and non-coding RNA structure, the nucleic acid sequence encoding of polypeptide is expanded.For example, spendable a kind of method " site is restricted " PCR uses universal primer to obtain the unknown nucleotide sequence adjacent with the known seat (Sarkar, G. (1993) PCR MethodsApplic.2:318-322).Specifically, under the condition of joint sequence primer and the existence of known region Auele Specific Primer, genomic dna is increased first.Then extension increasing sequence is carried out second and take turns PCR, wherein use identical joint primer and another Auele Specific Primer in first primer.With suitable R NA polysaccharase each is taken turns the PCR product and transcribe, check order with reversed transcriptive enzyme.

Another useful method is an inverse PCR, be also referred to as IPCR (referring to for example, Ochman H, Gerber AS, Hartl DL.Genetics.1988 November; 120 (3): 621-3).When only knowing internal sequence of target DNA, can use inverse PCR.The inverse PCR method comprises that the DNA that uses the restriction endonuclease cutting carries out a series of digestion and connects certainly.This kind cutting is at the arbitrary terminal known array that produces of unknown nucleotide sequence.According to this method, by restriction endonuclease digestion with target DNA slightly cut into thousands of bases than small segment.Under lower concentration, induce then from connecting, cause that phosphate backbone forms and produces cyclic DNA again and connects product.Use known nucleic acid restriction endonuclease restrictive diges-tion target DNA then.In the known internal sequence, produce cutting thus, produce linear product with known end sequence.Can utilize this product then and carry out the PCR of standard with known internal sequence complementary primer.

Commercially available capillary electrophoresis system can be used for analyzing order-checking or PCR product nucleotide sequence size or it is confirmed.Specifically, the kapillary order-checking can use flowable polymer to carry out electrophoretic separation, and four kinds of different fluorescence dyes of laser excitation (every kind of a kind of Nucleotide of correspondence) are surveyed emission wavelength with charge-coupled device camera.Use suitable software (as genetic component type and sequence navigator, Perkinelmer Inc.) (GENOTYPER and Sequence NAVIGATOR, Perkin Elmer) output/light intensity can be converted into electrical signal, from last sample to Computer Analysis and electronic data show and all can under computer control, carry out.Capillary electrophoresis especially is preferred for a small amount of small pieces segment DNA that exists in the specific sample is checked order.

In recent years, a kind of useful sequence measurement of tetra-sodium order-checking becoming.Referring to for example Ronaghi, M. etc. 1996. are by surveying tetra-sodium release carrying out real-time dna sequencing (Real-time DNAsequencing using detection of pyrophosphate release) .Anal.Biochem.242:84-89; Ronaghi, M. etc. 1998. are based on sequence measurement (A sequencingmethod based on real-time pyrophosphate) the .Science 281:363-365 of real-time tetra-sodium; Ronaghi, M. etc. 1999. are by tetra-sodium sequencing analysis DNA secondary structure (Analyses of secondarystructures in DNA by pyrosequencing) .Anal.Biochem.267:65-71; Ronaghi2001.Genome Res.11 volume, 1 phase, 3-11; Nyr é n, historical (The historyof pyrosequencing) the .Methods Mol Biol.2007 of tetra-sodium order-checking; 373:1-14.The advantage of tetra-sodium order-checking is accurate, flexible, also automatization easily of parallel processing. and this technology has been abandoned the needs to labeled primer, labeled nucleotide and gel electrophoresis.According to this method, polysaccharase catalysis is mixed nucleic acid chains with Nucleotide.The result who mixes is that the tetra-sodium molecule discharges and is converted into ATP by sulfurylase.The luciferase reaction produces light, and the luciferin molecule is oxidized therebetween.After adding every kind of Nucleotide, carry out washing step and add repeatedly allowing.Thereby the Nucleotide degrading enzyme continues degraded Nucleotide allows to add follow-up Nucleotide.Successfully the tetra-sodium order-checking is used for large scale sequencing as platform, comprises that genome and huge genome analysis are (referring to for example, from the gene order-checking instrument FLX of 454 Luo Shi life sciences (Life Sciences/Roche) ^TM).

Research and development SOLiD ^TMSystem is used for order-checking (referring to for example Applied Biosystems, Inc., SOLiD ^TMThe system applies specification sheets, Foster city, California) (Applied Biosystems.Application Fact Sheetfor the SOLiD ^TMSystem.Foster City, CA).This method is connected in the clonal expansion dna fragmentation that magnetic bead connects successively based on the oligonucleotide with dye marker.In the method, produce dna sequence dna by measuring continuous connection.Ligation is discerned based on probe but not is added successively, therefore is not easy to the accumulative total mistake.Chemical property has significantly reduced the possibility of wrong insertion or disappearance.Connection Step and handle not with Phosphoric acid esterase that linking probe can prevent phase shift.In addition, after experiencing 7 round-robin and connecting, original primer breaks away from from template, and new primer hybridization is to begin the inquiry to the n-1 position.Use this " replacement " to allow mutually to reduce systemic noise and allow longer reading length.In addition, use two alkali yl codings with discriminating measurement error and real polymorphism.The change in single site is accredited as random error, and can be removed by software in data analysis.As analysis platform, SOLiD ^TMSystem can be applicable to large scale sequencing, and digital gene is expressed, the ChIP and the research that methylates, and in the detection genome mutation, be particularly useful.

In another embodiment of the present invention, the polynucleotide of coded polypeptide or its fragment can be used for recombinant DNA molecules to instruct the expression of polypeptide or its fragment or variant in the suitable host cell.Owing to the intrinsic degeneracy of genetic coding, can produce other dna sequence dna of the aminoacid sequence of encode basic identical or functional equivalent, these sequences can be used for the clone and express phage polypeptide.It is engineered to change amino acid coding according to multiple reason to use the common institute in this area perception method that nucleotide sequence of the present invention is carried out, and includes but not limited to the variation of carrying out in order to change clone, processing and/or gene product expression.Can use the DNA reorganization of being undertaken by random fragmentation and carry out engineered to nucleotide sequence the PCR assembling of gene fragment and synthetic oligonucleotide.For example, can use site-directed mutagenesis to insert new restriction site, change the glycosylation form, change codon preference, introduce sudden change or the like.

In another embodiment of the present invention, can with natural, modify or the nucleic acid encoding sequence of reorganization is connected to heterologous sequence with encoding fusion protein.For example, coding can may be useful by the chimeric sequences of commercially available antibody recognition.Also can make it between polypeptide of the present invention and heterologous protein sequence, contain cleavage site by engineered fusion rotein, so that cutting and this polypeptide of purifying partly separate with allos.

In another embodiment, can use well known chemical process to synthesize the polypeptid coding sequence of complete or portion-form (referring to Caruthers, (1980) Nucl.Acids Res.Symp.Ser.215-223 such as M.H., Horn, T. etc. (1980) Nucl.Acids Res.Symp.Ser.225-232).Perhaps, can use synthetic amino acid array or its segmental chemical process to produce polypeptide itself.For example, can use multiple solid phase synthesis technique (Roberge, J.Y. etc. (1995) Science 269:202-204; Merrifield J. (1963) J.Am.Chem.Soc.85:2149-2154) carry out polypeptide and synthesize, for example using, ABI 43lA peptide synthesizer (Perkinelmer Inc.) carries out synthetic automatically.The various fragments of the synthetic polypeptide of available chemical process, and with chemical process combination results full-length molecule.

Available preparative high performance liquid chromatography separate new synthetic polypeptide (as, Creighton, T. (1983) protein structure and molecule principle, WH Fu Rui Man, New York (Proteins Structures andMolecular Principles, WH Freeman and Co., New York, NY)).Can confirm that by amino acid analysis and order-checking the composition of synthetic polypeptide is (as, Ai Deman degradation step (Edman degradationprocedure; Creighton), the same).In addition, the aminoacid sequence of polypeptide or its any part can be in directly synthetic change and/or by chemical process with from the combined sequence of other protein or its part with generation variant molecule.

In order to express biologically active polypeptides, the nucleotide sequence of coded polypeptide or function equivalent can be inserted suitable expression vector, promptly comprise the carrier that essential element was transcribed and translated to insertion sequence.The method that available those skilled in the art know makes up and comprises polypeptid coding sequence and the suitable expression vector of transcribing and translate controlling elements.

These methods comprise genetic recombination in extracorporeal recombinant DNA technology, synthetic technology and the body.

Sambrook, J. etc. (2001) " molecular cloning, laboratory manual " cold spring port press, New York Plainview (Molecular Cloning, A Laboratory Manual, Cold Spring HarborPress, Plainview, NY), and Ausubel, the newly organized molecular biology experiment guide of F.M. etc. (2007), John Wei Lisen press, New York (Current Protocols in Molecular Biology, JohnWiley﹠amp; Sons, New York NY) is described this type of technology.

Can use multiple expression vector/host system to comprise and express the encoding sequence of polypeptide of the present invention.They include but not limited to: the bacterium that microbe such as recombinant phage, plasmid or cosmid DNA expression vector transform; The yeast that Yeast expression carrier transforms; The insect cell system that virus expression carrier (as baculovirus) transforms; Virus expression carrier (as, cauliflower mosaic virus CaMV; Tobacco mosaic virus (TMV) TMV) or bacterial expression vector (as, Ti or pBR322 plasmid) the plant transformed cell; Or zooblast system.For bacterium, useful plasmid comprises pET, pRSET, pTrcHis2 and the pBAD plasmid of Ying Jun company (Invitrogen); The Director of the pET of Nova base company (Novagen) and pCDF plasmid and Sigma aldrich company (Sigma-Aldrich) ^TMPlasmid.For methanogen, useful plasmid includes but not limited to pME2001, pMV15 and pMP1.Specifically, intestinal bacteria (Escherichiacoli) can be used with expression vector pET.Used expression vector or host cell do not limit the present invention.

" controlling elements " and " adjusting sequence " be carrier non-translational region-enhanser, promotor, 5 ' and 3 ' non-translational region--they and host cell proteins matter interact, and transcribe and translate.The intensity of this class component may be different with specificity.According to use carrier system and host, can use any amount of suitable element of transcribing and translate, comprise composing type and inducible promoter.For example, when the clone advances bacterial system, can use inducible promoter, (department looks into column foot company as the BLUESCRIPT phagemid, the La Jolla, California) (Stratagene, LaJolla, CA) or the hybridization lacZ promotor of pSPORT1 plasmid (Life Technologies, Inc.) (Life Technologies) etc.Can in insect cell, use baculovirus polyhedrin body protein promotor.Can with derive from the vegetable cell genome (as, heat-shocked, RUBISCO and storage protein gene) promotor or enhanser or promotor or the enhanser (as viral promotors or leader sequence) that comes from plant virus be cloned in the carrier.

In bacterial system, can use according to the appointment of polypeptide many expression vectors are selected.For example, when a large amount of polypeptide of needs, but the instruction high level expression is easy to the carrier of the fusion rotein of purifying.Examples of such carriers includes but not limited to: multi-functional escherichia coli cloning and expression vector such as BLUESCRIPT (department looks into column foot company), wherein polypeptid coding sequence can be connected into carrier, with the N-terminal Met of beta-galactosidase enzymes and follow-up 7 residues in identical frame, thereby produce hybrid protein; PIN carrier (Van Heeke, G. and S.M.Schuster (1989) J.Biol.Chem.264:5503-5509) etc.

Also can adopt pGEX carrier (Pu Luomaige company, state of Wisconsin Madison) (Promega, Madison, WI) fusion rotein of express polypeptide and glutathione-S-transferase (GST).Usually, this class fusion rotein is solvable, and easily by the following method by the lysing cell purifying: be adsorbed on the glutathione agarose pearl, then wash-out in the presence of free glutathione.Can design the protein of this type systematic generation so that it comprises heparin, zymoplasm or Xa factor proteolytic enzyme cutting site, thereby interested cloned polypeptide can partly be discharged from GST as required.In yeast saccharomyces cerevisiae (Saccharomycescerevisiae), can use the variety carrier that comprises composing type or inducible promoter, as alpha factor, alcohol oxidase and PGH.Summary referring to (1987) Methods Enzymol.153:516-544 such as (the same) such as Ausubel and Grant.

Also can use the specificity start signal to reach the purpose of more effective translation invention polypeptid coding sequence.This type of signal comprises that ATG starts codon and flanking sequence.When polypeptid coding sequence, its initiator codon and upstream sequence are inserted under the situation of suitable expression vector, need not the other control signal of transcribing or translate.Yet, when only inserting encoding sequence or its fragment, need provide the translation control signal of external source to comprise the ATG initiator codon.And initiator codon should be arranged in correct reading frame, to guarantee the translation of complete inset.External source translation controlling elements and initiator codon can have multiple natural or synthetic source.By comprising that the enhanser that is fit to used specific cells system can strengthen expression efficiency, described in document (Scharf, D. etc., (1994) Results Probl.Cell Differ.20:125-162).

In addition, can regulate that insertion sequence is expressed or it is selected according to host cell strain with the ability of desired mode expression processing polypeptide.The modification of this type of sequence includes but not limited to: acetylize, carboxylation, glycosylation, phosphorylation, fatization and acylations.Also can use the translation post-treatment of cutting polypeptide " precursor " form to be beneficial to correct insertion, folding and/or function.Can be from American type culture collection (Maryland State Bei Saisida) (American Type Culture Collection (ATCC; Bethesda MD) obtains the different host cells with the active characteristic mechanism of specific cells machine or translation back, selects to guarantee correct sequence modification and processing.Concrete host cell includes but not limited to: the methanogen cell, as producing methane tyrothricin cell, specifically, ruminate methane tyrothricin or Shi Shi methane tyrothricin cell.Interested host cell for example also comprises, rhodotorula (Rhodotorula), short stalk mould (Aureobasidium), yeast saccharomyces cerevisiae (Saccharomyces), shadow yeast (Sporobolomyces), pseudomonas (Pseudomonas), Erwinia (Erwinia) and Flavobacterium (Flavobacterium); Or the uncommon bacterium (Escherichia) of other this type of organism such as dust, lactobacillus (Lactobacillus), bacillus (Bacillus), streptomycete (Streptomyces) etc.Specific host cell comprises the intestinal bacteria (Escherichia coli) that are particularly suited for the present invention and use, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), bacillus thuringiensis (Bacillus thuringiensis), subtilis (Bacillus subtilis), paleness streptomycete (Streptomyces lividans) etc.

Few techniques can be introduced nucleic acid in the eukaryotic cell of vitro culture.They comprise chemical process (Felgner etc., Proc.Natl.Acad.Sci., USA, 84:74137417 (1987); Bothwell etc., eukaryotic gene clone and analytical procedure (Methods for Cloning and Analysis ofEukaryotic Genes), compile, John and Butler publishing company, Boston, Massachusetts (Jones andBartlett Publishers Inc., Boston, Mass.) (1990); Ausubel etc., the simple and clear experimental program of molecular biology (Short Protocols in Molecular Biology), John Wei Lisen company, New York (JohnWiley and Sons, New York, NY) (1992); And Farhood, Annal.NY Acad.Sci., 716:2334 (1994)), use protoplastis (Bothwell, the same) or electricimpulse (Vatteroni etc., Mutn.Res., 291:163169 (1993); Sabelnikov, Prog.Biophys.Mol.Biol., 62:119 152 (1994); Bothwell etc., the same; And Ausubel etc., the same), use attenuated virus (Davis etc., J.Virol.1996,70 (6), 3,781 3787; J.Gen.Virol.2002 such as Brinster, 83 (Pt 2), 369 381; Moss, Dev.Biol.Stan., 82:55 63 (1994); And Bothwell etc., the same), and physical method (Fynan etc., the same; Johnston etc., Meth.Cell Biol., 43 (PtA): 353 365 (1994); Bothwell etc., the same; And Ausubel etc., the same).

Can by the following method nucleic acid successfully be delivered to animal tissues: use cationic-liposome (Watanabe etc., Mol.Reprod.Dev., 38:268 274 (1994)), directly exposed DNA or RNA are injected into the (Robinson etc. of animal muscle tissue, Vacc., 11:957 960 (1993); Hoffman etc., Vacc.12:1529 1533 (1994); Xiang etc., Virol., 199:132 140 (1994); Webster etc., Vacc., 12:1495 1498 (1994); Davis etc., Vacc., 12:1503 1509 (1994); Davis etc., Hum.Molec.Gen., 2:1847 1851 (1993); Dalemans etc., AnnNY Acad.Sci.1995,772,255 256.Conry etc., Cancer Res.1995,55 (7), 1397-1400) and the embryo (39:153 161 (1994) for Naito etc., Mol.Reprod.Dev.; With Burdon etc., Mol.Reprod.Dev., 33:436 442 (1992)), and the RNA vaccine of intramuscular injection self-replacation (Davis etc., J Virol 1996,70 (6), and 3,781 3787; Balasuriya etc., Vaccine 2002,20 (1112), 1,609 1617) or with " particle gun " technology intradermal injection DNA (Johnston etc., the same).

The various experimental programs that detect and measure expression of polypeptides of the present invention with protein specific polyclone or monoclonal antibody are known in the art.Example comprises the cell sorting (FACS) of enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and fluorescence-activation.Can use with polypeptide on two non-interference epi-positions have reactive monoclonal antibody and carry out dibit point mono-clonal immunization experiment, also can use competition in conjunction with experiment.These and other experiment is referring to Hampton, and R. etc. (1990; Serological method, laboratory manual (Serological Methods, a laboratory Manual), APS press, Sao Paulo, the Minnesota State) and Maddox, D.E. etc. (1983; J.Exp.Med.158:1211-1216) etc.

Those skilled in the art understand multiple mark and coupling technology, can be used for the experiment of multiple nucleic acid and amino acid.Produce the method that the hybridization of mark or PCR probe be used to survey the polynucleotide correlated series and comprise that oligonucleotide mark, nick translation, end mark or applying marking Nucleotide carry out pcr amplification.Perhaps, the encoding sequence of polypeptide or its any fragment or variant can be cloned into carrier and be used to produce the mRNA probe.Examples of such carriers is known in the art and can buy, and can be used for the vitro synthesized RNA probe behind the Nucleotide that adds suitable RNA polymerase such as T7, T3 or SP6 and mark.The multiple commercial reagent box that can utilize An Fama West Asia biotech company, Pu Luomaige company and U.S. Biochemics Inc. (AmershamPharmacia Biotech, Promega and US Biochechemical) to produce carries out these steps.Suitable reporter that is easy to survey or mark comprise radionuclide, enzyme, fluorescent substance, chemiluminescent substance or chromogenic reagent and substrate, cofactor, inhibitor, magnetic-particle etc.

Can be suitable for expressing and from culture, reclaim under the condition of polypeptide, copy expression vector or use the expression vector transformed host cells.But the culture inclusion body is outer or the expression in vivo assembly.The vivoexpression assembly comprises the vivoexpression assembly of rabbit reticulocyte lysate, intestinal bacteria lysate and malt extract, for example, and the Expressway of Ying Jun company (Invitrogen) ^TMOr the RiPs system, the Genelator of Ying Telong biotech company (iNtRON Biotechnology) ^TMSystem, the EcoPro of Nova base company (Novagen) ^TMOr STP3 ^TMSystem, Pu Luomaige company (Promega)

The EasyXpress system of quick coupling system and Kai Jie company (QIAGEN).The polypeptide that originates from culture can be the polypeptide that comprises in excretory or the cell, and this depends on sequence and/or used carrier.In some particular aspects, the expression vector that can design the coding phage polypeptide comprises it to instruct polypeptide to pass through protokaryon or eukaryotic cell membrane excretory signal sequence.

Other construction can comprise the amino acid structure territory that is beneficial to peptide purification.This type of structural domain includes but not limited to: metal chelating peptide such as Histidine-tryptophane (as 6X-HIS (SEQ ID NO:150)) module of purifying can be on curing metal, carried out, the a-protein structural domain of purifying can be on fixing immunoglobulin (Ig), carried out, and

Expansion/affinity purification system (Yin Miunaisi group, Seattle, the State of Washington) (Immunex Corp., Seattle, WA) in used structural domain.Available epi-position label comprises HA, VSV-G, V5, HSV, GST, GFP, MBP, GAL4 and beta-galactosidase enzymes.Useful plasmid comprises that the plasmid that contains biotin label is (as, the PinPoint of Pu Luomaige company ^TMPlasmid), contain the plasmid (looking into the pCAL plasmid of column foot company as department) of caldesmon, the plasmid that contains the Streptavidin binding peptide (is looked into the InterPlay of column foot company as department ^TMPlasmid), contain c-myc or

The plasmid of label (as the immunoprecipitation plasmid of Sigma aldrich company) or contain histidine-tagged plasmid (as the QIAExpress plasmid of Kai Jie company).

In order to be beneficial to purifying, expression vector can comprise the joint sequence that can cut, as the specificity joint sequence of Xa factor or enteropeptidase (Ying Jun company, San Diego, California).For example, carrier can comprise one or more joints between purification structure territory and polypeptide.A kind of this type of expression vector can be used in to express and comprises the fusion rotein of polypeptide of the present invention, and the nucleic acid of coding Trx or preceding 6 Histidines of enteropeptidase cleavage site is provided.Histidine residues is beneficial at IMAC (fixing metal ions affinity chromatographic column, as Porath, J etc. (1992) Prot.Exp.Purif.3:263-281 is described) and goes up purifying, the enteropeptidase cleavage site then provide a kind of from fusion rotein the method for purified polypeptide.Kroll, D.J. etc. (1993; DNA Cell Biol.12:441-453) provides discussion about the carrier that comprises fusion rotein.

Can use the common institute in this area perception method to produce antibody of the present invention, be used for purifying or diagnostic techniques.Specifically, the experimental program according to known to usually can use polypeptide or polynucleotide to produce antibody.This antibody-like can include but not limited to: polyclone, mono-clonal, chimeric and fragment that single-chain antibody, Fab fragment and Fab expression library produce.The present invention especially preferably uses neutralizing antibody (being those antibody of inhibit feature).

In order to produce antibody, can be injected into different hosts with having immunogenic polypeptide, polynucleotide or its any fragment, comprise goat, rabbit, rat, people etc., to carry out immunity.According to host type, can use different adjuvants to improve immunne response.This type of adjuvant includes but not limited to: freund adjuvant, mineral coagulant such as aluminium hydroxide and surfactant such as lysolecithin, pluronic gram polyvalent alcohol, polyanion, peptide, oil-emulsion, key hole keyhole limpet hemocyanin and dinitrophenol.The adjuvant that is used for the people, especially preferred BCG (bacille Calmette-Guerin vaccine) and CBP (Corynebacterium parvum).

Be used to induce the polypeptide of antibody or fragment preferably to have and comprise at least 5 amino acid, more preferably 10 amino acid whose aminoacid sequences.Preferably, they are identical with the part of natural protein aminoacid sequence, and they can comprise the complete amino acid sequence of little natural generation molecule.The galianconism of the antibody of amino acid galianconism and another protein such as key hole keyhole limpet hemocyanin and anti-chimeric molecule can be merged.

Use prepares monoclonal antibody by any technology that continuous cell line produces antibody molecule.These technology include but not limited to hybridoma technology, people B-quadroma technology and EBV-hybridoma technology (Kohler, G. etc. (1975) Nature 256:495-497; Kozbor, D. etc. (1985) J.Immunol.Methods 81:31-42; Cote, R.J etc. (1983) Proc.Natl.Acad.Sci.80:2026-2030; Cole, S.P. etc. (1984) Mol.Cell Biol.62:109-120).As bibliographical information, also can produce antibody in vivo, or produce antibody (Orlandi, R. etc. (1989) Proc.Natl.Acad.Sci.86:3833-3837 by screening immunoglobulin (Ig) library or high specific binding reagents plate by induction of lymphocyte; Winter, G. etc. (1991) Nature 349:293-299).

In addition, also can use some technology to produce " chimeric antibody ", as molecule (Morrison, S.L. etc. (1984) Proc.Natl.Acad.Sci.81:6851-6855 that the antibody gene combination is had suitable antigen specificity and biologic activity with acquisition; Neuberger, M.S. etc. (1984) Nature 312:604-608; Takeda, S. etc. (1985) Nature 314:452-454).Perhaps, can be used to produce the technology of single-chain antibody, to produce specific single-chain antibody by method improvement known in the art.Has relative specific but idiotype is formed different antibody and can be produced (BurtonD.R. (1991) Proc.Natl.Acad.Sci.88:11120-3) by the chain reorganization of making up the immunoglobulin (Ig) library at random.

Those skilled in the relevant art of the present invention understand term " double antibody " and " three antibody ".Exist to comprise the molecule that weight chain variable structural domain (VH) is connected with light chain variable structural domain (VL) by the small peptide joint, this small peptide joint is too short so that can't match between two structural domains on the same chain.This impels the complementary structure territory pairing with one or more other chain, and promotes to form dimer or the tripolymer molecule with two or more functional antigen binding sites.The antibody molecule of gained can be monospecific or polyspecific (as, have dual specificity under the situation of double antibody).Use the present invention relates to the standard method in field, as (the design of double antibody, three antibody and four antibody and application in the cancer target (Design and application of diabodies, triabodies and tetrabodies for cancertargeting) .J.Immunol.Methods.2001 February 1 such as Todorovska; 248 (1-2): 47-66) described, produce this type of antibody molecule from two or more antibody.

Also can produce the antibody fragment that comprises specific binding site.For example, this type of fragment includes but not limited to: can be by the F (ab ') of pepsin digested antibody molecule generation ₂Fragment, and by reduction F (ab ') ₂The Fab fragment that segmental disulphide bridges produces.Perhaps, can make up the Fab expression library and have required specific mono-clonal Fab fragment (Huse, W.D. etc. (1989) Science254:1275-1281) with fast and convenient evaluation.

Can use different immunization experiments to come Screening and Identification to have the antibody of binding specificity.Well known use have determine specific polyclone or monoclonal antibody be at war with in conjunction with or the kinds of experiments method of immune radiating experiment.This type of immunization experiment generally includes measures the mixture that forms between polypeptide or polynucleotide and its specific antibody.The preferred use with two non-interference epi-positions has the dibit point mono-clonal immunization experiment of reactive monoclonal antibody, but also can use competitive binding experiment (Maddox, the same).

Phage polypeptide described herein has target, penetrating and/or suppress the ability of cell, also can be used as carrier molecule and is used for other inhibitor molecules is sent into microorganism cells.Compound is coupled to amino acid whose chemical process has been able to good development, multiple different molecule type can be connected with polypeptide.Modal coupling method depends on the existence of free amine group (alpha-amino group or Lys), sulfydryl (Cys) or hydroxy-acid group (Asp, Glu or α-carboxyl).Can use coupling method by carboxyl-or amino-terminal residue polypeptide chain is connected to cytostatics.In some cases, sequence comprises a plurality of residues that can react with selected chemical substance.Can use this method to produce the polymer that comprises more than a kind of cytostatics.Perhaps, can shorten or select polypeptide, make reactive residue be positioned at the amino or the C-terminal of sequence.

For example, in polypeptide is synthetic, can use N-α-Fmoc-N ε-1-(4,4-dimethyl-2,6 dioxo cycloethylene-1-base-3-methyl butyl)-L-Methionin, reporter molecules such as fluorescein specificity are incorporated into lysine residue (Ono etc., 1997).Synthetic back is handled with hydrazine and is removed 4,4-dimethyl-2,6-dioxo cycloethylene-1-base, coupling 5-and 6-Fluoresceincarboxylic acid succinimide ester.Therefore, by in peptide sequence, comprising lysine residue, with suitable derivatize cytostatics reaction, can finish the coupling of inhibitor molecules and phage polypeptide then.

Also can use EDC (hydrochloric acid 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) or carbodiimide coupling method.Carbodiimide can activate the side chain carboxyl group group of aspartic acid and L-glutamic acid, and the C-terminal group, makes it become primary amine link coupled reactive site.The activatory polypeptide is mixed with cytostatics to produce final conjugate.If cytostatics at first is activated, the EDC method will be by N-terminal α amine and may be by amine (if present) the coupling cytostatics in the Lys side chain so.

Between-dimaleoyl imino benzoyl-N-hydroxysuccinimide eater (MBS) is a heterobifunctional agent, can polypeptide chain be connected to cytostatics by halfcystine.The thiol group of cysteine residues participates in coupling.If selected sequence does not comprise Cys, usually the Cys residue is positioned over N-or C-end so that under height control condition, connect polypeptide and cytostatics.For the synthetic purpose, it is helpful that halfcystine is placed the N-terminal of polypeptide.MBS especially is suitable for the present invention.

Glutaraldehyde can be used as the difunctional coupling reagent that two compounds is connected by its amino.Glutaraldehyde provides the spacer of high flexible between polypeptide and cytostatics, be beneficial to present.Glutaraldehyde is reactive very high compound, carries out the reaction of limited extent with Cys, Tyr and His.When polypeptide when its N-terminal only comprises a free amine group, the glutaraldehyde coupling method is particularly useful.When polypeptide comprises a more than free amine group, can form large-scale polycomplex.

In one aspect, polypeptide of the present invention can be blended in (as by cloning in the frame) or be connected in (as by chemical coupling) cytostatics, as antimicrobial reagent.Comprising antimicrobial peptide, for example sterilization/power/permeability increasing protein, positively charged ion antimicrobial proteins, N,O-Diacetylmuramidase, lactoferrin and Canidae antibacterial peptide (cathelicidins) are (as from neutrophil leucocyte, referring to for example Hancock and Chapple, 1999, Antimicrob.Agents Chemother.43:1317-1323; Ganz and Lehrer, 1997, Curr.Opin.Hematol.4:53-58; Hancock etc., 1995, Adv.Microb.Physiol.37:135-175).Antimicrobial peptide also comprise alexin (as, from epithelial cell or neutrophil leucocyte) and thrombocyte microbicidel albumen (referring to for example, Hancock and Chapple, 1999, Antimicrob.Agents Chemother.43:1317-1323).Other antimicrobial peptide includes but not limited to: Gramicidin S, bacitracin, PXB, king crab element, white corpuscle antibacterial peptide (bactenecin) (as, the bovine leukocyte antibacterial peptide), shut out antibacterial peptide (indolicidin) (as the ox Yin antibacterial peptide of shutting out) and nisin (as the bacterium nisin) of bullfrog skin antibacterial peptide (ranalexin), cecropin A (cecropin A), Yin.

Antimicrobial reagent also comprises ionophore (ionophores), it be beneficial to ion (as sodium) pass through lipid barrier such as cytolemma is propagated.Especially being fit to two ion carrier compounds of the present invention is RUMENSIN ^TM(gift comes company) (Eli Lilly) and lasalocid (Lasalocid) (Roche Holding Ag) (Hoffman LaRoche).Other ionophore includes but not limited to: Salinomycin., avoparcin, A Ruixin (aridcin) and actaplanin (actaplanin).Other biocides comprise penicillin, monensin TM and Azythromycin, metronidazole, Streptomycin sulphate, kantlex and penicillin, and beta-lactam, aminoglycoside, Macrolide, paraxin, Vulkamycin. PA-93, Rifampin and fluoroquinolone are (referring to for example Horn etc., 2003, Applied Environ.Microbiol.69:74-83; Eckburg etc., 2003, Infection Immunity 71:591-596; Gijzen etc., 1991, Applied Environ.Microbiol.57:1630-1634; Bonelo etc., 1984, FEMS Microbiol.Lett.21:341-345; Huser etc., 1982, Arch.Microbiol.132:1-9; Hilpert etc., 1981, Zentbl.Bakteriol.Mikrobiol.Hyg.1Abt Orig.C 2:21-31).

The inhibitor that is particularly useful is blocking-up or the compound that disturbs the methane generation, comprises the bromo ethyl sulfonic acid, as, 2-bromo ethyl sulfonic acid (BES) or its salt, for example sodium salt.Sodium orthomolybdate (Mo) is the sulfate reduction inhibitor, can use with the bromo ethyl sulfonic acid.Other anti-methane generates compound and includes but not limited to: nitric acid, formic acid, methyl fluoride, trichloromethane, Chloral Hydrate, S-WAT, ethene and unsaturated hydrocarbons, acetylene, lipid acid such as linolic acid, cis oleic acid, saturated fatty acid such as docosoic (behenic) and stearic acid, and land horse piperazine (lumazine) (for example, 2,4-dihydroxyl pteridine).Other compound comprises 3-bromine propanesulfonic acid salt (BPS), propynoic acid and tetrolic acid ethyl ester.

Biocide also comprises lyase, comprises phage lysozyme, endolysin, N,O-Diacetylmuramidase, lysin, phage lysin, molten intestines wall element, muramidase and viral lysin.Useful enzyme has the ability of particular key in the hydrolytic bacteria cell walls.Specific lyase includes but not limited to: glucuroide, the glycosidic link between aminosugar in its range of hydrolysed peptides glycan (as N-ethanoyl teichoic acid and N-acetyl glucosamine); Ntn hydrolase, the acid amides of the N-acetyl muramyl-L-L-Ala between its cutting polysaccharide chain and the crosslinked peptide connects; And endopeptidase, connect between its range of hydrolysed peptides (as, the halfcystine endopeptidase) and interior isopeptidase, it attacks the false murein from the methanogen of Methanobactericeae (Methanobacteriacaea).

ORF 2058 or ORF 2055 encoded polypeptides that this paper describes in detail can be used as cud methanogen specificity lyase.Can be from fresh Cracked is ruminated the natural enzyme of preparation in the methane tyrothricin cell.Perhaps, can with ORF 2058 or ORF 2055 be cloned into expression vector and at heterologous host such as expression in escherichia coli.Utilize PeiP and PeiW to finish this work in the early time, and this recombinant protein show antagonism methane thermophilic bacteria (Methanothermobacter) cell activity (Luo etc., 2002) under reductive condition.ORF 2058 or ORF 2055 lyase or any other lyase composition can be used for, for example,, perhaps it slow releasing capsule can be mixed or the pill device is used for sending for a long time at cud as the fodder additives of ruminating animal.Can or use successively lyase and the combination of other methanogen inhibitor to avoid host's methanogen to adapt to and enzyme is tolerated.Also can in enzyme, use at random and/or target sudden change adapts to avoiding.Cracking/molten former switch assembly (as ORF 1981 and ORF 1983-ORF1986) can the mode similar to lyase be used.

In addition, PNA also comprises as antimicrobial reagent.PNA is peptide-nucleic acid hybridization thing, wherein phosphate backbone replaced available from the neutral main chain of the achirality of N-(2-amino-ethyl)-glycine unit (referring to for example excellent card bio-science series (Eurekah Bioscience Collection). the PNA of human telomerase and oligonucleotide inhibitor (PNA and Oligonucleotide Inhibitors of HumanTelomerase) .G.Gavory and S.Balasubramanian, Landon Biological Science Co., Ltd (LandesBioscience), 2003).Connect by the methylene carbonyl A, G, T, C base are connected in (P.E.Nielsen etc., Science 1991.254:1497-1500 on the amino nitrogen of main chain; M.Egholm etc., Nature 1993.365:566-568).PNA combines with complementary sequence with high specific, and similar relatively DNA or RNA, and PNA has more high affinity (M.Egholm etc., the same).Compare with corresponding DNA/DNA or DNA/RNA duplex, PNA/DNA or PNA/RNA hybrid have higher thermostability (M.Egholm etc., the same).Because the non-natural amide backbone is not by ribozyme or proteolytic enzyme identification, thereby PNA also has high chemistry and biology stability (V.Demidov etc., Biochem Pharmacol 1994.48:1310-1313).Usually the length of PNA is at least 5 bases, and comprises terminal Methionin.Can be with PNA PEGization with its life-span of further prolongation (Nielsen, P.E. etc. (1993) Anticancer Drug Des.8:53-63).

A particular aspects, polypeptide of the present invention can or be connected (as by chemical coupling) with cytostatics such as antibody or its fragment fusion (as by cloning in the framework).But antibody or antibody fragment targeted microorganisms cell, perhaps methanogen cell particularly, or one or more cell assemblies.For example, but the targeted cells surface protein, as the outer acceptor of born of the same parents.The immunocompetence part that comprises immunoglobulin molecules and immunoglobulin (Ig) (Ig) molecule promptly comprises the molecule of the antigen binding site of specificity conjugated antigen (with its immune response).

Polypeptide of the present invention is to be particularly useful in the methanogen cell at the targeted microorganisms cell specifically.In particular aspects, can utilize this polypeptide to connect or combine, penetrating cell and/or suppress the growth of cell or duplicate with cell walls or symphysis.Equally, can use this polypeptide instantaneous or be attached to cell for a long time, or penetrating cell walls or film and/or in born of the same parents, accumulate in the environment.Should be understood that, phage polypeptide of the present invention, and corresponding polynucleotide, expression vector, host cell and antibody can be used for the multiple microorganism of target, for example, ruminate methane tyrothricin and Shi Shi methane tyrothricin, the former is the main methanogen in the ruminating animal, and the latter is the main methanogen of human body.In order to implement target, microorganism cells can be contacted with phage polypeptide, describe in detail as this paper, described polypeptide is separable from one or more natural resource, or originates from expression vector and/or host cell, or comes from synthetic or semi-synthetic chemical process.In order to strengthen permeability, this polypeptide can be merged with one or more signal sequences or be connected (the prediction consensus sequence:

[ML] KKKK[K] and 0,1}X{0,9}[IL] [IFL] [IL] [IL] [IS] [LIA] X{0,4}[LIVF] [LIAV] [LI] [ILV] [LAIV] [ILFV] [LIVF] [SAL] [ILV] [GSA] [AS] [VAI] [SA] A (SEQ ID NO:151), referring to Fig. 6).Also referring to P é rez-Bercoff,

Koch, J. and B ü rglin, T.R. (2006) LogoBar: utilize histogram observing protein sign and breach (LogoBar:bar graphvisualization of protein logos with gaps) .Bioinformatics 22,112-114.In particular aspects, this polypeptide is delivered to object with the composition forms that this paper describes in detail, for example send by the delayed release device that is used for ruminating animal.

In some embodiments, this polypeptide and cytostatics are merged or is connected, described cytostatics for example comprises, anti--produce methane generation compound (as the bromo ethyl sulfonic acid), antibody or antibody fragment, lyase, peptide nucleic acid(PNA), antimicrobial peptide or other microbiotic.Peptide inhibitor is delivered to object to suppress microorganism cells with the form of composition, specifically is the growth of methanogen cell and/or duplicates.Said composition comprises, for example: a) isolating phage, phage particle, phage genome or its version, fragment, variant or derivative; B) isolating phage polypeptide or its version, fragment, variant or derivative; C) isolating polynucleotide or its version, fragment, variant or derivative; D) comprise the expression vector of these polynucleotide; Or e) comprises the host cell of this expression vector.According to disclosed method, composition of the present invention can be packaged as the part of test kit specially, is used for target, penetrating and/or inhibition microorganism cells, especially methanogen cell.This test kit comprises the listed composition of at least a this paper; And be used for target or penetrating methanogen or other microorganism cells, or the operation instruction that suppresses its cell growth or duplicate.

In another embodiment, the present invention relates to above-mentioned any method used with the pharmaceutical composition pharmaceutically acceptable carrier coupling.This type of pharmaceutical composition can comprise the combination of phage polypeptide and cytostatics.Perhaps, pharmaceutical composition can comprise expression vector or the host cell that this paper describes in detail.Can give separately said composition or with at least a other medicament, unite as stable compound and to give, can utilize any aseptic biocompatibility pharmaceutical carriers, include but not limited to: salt solution, buffer saline, dextrose and water are given and said composition.Said composition can give object separately or give with other medicament, medicine (as antimicrobial agents) or hormons.

Except activeconstituents, these pharmaceutical compositions also can comprise suitable pharmaceutically acceptable carrier, comprise being beneficial to vehicle and the auxiliary that active compound is processed into the pharmacy useful formulations.At the Lei Mingdun of latest edition pharmaceutical science (Remington ' s Pharmaceutical Sciences) ((the Maack Publishing Co. of the Mike publishing company of Pennsylvania's Easton, Easton, PA)) can find the more details of preparation and medicine-feeding technology.The pharmaceutical composition that the present invention uses can give by any approach, includes but not limited to: in oral, intravenously, intramuscular, intra-arterial, the marrow, in the sheath, in the ventricle, in the transdermal, subcutaneous, intraperitoneal, nose, in the intestines, local, hypogloeeis or rectal.

Can use pharmaceutically acceptable carrier well known in the art, with the oral administration suitable dose, preparation is used for pharmaceutical composition for oral administration.Examples of such carriers makes pharmaceutical composition can be formulated as tablet, pill, sugar-coat agent, capsule, liquid, gelifying agent, syrup, slurries, suspensoid etc., is convenient to the object picked-up.Can obtain the pharmaceutical preparation of oral use by the following method: with active compound and fixing mixed with excipients, optional the gained mixture is ground, after adding suitable auxiliary, this mixture is processed into particle, obtain tablet or sugar-coat agent core body.Suitable vehicle is sugar or protein weighting material, as sugar, comprises lactose, sucrose, N.F,USP MANNITOL or Sorbitol Powder; Starch from corn, wheat, rice, potato or other plant; Mierocrystalline cellulose is as methylcellulose gum, hydroxypropylmethyl-Mierocrystalline cellulose or Xylo-Mucine; Colloid comprises gum arabic and tragacanth; And protein such as gelatin and collagen.Need, can add disintegrating agent or solubilizing agent, as cross-linked polyvinylpyrrolidone, agar, alginic acid or its salt, as sodiun alginate.

The other medicines preparation that can orally use comprises crimping (push-fit) capsule that gelatin is made, and the sealing soft capsule made of gelatin and Drug coating (coating) (as glycerine or Sorbitol Powder).The crimping capsule can comprise and weighting agent or tackiness agent, as lactose or starch; Lubricant is as talcum powder or Magnesium Stearate and optional stabilizer blended active ingredient.

In soft capsule, active compound solubilized or be suspended in the suitable liquid that contains or do not contain stablizer is in fatty oil, liquid or liquid macrogol.

Sugar-coat agent core body can with suitable Drug coating, unite use as concentrated sugar solution, wherein also can comprise gum arabic, talcum powder, polyvinylpyrrolidone, carbomer gel, polyoxyethylene glycol and/or titanium dioxide, lacquer solution and appropriate organic solvent or solvent mixture.Dyestuff or pigment can be added in tablet or the dragee coatings amount that is used to indicate product or characterizes active compound, i.e. dosage.

Available aqueous solution, preferred physiological compatibility damping fluid is as the pharmaceutical preparation of hanks solution, Ringer's solution or the suitable gi tract external administration of physiological buffer salt solution preparation.The water-based injection suspension can comprise the material that increases suspension viscosity, as Xylo-Mucine, Sorbitol Powder or dextran.In addition, the suspension of active compound can be prepared as suitable oily injection suspension.Suitable lipophilic solvent or vehicle comprise fatty oil such as sesame oil, or Acrawax such as ethyl oleate or triglyceride level, or liposome.Also can use non-lipid polycation aminoacid polymers to send.Suspension can be chosen wantonly and comprise suitable stabilizers or increase the compound dissolution degree to prepare the reagent of highly enriched solution.For part or intranasal administration, in preparation, use the permeate agent of the suitable particular barrier that will permeate.This area is understood this type of permeate agent usually.

Pharmaceutical composition of the present invention can mode known in the art be made, as, mixing, dissolving, granulation, the agent of manufacturing sugar-coat, the water by routine flies, emulsification, encapsulate, seal or the method for freeze-dry process.Form that can salt provides pharmaceutical composition, and described salt can form with multiple acid, includes but not limited to: hydrochloric acid, sulfuric acid, acetate, lactic acid, tartrate, oxysuccinic acid, succsinic acid etc.Salt is easier to dissolving than corresponding free alkali form in water-based or other protonic solvent.In other cases, preferred formulation can be the lyophilized powder that comprises following any or all composition: 1-50mM Histidine, 0.1%-2% sucrose and 2-7% N.F,USP MANNITOL, pH scope are 4.5-5.5, make up with damping fluid before use.After the preparation of pharmaceutical compositions, it can be positioned in the suitable containers, and stick be used for the treatment of shown in the label of illness.For the administration of the present composition, this label can comprise dosage, frequency and method.

Being applicable to that pharmaceutical composition of the present invention comprises comprises the composition of significant quantity active ingredient to accomplish the end in view.For any compound, at first can be in cell experiment, as microorganism cells or specifically, in the methanogen cell, or in animal model, normally estimate the treatment effective dose in mouse, rabbit, dog or pig or ruminating animal such as sheep, ox, deer or the goat.Also can use animal model to determine proper concentration and route of administration.This type of information also can be used for defining the dosage or the approach of usefulness.Usually dosage can be 0.1-100,000 microgram, even total dose is about 1g or more, this depends on route of administration.Guide about concrete dosage and delivering method is provided in the document, and personnel are implemented in this area can obtain these guides.Compare with sending polypeptide, those skilled in the art will use different formulation delivered polynucleotide.Similarly, polynucleotide or polypeptide to send for specific cells, illness, position etc. be different.

Therapy based on phage known in the art, and this type of preparation of compositions method is disclosed.Describe phagotherapy and can be used for target staphylococcus (Staphylococcus) (as streptococcus aureus (S.aureus)), pseudomonas (Pseudomonas) (as Pseudomonas aeruginosa (P.aeruginosa)), intestinal bacteria (Escherichia) (as intestinal bacteria (E.coli)), klebsiella (Klebsiella) is (as Klebsiella ozaenae (K.ozaenae), nose scleroma klebsiella (K.rhinoscleromatis scleromatis) and Klebsiella Pneumoniae (K.pneumonia)), Bacillus proteus (Proteus), Salmonellas (Salmonella), Shigellae (Shigella) is (referring to for example Carlton, R.M. (1999) .Archivum Immunologiae etTherapiae Experimentalis, 47:267-274; Liu, J. etc. (2004) .Nat.Biotechnol.22,185-191; Projan, S. (2004) .Nat.Biotechnol.22,167-168; Sulakvelidze, A., Alavidze, Z. and Morris, J.G. (2001) .Antimicrobial Agents and Chemotherapy, 45 (3): 649-659; Weber-Dabrowska, Mulczyk, M. and Gorski, A. (2000) .Archivum Immunologiae et Therapiae Experimentalis, 48:547-551).Phagotherapy has inborn advantage than traditional biocide, because the phage high special does not influence normal microorganism in the human body; Phage is infection of eukaryotic cells not, does not have known serious side effects; Phage can be positioned to infect the position; And phage can exponentially be duplicated, therefore this treatment only need low dose of, cost very low usually (referring to for example Sulakvelidze etc., the same).About current summary, referring to Fischetti VA, Nelson D, Schuch R. reuses phagotherapy: is part greater than summation? (Reinventing phage therapy:are the parts greater than the sum?) NatBiotechnol.2006 December; 24 (12): 1508-11.

Therapy based on peptide and polypeptide is described, interleukin fusion toxin (denileukindifitox) for example, Sostatin, vapreotide, Lanreotide, the RC-3940 series peptide, Wy-42462, leuprorelin acetate (lupron), the Rayleigh, cetrorelix is (referring to for example, Lu etc., 2006, AAPS J 8:E466-472), Hai Moxiting (hemocidins), Si Tafuping (staphopains) (referring to for example, Dubin etc., 2005, Acta Biochemicai Polonica, 52:633-638), and indoles Xi Ting (indolicidin), alexin, lantibiotics, Wei Xi spit of fland B17 (microcidin B17), histatins (histatins) and add peaceful (maganin) (referring to for example, Yeaman and Yount, 2003, Pharmacol Rev 55:27-55).At Degim etc., 2007, Curr Pharm Des 13:99-117 and Shai etc., 2006, Curr ProtPept Sci can find the general guide of peptide and polypeptide therapy among the 7:479-486.The medicine based on peptide of approval comprises Hematide recently ^TM(synthetic is based on the stimulators of erythropoiesis of peptide, (the Affymax of company of the non-Mike of dust department, Inc.)), Exenatide (Exenatide) (synthetic incretin analogue (exendin)-4, Ai Mailin/gift comes company (Amylin/Eli Lilly), Natrecor (Nesiritide (nesiritide), Nesiritide, Si Keaosi company (Scios)), generally come Nahsi (Plenaxis) (abarelix, Pu Ruixisi drugmaker (Praecis Pharmaceuticals)) and SecreFlo (secretin, auspicious general Rigen company (Repligen)).

Implementer's factor that treatment target is relevant is as required determined accurate dosage.Dosage and administration are adjusted with active agent that enough levels are provided or kept required effect.The factor that need consider comprises seriousness, the general health of object, age, body weight and sex, diet, time of administration and the frequency of object, drug combination, the reaction sensibility and the tolerance/response to treating of disease condition.According to the transformation period and the clearance rate of particular formulations, the depot drug product composition can every 3-4 days, weekly or give once in per two weeks.

What the present composition (as pharmaceutical composition) was particularly useful is slowly-releasing prescription or principle.For example, device includes but not limited in the cud: New Zealand Ai Gerui feed company (Agri-Feeds Ltd., NewZealand) time capsule ^TMThe ball scope, at first by the exploitation (AgResearchLtd. of New Zealand Ai Ji research company, New Zealand), disclosed as WO 95/19763 and NZ 278977, and the branch Niu Famu of the Niu Famu company of Auckland, NZL is healthy and CAPTEC (the Nufarm Health﹠amp of scientific company; Sciences, a division of Nufarm Ltd., Auckland, NewZealand), as AU 35908178, PCT/AU81/100082 and Laby etc., 1984, Can.J.Anim.Sci.64 (supplementary issue) 337-8 is disclosed, and it is for referencial use to include all these reference in this paper.As specific example, this device can comprise spring and plunger, forces composition to pass with terminal hole.

As another embodiment, the present invention relates to as the composition of water fill-in to be used for above-mentioned any method as water inlet composition and dietary supplement ingredient such as ruminant feed components.In particular aspects, dietary supplement ingredient comprises at least a edible vegetable material and peptide of the present invention or polypeptide.Perhaps, dietary supplement ingredient comprises at least a edible vegetable material and peptide disclosed herein or polypeptide, or the polynucleotide of encode peptide disclosed herein or polypeptide, for example, and expression vector or contain the form of the host cell of expression vector.Specifically, composition also comprises the cytostatics that merges or be connected with the institute calling sequence.Preferred vegetable material comprises any in hay, grass, cereal or the break chop, for example, pulse family hay, grass hay, corn silage, this ensiling of standing grain, pulse family ensiling, corn grain, oat, barley, wine brewing cereal, beer cereal, soya grits and cottonseed break chop.Specifically, this ensiling of standing grain can be used as the foodstuffs compositions of ruminating animal.Can carry out genetic modification to vegetable material, make it comprise one or more components of the present invention, as one or more polypeptide or peptide, polynucleotide or carrier.

In another embodiment, the antibody of polypeptide of the present invention or polynucleotide can be used to measure this microorganism, the especially existence of methanogen in the experiment kind of monitoring microorganism level.Method that can be identical same as above prepares the antibody that is used for diagnostic purpose.Diagnostic test comprises the method for using polypeptide in antibody and label human body body fluid or the cell or tissue extract.Can use and modify or the antibody of unmodified, reporter molecules is incorporated into row labels with it by mode covalently or non-covalently.Can use multiple different reporter molecules known in the art, above to several being described wherein.

Known in the artly be used to measure the kinds of experiments scheme of polypeptide or polynucleotide level (as ELISA, RIA, FACS and blotting, as Southern, Northern, Western trace), especially the existence or the level of methanogen provide the foundation in order to measure microorganism.By in that be fit to form under the condition of mixture will be from body fluid or the cell extract and antibody combination of normal subjects such as normal people or ruminating animal, thereby determine normally or standard level.Utilize the whole bag of tricks to carry out quantitatively to the formation amount of standard mixture, but preferred spectrophotometry.The amount and the standard value of polypeptide expressed or polynucleotide in object, contrast and the treatment sample (Tathagata is from the sample for the treatment of object) are compared.Deviation between standard value and the object value has determined to be used to measure the parameter of microorganism existence or level.

In a specific implementations of the present invention,, polynucleotide can be used for diagnostic purpose by using specific cross and/or amplification technique.Spendable polynucleotide comprise oligonucleotide, complementary RNA and dna molecular and PNA.Polynucleotide can be used for detecting or the quantitative assay sample in genetic expression, wherein express relevant with existence or the level of microorganism.Can use diagnostic test to distinguish not existing, exists and changing of microorganism level, and in treating intervention the monitoring level.

In one aspect, can utilize with the hybridization of PCR probe and identify nucleotide sequence, especially genome sequence, its polypeptide of the present invention of encoding.No matter probe results from the zone of high degree of specificity, 10 distinct oligonucleotides as 5 ' regulatory region, perhaps low specific zone, as 3 ' coding region, the preciseness of the specificity of probe and hybridization or amplification (maximum, high, medium or low) will determine whether this probe only discerns sequence, allelotrope or the correlated series of natural generation.Probe also can be used for detecting correlated series, and should preferably comprise at least 50% Nucleotide from any encoding sequence.Hybridization probe of the present invention can be DNA or RNA, and derives from nucleotide sequence SEQ ID NO:74-142 or its complementation or modification sequence, or comes from the promotor that comprises natural generation sequence, the genome sequence that strengthens element and intron.

The method that is used to produce the specific DNA hybridization probe comprises nucleotide sequence is cloned into carrier to produce the mRNA probe.Examples of such carriers is understood in this area, and they can be buied, and they can be used for the vitro synthesized RNA probe by adding suitable R NA polysaccharase and suitable labeled nucleotide.Can carry out mark to hybridization probe by multiple reporter group, these reporter groups for example radionuclide as ³²P or ³⁵S, or enzyme labelling are as alkaline phosphatase of being coupled to probe by the avidin/biotin coupling system etc.Polynucleotide can be used for Southern or northern analyzes, dot blotting or other technology based on film; Be used for round pcr; Perhaps be used for test strip, slit, ELISA experiment or microarray, use from the liquid of object biopsy or existence and the level of tissue detection microorganism.Well known this type of qualitative or quantitative methods.

A particular aspects, nucleotide sequence can be used for the experiment of various standard method marks, and adds liquid or tissue from object under the condition that is fit to hybridization and/or amplification.After hatching the suitable time, washing sample, to signal carry out quantitatively and with standard value relatively.If the semaphore of given the test agent is compared with the semaphore of comparable control sample significant change has taken place, the change that occurs the nucleotide sequence level so in the sample shows appearance or the level of microorganism.Also can use the effect of this type of experimental evaluation particular treatment in zooscopy, clinical experiment or monitoring target treatment.

For the diagnostic base of microorganism appearance or level is provided, need to determine the normal or standard feature of expression.By under the condition that is fit to hybridization and/or amplification, will mix with polynucleotide or its fragment from the body fluid or the cell extract of normal subjects, finish this experiment., can carry out quantitatively available from the value of normal subjects and available from the value in the experiment of using the basic purifying polynucleotide of known quantity by relatively standard level.Can will compare from the standard value of normal specimens and value from the object for the treatment of at microorganism growth.Utilize existence or the level of the deviation measuring microorganism between standard value and the object value.

In case identified microorganism and begun treatment plan, then carry out multiple hybridization and/or amplification experiment with observed expression level in estimating with respect to normal subjects on conventional basis, whether the expression level in the object begins to reduce.Can be used for showing effect during the treatment from a couple of days to the several months from continuous result of experiment.

Use by the particular diagnosis of the oligonucleotide of nucleotide sequence design and can comprise and use PCR.This type of oligomer can be that chemosynthesis, Enzymology method produce or external generation.Oligomer preferably is made up of two nucleotide sequences, and one is just direction (5 '-＞3 '), and another is antisense orientation (3 '-＞5 '), uses under for the optimal conditions of identifying concrete nucleotide sequence or condition.Be used to detect and/or the low preciseness condition of DNA that quantitative assay is closely related or RNA sequence under, uses two kinds of identical oligomers, the nido oligomer is gathered or oligomer degeneracy storehouse.

The method that can be used for the quantitative assay expression comprises radio-labeling or biotinylated nucleotide, contrast nucleic acid coamplification and the typical curve (Melby that can obtain the experimental result interpolation by interpolation, (1993) J.Immunol.Methods such as P.C., 159:235-244; Duplaa, C. etc. (1993) Anal.Biochem.229-236).Can accelerate the quantitative speed of a plurality of samples by experimentizing with the ELISA form, wherein interested oligomer occurs with various extent of dilution, and it is quantitative to carry out rapidity by spectrophotometry or colorimetry.

In other embodiment, be derived from the oligonucleotide of any polynucleotide of the present invention or longer fragment and can be used as target spot in the microarray.Can use microarray to monitor a large amount of expression of gene levels (producing the transcript image) simultaneously, and identify hereditary variant, sudden change and polymorphism.Can use this information to determine gene function, understand the genetics basis of disease, diagnose the illness, exploitation and monitor therapy agent activity.In one embodiment, according to method preparation known in the art and use microarray, as PCT application WO 95/11995 (Chee etc.), Lockhart, D.J. etc. (1996; Nat.Biotech.14:1675-1680) and Schena, M. etc. (1996; Proc.Natl.Acad.Sci.93:10614-10619) described.

In one aspect, can use chemical coupling step and spray ink Printing application apparatus, as described in the PCT application WO 95/251116 (Baldeschweiler etc.) at the microarray surface synthetic oligonucleotide.On the other hand, can use " netted " array (the HYBRIDOT equipment that is similar to spot or slit engram, Life Technologies Corporation (Life Technologies)), utilize vacuum system, heat, UV, machinery or chemical Connection Step that substrate surface is settled and be connected to cDNA fragment or oligonucleotide.On the other hand, can craft or utilize obtainable equipment, material or machine (to comprise multichannel pipettor or robot instrument; The Brinkmann Corp., Westbury, New York (Brinkmann, Westbury, N.Y.)) produce array, this array for example can comprise 24,48,96,384,1024,1536 or 6144 or more a plurality of point or hole (as porous plate), or from 2-1, any multiple of 000,000 is so that make full use of commercially available instrument.

In order to carry out sample analysis with microarray, extracting polynucleotide from biological products.Can be from any body fluid (blood, urine, saliva, phlegm, gastric juice etc.), culturing cell obtains biological sample in biopsy thing or other tissue preparation thing.In order to produce probe, use extracting from the polynucleotide of sample produce with array on nucleic acid complementary nucleotide sequence.If microarray is made up of cDNA, then sense-rna is suitable probe.Therefore, in one aspect, use mRNA to produce cDNA, and then in the presence of fluorescent nucleotide, produce fragment or antisense RNA probes with cDNA.These fluorescently-labeled probes and microarray are hatched, so that the cDNA oligonucleotide hybridization of probe sequence and microarray.Polynucleotide, fragment and complementation or the antisense sequences that can comprise on the other hand, restriction enzyme, round pcr and oligomer labelling kit (An Fama West Asia biotech company (Amersham Pharmacia the Biotech)) generation of knowing in use hybridization technique field as the nucleotide sequence of probe.

In another embodiment of the present invention, can utilize functional or immunogenic fragments of polypeptide of the present invention or its or oligopeptides by any drug screening technology SCREENED COMPOUND library.This type of screens used fragment and can dissociate in solution, is additional to solid support, is carried on cell surface or is positioned cell interior.Can detect polypeptide and be tried formation between thing in conjunction with mixture.

Disclosed PCT application WO 84/03564 has described a kind of drug screening technology, and it can be used for high flux screening has suitable avidity to polypeptide of interest compound.In the method, synthetic a large amount of different little test-compounds on solid substrate such as plastics pin or some other surfaces.Test-compound and polypeptide or the reaction of its fragment, washing then.Utilize well known method to detect the bonded polypeptide then.Also can be used for the said medicine triage techniques with the polypeptide direct coated of purifying onboard.Perhaps, can use nonneutralizing antibody to catch polypeptide and be fixed on the solid support.

In another technology, can use the competitive drug screening assay experiment, wherein can combine this polypeptide with the competition of test-compound specificity in conjunction with the neutralizing antibody of polypeptide.In this way, can use this antibody test and this antibody to have the existence of the test-compound of identical one or more antigen binding sites.

Embodiment

Embodiment described herein is in order to explain embodiments of the present invention.Other embodiment, method and analysis type need not to give unnecessary details at this in those skilled in the art's technical scope of molecular diagnosis field.Embodiment in other this area scope also should be as a part of the present invention.

Embodiment 1: the estimation of genome size

Ruminate methane tyrothricin (Methanobrevibacter ruminantium) bacterial strain M1 ^T(DSM1093) grow in (minimum medium, Joblin etc., 1990) in the BY+ substratum, this substratum is by [g/l] NaCl (1), KH ₂PO ₄(0.5), (NH ₄) ₂SO ₄(0.25), CaCL ₂.2H ₂O (0.13), MgSO ₄.7H ₂O (0.2), K ₂HPO ₄(1), liquid (300ml), dH are ruminated in clarification ₂O (360ml), NaHCO ₃(5), resazurin (0.2ml), L-cysteine hydrochloride (0.5), yeast extract (2) and Bach (Balch) trace element solution (10ml) (add trace element; Balch etc., 1979) form, by (g/l) NTA nitrile triacetic acid (1.5), MgSO ₄.7H ₂O (3), MnSO ₄.H ₂O (0.5), NaCl (1), FeSO ₄.7H ₂O (0.1), CoCl ₂.6H ₂O (0.1), CaCl ₂(0.1), ZnSO ₄.7H ₂O (0.1), CuSO ₄.5H ₂O (0.01), AlK (SO ₄) ₂.12H ₂O (0.01), H ₃BO ₃(0.01), Na ₂MoO ₄.2H ₂O (0.01), NiSO ₄.6H ₂O (0.03), Na ₂SeO ₃(0.02) and Na ₂WO ₄.2H ₂O (0.02) forms.Frozen cell group and with the aseptic mortar and the pestle grinding of precooling, extracting genomic dna in liquid nitrogen.Cell homogenates liquid is embedded in the agarose plug, and subsequent operations is carried out to reduce the physics of genomic dna being sheared in bolt.Digest with restriction endonuclease, with pulsed field gel electrophoresis (PFGE) DNA isolation fragment.

Embodiment 2:DNA clone and order-checking

Peace is advanced (the Agencourt Biosciences Corporation (Massachusetts of Biological Science Co., Ltd of section (masschusetts, u.s.a), USA)) use shotgun cloning scheme (Fleischmann etc. at random, 1995), (Macrogen Corporation (the Rockville of mark genome company (Maryland, USA Luo Keweier), MD, USA)) use the tetra-sodium order-checking that the genomic dna of ruminating the methane tyrothricin is checked order.Briefly, by physical damage genomic dna and electrophoretic separation fragment make up the DNA library of ruminating the methane tyrothricin in intestinal bacteria at random.From gel, reclaim the big fragment in the 40Kb scope, and be used to produce big insertion f cosmid library.Reclaim the dna fragmentation of 2-4kb scope and be used to produce little insertion plasmid library.Cultivate the clone of big and little insertion library gained, reclaim its f clay or plasmid DNA and check order with high throughput sequencing technologies.Clone to sufficient amount checks order to reach ruminating 8 times the covering in theory of methane tyrothricin genome.On the genomic DNA fragment of random shearing, carry out the tetra-sodium order-checking, and reach 10 times covering in theory.

Embodiment 3: sequence assembling and prophage note

The comparison dna sequence dna is to find the overlapping sequence, and (para is matched company to utilize para match genome assembler (ParacelGenome Assembler), the California, the U.S.) (Paracel Inc, CA, USA) and Staden software package (Staden etc., 1998), be assembled into contiguous nucleotide sequence (contig) with combined sequence from standard and inverse PCR.Use open reading frame (ORF) finder GLIMMER (assignment of genes gene mapping interpolation Markov model ER) ( GEne LOcator INterpolated MArkov MOdel ER,Delcher etc., 1999) analyze contig, utilize breach BLASTP (the local comparison in basis research tool) ( BAsic LOcal ALignment SEarch TOol (Altschul etc., 1997) NCBI (National Center for Biotechnology Information) (NCBI) nonredundancy Nucleotide and Protein Data Bank in each ORF is analyzed.By producing " false molecule " with the artificial contig that connects from 8 times of sketch phage sequences of random fashion, and submit to (the TIGR of Joint Genome Institute (TheInstitute for Genomic Research), the Washington, DC special zone) (TIGR, DC USA) carry out automatic note.With GLIMMER to analyzing once more, and with GAMOLA (complicated on-the-spot Blast dna sequence dna global comments (GlobalAnnotation of Multiplexed On-site Blasted DNA sequences) from the contig of 10 times of tetra-sodiums order-checking assembling; Altermann and Klaenhammer, 2003) ORF is carried out automatic note.With lineal homologous protein cluster (COG) database root according to function to ORF (threshold value 1e-02) (the http://www.pnas.org/cgi/content/full/102/11/3906 that classifies; Tatusov etc., 2001).

Utilize the overall situation and local comparison (http://pfam.wustl.edu) and standard and fragment schema TIGRFAM HMM model (http://www.tigr.org/TIGRFAMs) (threshold value 1e-02) respectively, use PFAM HMM and TIGRFAM library the albumen motif to be determined by HMMER (http://hmmer.wustl.edu).Identify tRNA (Lowe and Eddy, 1997) with TRNASCAN-SE, with KODON software package (applied mathematics company, Texas, USA Austin) (Applied Maths, Austin, TX, USA) and REPUTER (Kurtz and Schleiermacher, 1999) identify that Nucleotide repeats.Subsequently automatic note is carried out desk checking.Use GENEWIZ (Jensen etc., 1999) to make up visual genome atlas, develop algorithm with the inside of customization and produce the potential data structure.Utilize the software (PathwayVoyager of inner exploitation; Altermann and Klaenhammer, 2005), ruminate methane tyrothricin ORF group and KEGG (capital of a country gene and genome encyclopedia) (Kyoto Encyclopedia of Genes and Genomes, Kanehisa etc., 2004) online database reconstruction path from prediction.

Embodiment 4: sequencing result and analysis

Measure the estimation that clip size is ruminated methane tyrothricin genome size by the Restriction Enzyme digested genomic dna with by PFGE, show the about 2.5-2.9Mb of wall scroll karyomit(e) size.Big and little insertion clone's initial order-checking (6 times of sketches cover) and be that contig shows the regional frequency of occurrences of 40Kb very high (over-represented) (＞20 times) in the genome with sequence assembling is particularly in little inset library.Possible reason is in the process of growth that is used for the extractive culture of DNA, plasmid of high copy number (although not identifying exchromosomal DNA) or lysogenic bacteria phage replication.Because this huge sequence deflection so only little insertion clone is checked order (covering 2 times of theoretical genomes) once more, produces 8 times of final coverings from the Sanger order-checking.With 756 contigs of 8 times of sketch stages (phase) sequence assembling for connecting by 105 supports.Further carry out the tetra-sodium order-checking,, these sequences are mixed the assembling thing make the number of contig reduce to 27 to realize extra about 10 times covering.Use the follow-up breach connection procedure of reverse and long scope round pcr to make the contig number reduce to 14, keep a wrong assembling.

In the high-flux sequence stage, observe sequence and tend to cover (～12Kb) the tightly adjacent remarkable upper zone of G+C content (～50Kb) direction with low G+C district.By GAMOLA and GeneWiz genome sequence analysis has been found significant height-GC district with huge low-G C fringe (spike) next-door neighbour.Detailed analysis to high G+C district has disclosed the similar gene product (Fig. 3) of peptase as the phage cytolysin that has relevant intergrase with phage, the big subunit of phage terminal enzyme, phage door albumen, phage capsid protein and prediction.(do by note as the methane tyrothricin prophage of predicting that ruminates for these gene products

) integrally-built anchored site.Based on the analysis of DNA secondary structure, identify possible phage integration site attL and attR (Figure 1A).As if the phage in att site is integrated the membranin of inferring that has destroyed ORF 1980 and 2069 codings, and this gene may have

The original integration site attB of phage genome.

Based on the phage genome modular construction of generally acknowledging and with sequence similarity and functional database, determine

General structure (Figure 1B) and dna sequence dna (Fig. 4 A).Referring to for example, AltermannE, Klein JR, Henrich B. lactobacillus gasseri temperate phage

Genomic primary structure and feature (Primary structure and features of the genome of the Lactobacillusgasseri temperate bacteriophage (phi) adh) .Gene.1999 August 20; 236 (2): 333-46; Desiere F, Lucchini S, Canchaya C, Ventura M, phage in the Br ü ssow H.Antonie Van Leeuwenhoek. lactic-acid-bacterium and the comparative genomics of prophage (Comparative genomics of phages and prophages in lactic acid bacteria) .2002 August; 82 (1-4): 73-91.Success will be predicted

Phage ORF group categories is the module of the integration of coding phage, dna replication dna and packing, phage structural protein and cracking box, and about 40% phage ORF has been carried out the function sign.With a large amount of direct or non-direct repetition side joints and the terminator spline structure (244bp) of determining to be arranged in the non-coding region of dna replication dna inside modules be characterized as being the dna replication dna starting point of inferring.Through prediction, several genes of phage genome sequence inside are positioned on the antisense strand, and they and low-G C district occur simultaneously.Having to be determined is whether these genes make the phage functionally inactive or show mistake assembling in the phage genome.

The phage lysin and the low-G C district between the attR that find prediction have DNA sulfur modification system, and dnd (degrading during the electrophoresis) comprises the restricted m6 adenine dna of II type methyltransgerase and may be transcriptional regulatory of dnd systemic characteristic.And, identify the non-coding RNA structure in phage genome inside or with phage genome side joint place.Dna replication dna inside modules in prediction identifies rbcL.The rbcL representative is from 5 ' TRRNA stable element of Chlamydomonas reinhardtii (Chlamydomonas reinhardtii).This family has been considered to participate in the stable of rbcL gene, rbcL genes encoding 1, the big subunit of 5-diphosphoribulose carboxylase.The sudden change of this family can cause the transcript degraded to quicken 50 times.

Identify three groups of Group I Introns structures with the phage genome side joint.I group catalysis intron is that big oneself shears ribozyme.In organism widely, their catalysis self is sheared from mRNA, tRNA and rRNA precursor.The core secondary structure is formed (P1-P9) by 9 pairing regions.They mainly are folded into two structural domains-P4-P6 structural domain (being made up of the P5 that piles up, P4, P6 and P6a spiral) and P3-P9 structural domain (being made up of P8, P3, P7 and P9 spiral).The mark of this family (mark-up) secondary structure is only represented this conservative core.I group catalysis intron has the long ORF that inserts the ring zone usually.These non-coding RNA structures are positioned at ORF 1980 (SEQ ID NO:74) upstream, the non-coding region of the downstream of ORF2065 (SEQ ID NO:141) and attR and ORF 2069 (SEQ ID NO:142) upstream.

Embodiment 5A: phage gene

The sequence of finding prophage in ruminating methane tyrothricin genome sequence is a beyong contemplation.Before this not relevant for ruminating the report of methane tyrothricin bacterial strain M1 (DSM 1093), report phage (Baresi and Bertani, 1984 that identify other methane quarter butt bacterial classification although have to cracking or lysogenic phage susceptibility; Knox and Harris, 1986).

The G+C content of prophage sequence is ruminated methane tyrothricin genome around being significantly higher than, and shows that it originates from another organism.Observed homology level does not show the obvious host of its origin, and this shows

Be different from other any phage of meeting so far.

Dna sequence dna is inserted into ruminating in the methane tyrothricin membranin of prediction, and side joint is in the dna sequence dna that has with the corresponding to secondary structure of attL and attR site.Although lack strong homology with other known protein matter,

The inner all functions characteristic module that can identify phage.An interesting feature of this sequence is 3 ' the terminal existence to hang down the G+C district, and this demonstrates homology with the protein that participates in DNA sulfur modification system (dnd).These genes are positioned at

AttR depend on the upstream, site, therefore may in the phage integration process, be brought into and be ruminated in the methane tyrothricin genome.The ORF (dnd1,2 and 3) that the multiple dnd of this regional code is relevant, and II type methylase subunit and transcriptional regulatory of inferring.

The dnd phenotype impels its DNA to degrade in electrophoresis process.The ORF function of each dnd is carried out having mixed in the analysis revealed host genome sulphur or S-contained substance.Find that also the Dnd phenotype is present among the DNA of various bacterial species of different sources and different habitats.In representing not generic various bacteria genome and halobiontic eDNA, to find to organize similar gene cluster, this shows that this modification is a kind of phenomenon widely.(35) S labelling experiment shows that Dnd phenotype and DNA sulfur modification betide (Zhou X in the genome of multiple representative bacterium simultaneously in the body, He X, Liang J, Li A, Xu T, Kieser T, Helmann JD, Deng Z. Novel DNA sulfur modification (A novel DNA modification bysulphur) .Mol Microbio1.2005 September; 57 (5): 1428-38).

II type R the M system be the simplest most popular.Methyltransgerase and endonuclease are encoded to two independent protein and independent action, but not with the form work of mixture.There is not specific protein.Two kinds of therefore active competitions of recognition site that albumen identification is identical.Methyltransgerase once methylates to a chain in the doubly-linked body with the monomeric form effect.Endonuclease promotes the cutting of two chains with the effect of homodimer form.Cutting near recognition sequence or inner predetermined site take place.In this, the function that it be not immediately clear prediction how with the acting in conjunction of dnd system.But, be clear that phage can be used as the gene delivery vehicle.Specifically, can utilize the locus of lysogeny zone of transformation as gene substitution.

The dnd system may be transported to by phage and ruminate in the methane tyrothricin.Equally, still do not understand

The dnd system is in protection or modify the effect of ruminating in methane tyrothricin or the foreign DNA.

The interesting characteristic of another of sequence is the ORF number of encoding on the antisense strand.The corresponding low GC districts of these ORF and with have the low BLAST goodness of fit from multiple organic protein.This show be integrated into ruminate the methane tyrothricin after, these genes exist Accumulate in the genome.It is unclear that these ORF and whether represent insertion to accumulate, and finally cause phage inactivation and domestication, or Whether activate fully.

For reducing of methane particularly important

Gene is the ORF2058 that is arranged in the cracking box.ORF 2058 is noted as peptase, and with PEPC C 39 family proteins have protein family (Pfam) matching (Protein Family (Pfam) match) (scoring :-13.7, E value: 0.00054).These protein are halfcystine peptases, and are the parts (Rawlings etc., 2006) of the bigger CA peptide enzyme family of MEROPS peptase database definition.C39 peptide enzyme family usually is associated with abc transport albumen, is used as the maturation protein enzyme in bacteriocin output and processing.CA peptide enzyme family also comprises viral halfcystine endopeptidase, as cuts isopeptidase in the ancient bacterium phage of C71 of crosslinked peptide of ancient mycetocyte wall.The cell walls that belongs to the ancient bacterium of product methane of Methanobactericeae comprises the parallel chain of false murein, and is a kind of by the polymkeric substance of the crosslinked N-ethanoyl of peptide-L-talosamine uronic acid (N-acetyl-L-talosaminurinic acid).Isopeptidase can cut the crosslinked and energy lysing cell of archeobacteria cell walls peptide in the false murein of C71.

Based on position and colinearity from isopeptidase in the false murein of Marburg methane thermophilic bacteria (Methanothermobacter marburgensis) phage Ψ M2 (Fig. 3), ORF 2058 can have the role of methanogen lysin gene, and its coding participates in the lyase of the lysis before progeny phage discharges.With ORF 2058 with compare from the PeiP of Marburg methagen (M.marburgensis) with from the PeiW (Fig. 5) of Wo Shi methagen (M.wolfeii), show that the global homology between these protein is low.Yet, the Histidine and the asparagicacid residue of isopeptidase catalysis triplet have conservative property in participating in, the cysteine residues position of ORF 2058 is near the conservative halfcystine of PeiP and PeiW in addition, it has formed the 3rd conservative site (Makarova etc. of catalysis triplet, 1999, Luo etc., 2002).And, in ORF 2058, also found Gly-His-Tyr motif around catalytic His residue among PeiP and the PeiW.These discoveries show that ORF 2058 is Bacteriolysin gene, function are that methane tyrothricin cell is ruminated in cracking in the phage splitting circulation.ORF 2058 and PeiP are crosslinked with the ancient mycetocyte wall peptide that the difference between PeiW may have been reacted different, have therefore reacted different peptase substrate specificities.

Embodiment 5B: phage induction

Ruminate methane tyrothricin (Methanobrevibacter ruminantium) bacterial strain M1 ^T(DSM1093) grow in (minimum medium, Joblin etc., 1990) in the BY+ substratum, this substratum is by [g/l] NaCl (1), KH ₂PO ₄(0.5), (NH ₄) ₂SO ₄(0.25), CaCL ₂.2H ₂O (0.13), MgSO ₄.7H ₂O (0.2), K ₂HPO ₄(1), liquid (300ml), dH are ruminated in clarification ₂O (360ml), NaHCO ₃(5), resazurin (0.2ml), L-cysteine hydrochloride (0.5), yeast extract (2) and Bach's trace element solution (10ml) (add trace element; Balch etc., 1979) form, by (g/l) NTA nitrile triacetic acid (1.5), MgSO ₄.7H ₂O (3), MnSO ₄.H ₂O (0.5), NaCl (1), FeSO ₄.7H ₂O (0.1), CoCl ₂.6H ₂O (0.1), CaCl ₂(0.1), ZnSO ₄.7H ₂O (0.1), CuSO ₄.5H ₂O (0.01), AlK (SO ₄) ₂.12H ₂O (0.01), H ₃BO ₃(0.01), Na ₂MoO ₄.2H ₂O (0.01), NiSO ₄.6H ₂O (0.03), Na ₂SeO ₃(0.02) and Na ₂WO ₄.2H ₂O (0.02) forms.

As wavelength 600 (OD ₆₀₀) time optical density(OD) (OD) measured when 0.10-0.14, use the stimulation of 1ml and 2ml sterile air (～160 to 320 μ l oxygen) (Fig. 1 C) and 2 μ g/ml ametycins (Fig. 1 D) to ruminate the methane tyrothricin respectively.Two kinds of stimulations all can be observed typical clastogram, and be～90 minutes the latent period of air stimulation.The firstling that ametycin stimulates shows very short latent period.For phage is excised in verification from host genome, design two oligonucleotide, respectively towards two phage attachment site (R1F:caaagagagattaaagaagcagacg; SEQ ID NO:146 and L2Ragtagtgttggaatcagtgaaaagg; SEQ ID NO:147).If phage genome is cyclisation once more after excision, this then can produce amplicon to primer.

Fig. 1 E has described when ruminating the methane tyrothricin with air stimulation, initial excision experiment.Induce the back to find explicit amplicon, show the cutting of success and cyclisation again with expectation size.Ruminate in the methane tyrothricin cell at inductive not and also to find similar but faint band, show in the growth of normal non-stimulation,

Ability with spontaneous cutting.

Embodiment 5C: lyase Bioexperiment

ORF 2058 encoded polypeptides can be used as cud methanogen specificity lyase, and subclone is gone into coli expression carrier and is used to produce recombinant protein.Use primer Mbbrum11for22 (1122For, cac cat ggt tag att cag cag aga c; SEQ ID NO:148) and Mbbrum 11rev22 (1122Rev, tca tgc agg aca gac aac ata gta g; SEQ ID NO:149) by the PCR ORF 2058 that increases in 150 μ L reaction systems, this reaction system contains 121.5ng and ruminates methane tyrothricin bacterial strain M1 genomic dna; 0.2 μ M 1122For and 1122Rev primer; 15 μ L Accuprime Pfx damping fluids (containing dNTP, Ying Jun company (InVitrogen)); 2.4 μ L Accuprime Pfx (Ying Jun company).The PCR condition is 95 ℃ of initial sex change in 2 minutes, carries out 35 following circulations then: 95 ℃ 15 seconds, 55 ℃ 30 seconds and 68 ℃ 40 seconds.Need not last extension step.Purified pcr product, and quantitative with Nanodrop (Thermo Fischer Scient Inc., State of Georgia, US).

ORF 2058 clone: recommend according to manufacturer, the PCR-ORF 2058 that increases is cloned in pET 100 or the pET 151-D Topo carrier (Ying Jun company), and is transformed in chemoreception attitude TOP 10 cells (Ying Jun company).With bacterium colony pcr analysis transformant, plasmid DNA purification and order-checking.Selection has the clone of the dna sequence dna of coupling ORF 2058.

ORF 2058 expresses: utilize electroporation to be transformed in electroreception attitude BL21* or Rosetta 2 cells from the plasmid DNA that contains through the clone of the ORF of verification 2058 insets.Find expressing solubility ORF 2058 proteic optimal growth conditions is LB substratum, induce with 0.5mM IPTG during in absorbancy 600 for 0.48-0.6, and 30 ℃ of continuation cultivations 6 hours.Centrifugal collecting cell is also frozen in-20 ℃ then.

Lysis: melt cell mass, and be resuspended in (pH 7.5): 300mMNaCl, 2mM DTT, 10mM imidazoles, 20mM Tris, 20% glycerine, 1%Triton-X, 5mMCaCl in the following damping fluid ₂With 10mM MgCl ₂Adding the N,O-Diacetylmuramidase final concentration is 1mg/ml, stirs 30min then gently on ice.Add DNA enzyme I and RNA enzyme I, final concentration is 5 μ g/ml, stirs gently on ice 30 minutes then.12, centrifugal 15 minutes of 000rpm slightly carries lysate with the filtration of 0.8 μ m filter with cell lysate.

Nickel affinity chromatography: will put on 80mL nickel affinity column from the filtering supernatant of lysis step, and with the following damping fluid that contains the 20mM-250mM imidazoles (pH 7.5) gradient elution: 300mMNaCl, 2mM DTT, 20mM Tris and 20% glycerine.With being equipped with 10, the Mi Libo ultrafiltration cell of 000kDa weight shutoff film concentrates the expressed 0RF 2058 proteic components that contain of from the chromatography column wash-out.Utilize ORF 2058 constructions among the pET100 that following elution buffer expresses the wash-out e. coli bl21 * cell: pH 8.2 (20mM Tris, 250mM imidazoles, 300mMNaCl, 10mM b-mercaptoethanol, 10% glycerine) from the nickel post, and in the damping fluid that adds glycerine and dithiothreitol (DTT) in addition, store enzyme, the final concentration of this damping fluid is 40% glycerine, the 1mM dithiothreitol (DTT), pH8.2.

Desalination: use to contain following damping fluid (pH 7.0): 250mL BioGel P6DG (the Bole company of 20mM MOPS, 1mM DTT, 300mMNaCl and 20% glycerine, California, USA) (BioRad, CA, USA) post carries out desalination to the protein concentrate of pET 151 constructions expression in Rosetta 2 cells.Concentrate component as mentioned above, final sample is filtered and use liquid nitrogen flash freezer, be stored in-20 ℃ then from post.

The cracking tranquillization ruminate methane tyrothricin cell: the culture of 5ml being ruminated methane tyrothricin M1 (DSM 1093) in containing the Heng Gaite test tube of BY+ substratum (Hungate tube) is cultured to the logarithm later stage, under the room temperature 5, the cell that 000x collected in the Heng Gaite test tube in centrifugal 30 minutes.Cell is moved to (95%CO in the anaerobic chamber ₂-5%H ₂, skill Products Lab Inc of section, Michigan, USA) (CoyLaboratory Products, MI, USA), and supernatant discarded, the cell of 10ml culture is resuspended in 1ml MOPS pH of buffer 6.8 (50mM MOPS, 5mM CaCl in the future ₂, the 1mM dithiothreitol (DTT)) in.MOPS damping fluid diluting cells suspension with other, its OD (600nm) is adjusted to～0.12.

(50 μ l) is dispensed in the microwell plate with the standard cell lines suspension, adds ORF 2058 lyase (by the preparation of pET 100 constructions) of different concns, will react cumulative volume with damping fluid and mend to 250ml.At 37 ℃ of incubated cells and egg white mixture, and the record OD value of reading.Tranquillization ruminate add enzyme (each experiment add enzyme μ g number) in the methane tyrothricin cell effect as shown in Figure 7.Compare with the control cells that does not add enzyme, the adding of enzyme reduces the OD 600nm reading of suspension cell in dosage dependence mode.This shows that ORF 2058 lyase can be attacked and methane tyrothricin resting cell is ruminated in cracking under oxygen free condition.

Cracking growth ruminate methane tyrothricin cell: ruminate the methane tyrothricin and grow in the RM02 substratum.The RM02 substratum is formed (g/L): KH by following component ₂PO ₄(1.4), (NH ₄) ₂SO ₄(0.6), KCl (1.5), trace element solution SL10 (1ml), selenium/tungsten solution (1ml), 0.1% (w/v) resazurin solution (4).With the mixed anaerobic 100%CO that is incorporated in of component ₂Condition under boil, use 100%CO ₂Bubbling also cools off in ice bath.The cooling back adds NaHCO ₃(4.2g) with L-cysteine hydrochloride H ₂O (0.5g) is dispensed to the 9.5ml substratum in the Heng Gaite pipe, uses 100%CO ₂Test tube is ventilated.With the test tube autoclaving, lucifuge stores 24h before using.Before the inoculation, add NoSubRFV (every pipe 0.5ml comprises substrate, yeast extract, VITAMIN).Use 80%CO after the inoculation ₂/ 20%H ₂Ventilate to 25lb/in ²Ruminate the methane tyrothricin and grow to mid-log phase (OD 600nm～0.1), at this moment add ORF 2058 lyase (by pET 151D Topo clone preparation) of different concns.Continue to hatch culture and write down the OD reading.Add enzyme forms (after representing to grow 217 hours with bracket relative add the % methane generation that contrasts) to ruminating growth of methane tyrothricin and methane influence as shown in Figure 8.The result shows that ORF 2058 lyase rely on the mode remarkably influenced with dosage and ruminate the growth of methane tyrothricin, is adding the OD 600 that reduces grown culture in 2 hours.Enzyme adding also minimizing methane formation of twice highest level, similar to the degree that adds chloroform (100 μ l/10ml culture).

Embodiment 6: general introduction

A unexpected discovery of ruminating in the methane tyrothricin gene order-checking is to have the prophage sequence.Analysis and Identification for genome sequence goes out unusual high GC content district, wherein comprises the relevant gene of multiple phage.Further bioinformatic analysis identifies the one-piece construction of the prophage of prediction, and is called About 40% phage gene is appointed as different functional group, comprises phage integration, dna replication dna and packing, phage structural protein and cracking.The dna sequence dna of discovery side joint phage genome is represented potential phage integration site (attL and attR).

As if phage ruminates the inferring in the membranin of methane tyrothricin with itself being inserted into, and this albumen may contain

The original methanogen integration site of phage genome, attB.And the terminator spline structure that is found in the dna replication dna module is considered to represent the phage DNA replication orgin.The assembly of DNA sulfur modification system is seemingly contained in the low-G C district of phage genome 3 ' end, comprises the gene that may control the dnd system expression.These genes may be brought in the genome of ruminating the methane tyrothricin in the process that phage is integrated, and it is still waiting to illustrate the role aspect modification phage, host or the foreign DNA.Ruminate the methane tyrothricin and show that for the reservation of dnd system it is benefited the host.Yet,

The effect of dnd system in ruminating the modification of methane tyrothricin or foreign DNA is still waiting research.

The interesting characteristics of another of sequence be corresponding low GC district and with the number of the lower antisense strand encoding gene of various organism protein matchings.This show these genes its be integrated into ruminate the methane tyrothricin after

Genome in accumulate, on behalf of insertion in progress, these genes may set up, and perhaps finally causes the domestication of phage inactivation and phage.With ruminate methane tyrothricin genome and compare

The high GC content of phage sequence shows that it originates from another organism.Yet host before is not clear and definite, because compare with other known up to now phage

Protein demonstrates certain uniqueness.

Especially allow the people interested about what reduce methane Gene is those genes that are arranged in the cracking box.Specifically, the protein of genes encoding and C39 peptase falmily resemblance.This peptide enzyme family comprises viral halfcystine endopeptidase etc., as isopeptidase in the ancient bacterium phage of C71, and the crosslinked peptide in the false murein of this enzyme cutting composition methane tyrothricin cell walls.According to the gene location in the phage genome and with colinearity from isopeptidase in other non-false murein of ruminating the methanogen phage genome, the lysin gene of the lyase before this gene can be used as coding and participates in the phage offspring and discharge in the lysis.Enzyme to this gene and its coding is interested especially, because may ruminate controlling mechanism is arranged in the methanogen at ruminate methane tyrothricin and other with similar cell walls.

The enzyme of ruminating phage and participation cracking host cell thereof may be used to methanogen colony and the member of other group (bacterium, protozoon and fungi) in the control cud.In addition, by the life cycle of research phage, might identify the host enzyme target spot that is easy to be subjected to the key that phage protein suppresses.The inventor carried out investigation to the composition of ruminating phage in ox, sheep and the deer, showed phage quantity and type over time.Also identify the New Zealand's methanogen isolate that influenced by phage.Utilize pure methanogen culture to estimate bacterial virus catenase, exploitation based on the technology of culture and PCR with the screening new phage.Purifying can carry out the random dna sequencing analysis from the phage of cud sample, thereby finds phage enzyme.

Phage or its enzyme have multiple advantage in the mitigation technique that is used for reducing discharge of methane.Phage is the natural member in the rumen microorganism group, therefore, can not be regarded as antibiotic therapy (and can more easily overcome any regulatory limits).Phage has specificity to the host of close limit usually, therefore can selectivity target methanogen.Think that now the phage treatment is to the organic a kind of treatment of microbiotic tolerance type, be commonly considered as safe.In case produce, phage is relatively stable usually.To introduce cud to the methanogen bacterial strain of phage susceptible and may have long-term benefit, under the situation about inoculating especially in early days (as lamb or and calf).Known some methanogen comprises phage genome, to lytic phage susceptible or autolyze (prompting has lyase), comprise Shi Shi methane tyrothricin (Methanobrevibacter smithii) (bacterial strain PS), Bu Shi methagen (Methanobacteriumbryantii) and methane tyrothricin bacterial strain MF-1.Suppress to cause that an organic known example of agricultural problem is to use phage target colon bacillus 0157: H7 with phage.

The methane tyrothricin is ruminated in selection, and to carry out gene order-checking be because extensively there be (based on cultivating and the Molecular Detection data) in its ruminant tumor gastric under various raising conditions, obtain culture easily, the chamber routine that is easy to experimentize is cultivated and can be obtained about this organic a large amount of early-stage Study data and background document.The invention provides about ruminating the genomic significant data of methane tyrothricin, and phage in the cud is carried out detailed composition.

The prophage sequence provides concrete reagent for suppressing to ruminate the genetics manipulation that helps to determine gene function in methane tyrothricin and future.Can utilize the conservative function/assembly in this phage blocking-up methanogen to form with the methane that prevents or reduce in the cud.

Reference

Altermann E, Klaenhammer TR (2005) path exploration people: carry out path mapping (PathwayVoyager:pathwaymapping using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database) .BMC Genomics 6:60-66 with capital of a country gene and genome (KEGG) encyclopedia database.

Altermann, E Klaenhammer TR (2003) GAMOLA: sequence note and to prokaryotic gene group sketch with finish new local solution (GAMOLA:a newlocal solution for sequence annotation and analyzing draft and finishedprokaryotic genomes) the .OMICS:A journal of integrative biology 7 that sequence is analyzed, 161-169.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997), breach BLAST and PSI-BLAST: protein database search program (Gapped BLAST and PSI-BLAST:a new generation of protein databasesearch programs) the .Nucleic Acids Research 25 of a new generation, 3389-3402.

Balch WE, Fox GE, Magrum LJ, Woese CR, Wolfe RS (1979) methanogen: (Methanogens:reevaluation of a uniquebiological group) the .Microbiological Reviews 43 that reappraises of a unique biology colony, 260-296.

Baresi, L. and Bertani, G.1984. the bacteriophage (Isolation of a bacteriophage for a methanogenic bacterium) that separates a kind of methanogen, publish in " U.S. microorganism association annual meeting summary " (Abstracts of the Annual Meeting of the American Societyfor Microbiology), the Washington D.C., U.S. microorganism association (Washington DC:AmericanSociety for Microbiology), the 133rd page.

Bickle, T.A. and D.H.Kruger.1993, the restricted biology of DNA (Biology ofDNA restriction) .Microbiol.Rev.57:434-450.

(Complete genome sequence of the methanogenic archaeon, Methanococcusjannaschii) .Science 273,1058-1073. for the complete genome group sequence of product such as Bult CJ (1996) methane archeobacteria Zhan Shi methanogen

Coutinho PM, Henrissat B (1999) carbohydrate-organized enzyme: integral data scheme. " latest developments of carbohydrate biotechnology " (Carbohydrate-active enzymes:anintegrated database approach. ' Recent Advances in CarbohydrateBioengineering ') (HJ Gilbert, G Davies, B Henrissat and B Svensson compile) the chemistry meeting of 3-12 imperial family, Cambridge (The Royal Society of Chemistry, Cambridge) (carbohydrate activity enzyme database (Carbohydrate Active Enzymes database) Http:// www.cazy.org/).

Delcher AL, Harmon D, Kasif S, White O, Salzberg SL (1999) improves microbial gene identification (Improved microbial gene identification withGLIMMER) .Nucleic Acids Research 27,4636-4641 with GLIMMER.

Fleischmann, the genome sequencing of RD etc. (1995) hemophilus influenzae Rd and assembling (Whole-genome random sequencing and assembly of Haemophilus influenzaeRd) .Science 269,496-512.

Fricke WF, Seedorf H, Henne A, Kruer M, Liesegang H, Hedderich R, Gottschalk G, Thauer RK (2006) Si Shi methane ball bacteria genome sequence are disclosed as the ancient bacterium of who small intestine and only limit to form methane and synthetic ATP (The genome sequenceof Methanosphaera stadtmanae reveals why this human intestinal archaeon isrestricted to methanol and H with methyl alcohol and H2 ₂For methane formation and ATP synthesis) .Journal of Bacteriology 188,642-658.

Godde JS, Bickerton A (2006) is called repeated DNAe and the genes involved thereof of CRISPR: the evidence of horizontal transfer between the protokaryon animal (The repetitive DNAe called CRISPRs andtheir associated genes:evidence of horizontal transfer among prokaryotes.) Journal of Molecular Evolution 62,718-729.

Haft DH, Selengut J, Mongodin EF, guide (a guild of45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cassubtypes exist in prokaryotic genomes) the .PLoS Computational Biology1:474-483 of 45 relevant (Cas) protein familieses of CRISPR and multiple CRISPR/Cas hypotype in Nelson KE (2005) the prokaryotic gene group.

Jansen R, Embden JD, Gaastra W, DNA repeats evaluation (Identification of genes that are associated with DNArepeats in prokaryotes) the .Molecular Microbiology 43 of genes involved, 1565-1575 in Schouls LM (2002) prokaryotic cell prokaryocyte.

Jansen R, van Embden JD, Gaastra W, Schouls LM (2002) identifies that in prokaryotic cell prokaryocyte novel sequence repeats the .OMICS:A journal of integrative biology 6 of family (Identification of a novel family of sequence repeatsamong prokaryotes), 23-33.

Jensen LJ, Friis C, three kinds of viewpoints of Ussery DW (1999) microbial genome (Threeviews of microbial genomes) .Research in Microbiology 150,773-777.

Joblin KN, Naylor GE, Williams AG (1990) Shi Shi methane tyrothricin ruminates the active influence of fungi xylan hydrolysis (Effect of Methanobrevibacter smithii onxylanolytic activity of anaerobic ruminal fungi) .Applied and EnvironmentalMicrobiology 56,2287-2295 to anaerobism.

Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M (2004) deciphering genomic KEGG resource (The KEGG resource for deciphering the genome) .NucleicAcids Research 32, D277-D280.

Kiener, A., Konig, H., Winter, J. and Leisinger, purifying and utilize false kytoplasm wall endopeptidase cracking hot autotrophic methane bacteria (the Purification and use ofMethanobacterium wolfeii pseudomurein endopeptidase for lysis ofMethanobacterium thermoautotrophicum.) J.Bacteriol.169 of Wo Shi methagen, 1010-1016. T.1987.

Knox, M.R. and Harris, J.E.1986. separate and characterize the 14 the international microorganism conference summary of phage (Isolation and characterisation of a bacteriophage of Methanobrevibactersmithii.) (Abstracts of the XIV InternationalCongress on Microbiology) of Shi Shi methane tyrothricin, Manchester: international microorganism alliance of association (Manchester:International Union of Microbiological Societies).

Kurtz S, Schleiermacher C (1999) REPuter: the maximum multiple of complete genome group calculates (REPuter:fast computation of maximal repeats in complete genomes) .Bioinformatics 15,426-427 fast.

Lowe TM, Eddy SR (1997) tRNAscan-SE: improve program (tRNAscan-SE:a program for improved detectionof transfer RNA genes in genomic sequence) the .Nucleic Acids Research 25 that transfer RNA gene in the genome sequence is detected, 955-964.

Loenen, the restricted alleviation albumen (Ra1) of W. and N.Murray.1986. phage strengthen modification (Modification enhancement by restriction alleviation protein (Ral) ofbacteriophage lambda.) J.Mol.Biol.190:11-22.

Lucchini, S., the comparative genomics support module Evolution Theory of F.Desiere and H.Brussow.1999. thermophilus streptococcus phage kind (Comparative genomics of Streptococcusthermophilus phage species supports a modular evolution theory) .J.Virol.73:8647-8656.

Luo, Y.N., Pfister, P., Leisinger, T. and Wasserfallen, A.2002. isopeptidase PeiW and PeiP in the false murein, relevant member (the Pseudomurein endoisopeptidases PeiW and PeiP of two moderates of the novel proteolytic enzyme family that methane thermophilic bacteria bacterial strain produces, twomoderately related members of a novel family of proteases produced inMethanothermobacter strains), FEMS Microbiol.Lett.208,47-51.

Makarova, K.S., Aravind, L. and Koonin, E.V.1999. with superfamily (the A superfamily of archaeal of animal trans-glutaminases homologous archeobacteria, bacterium and eukaryotic protein, bacterial, and eukaryotic proteins homologous to animal transglutaminases) .Protein Sci.8,1714-1719.

Makarova KS, Grishin NV, Shabalina, SA, Wolf YI, infer in Koonin EV (2006) prokaryotic cell prokaryocyte based on RNA interferential immunity system: with computer analyses and prediction enzyme machine, eucaryotic RNA i function is analogized and false work done in the manner of a certain author mechanism (A putative RNA-interference-basedimmune system in prokaryotes:computational analysis of the predictedenzymatic machinery, functional analogies with eukaryotic RNAi, andhypothetical mechanisms of action) .Biology Direct 1:7-32.

New Zealand's statistics 2005 ( Www.stats.govt.nz).

New Zealand's greenhouse gases catalogue (New Zealand ' s Greenhouse Gas Inventory) 1990-2004.Country's catalogue report and general reporting format (The National Inventory Report andCommon Reporting Format). (2006) Department of the Environment (Ministry for the Environment). Http:// www.mfe.govt.nz/publications/climate/nir-apr06/nir-apr06 .pdf

Reeve JN, Nolling J Morgan RM, Smith DR (1997) methane generates: gene, genome, who is first? (Methanogenesis:genes, genomes and who ' s on first?) Journal of Bacteriology 179,5975-5986.

Rawlings, N.D., Morton, F.R. and Barrett, A.J.2006.MEROPS: peptase database (MEROPS:the peptidase database) .Nucleic Acids Res.34, D270-D272.

Samuel BS, Hansen EE, Manchester JK, Coutinho PM, Henrissat B, Fulton R, Latreille P, Kim K, Wilson RK, Gordon JI (2007) Shi Shi methane tyrothricin adapts to (Genomic adaptations of Methanobrevibacter smithiito the human gut) .Proceedings of the National Academy of Sciences USA 104,10643-10648 to HE genome.

The complete genome group sequence of (1997) hot autotrophic methane bacteria H such as Smith DR: functional analysis and comparative genomics (Complete genome sequence of Methanobacteriumthermoautotrophicum Δ H:Functional analysis and comparative genomics) .Journal of Bacteriology 179,7135-7155.

Smith PH, Hungate RE (1958) ruminate separation and sign (Isolationand characterization of Methanobacterium ruminantium n.sp.) the Journal ofBacteriology 75 of methane tyrothricin, 713-718.

Staden R, Beal KF, Bonfield JK (1998) Si Tadeng software package (The StadenPackage). molecular biology method: bioinformatics method and experiment guide (Methods inMolecular Biology:Bioinformatics Methods and Protocols) 132,115-130.

Tatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS, Kiryutin B, Galperin MY, Fedorova ND, Koonin EV (2001) COG database: from new development (The COGdatabase:new developments in phylogenetic classifcation of proteins fromcomplete genomes) the Nucleic Acids Research 29 that the proteinic phylogeny of complete genome group is classified, 22-28.

It is for referencial use that all publications that above-mentioned specification sheets is mentioned and full patent texts are included this paper in.

If mention content with known equivalents with reference in the above-mentioned specification sheets, also include these equivalents in this paper so, just look like to list separately in this article like that.Though in conjunction with concrete preferred embodiment the present invention is described, should be appreciated that as claimed in claim, the present invention should not be subject to these specific embodiments excessively.Should be understood that under the situation that does not deviate from design of the present invention and scope, can do further modification the present invention.

Claims (57)

1. isolated polypeptide, it comprises the aminoacid sequence that is selected from SEQ ID NO:2-5.

2. isolated polypeptide, it comprises the aminoacid sequence that is selected from SEQ ID NO:62.

3. isolated polypeptide, it comprises the aminoacid sequence that is selected from SEQ ID NO:63 or 72.

4. isolated polypeptide, it comprises the aminoacid sequence that is selected from SEQ ID NO:64-68.

5. isolated polypeptide, it comprises the aminoacid sequence that is selected from SEQ ID NO:1,6-61 or 69.

6. isolated polypeptide, it has 90% homogeny with the aminoacid sequence that is selected from SEQ ID NO:2-5.

7. isolated polypeptide, it has 90% homogeny with the aminoacid sequence that is selected from SEQ ID NO:62.

8. isolated polypeptide, it has 90% homogeny with the aminoacid sequence that is selected from SEQ ID NO:63 or 72.

9. isolated polypeptide, it has 90% homogeny with the aminoacid sequence that is selected from SEQ ID NO:64-68.

10. isolated polypeptide, it has 90% homogeny with the aminoacid sequence that is selected from SEQ ID NO:1,6-61 or 69.

11. isolating polynucleotide, its coding is selected from the aminoacid sequence of SEQ ID NO:2-5.

12. isolating polynucleotide, its coding is selected from the aminoacid sequence of SEQ ID NO:62.

13. isolating polynucleotide, its coding is selected from the aminoacid sequence of SEQ ID NO:63 or 72.

14. isolating polynucleotide, its coding is selected from the aminoacid sequence of SEQ ID NO:64-68.

15. isolating polynucleotide, its coding are selected from the aminoacid sequence of SEQ ID NO:1,6-61 or 69.

16. isolating polynucleotide, it comprises the nucleotide sequence that is selected from SEQ ID NO:75-78.

17. isolating polynucleotide, it comprises the nucleotide sequence that is selected from SEQ ID NO:135.

18. isolating polynucleotide, it comprises the nucleotide sequence that is selected from SEQ ID NO:136.

19. isolating polynucleotide, it comprises the nucleotide sequence that is selected from SEQ ID NO:137-141.

20. isolating polynucleotide, it comprises the nucleotide sequence that is selected from SEQ ID NO:74,79-134 or 142.

21. the carrier of each described polypeptide among the claim 1-10 that encodes.

22. carrier that comprises each described polynucleotide among the claim 11-20.

23. host cell that comprises claim 21 or 22 described carriers.

24. the host cell of each described polypeptide among the genetically modified coding claim 1-10.

25. genetically modified host cell that comprises each described polynucleotide among the claim 11-20.

26., it is characterized in that described cell is a prokaryotic cell prokaryocyte as each described host cell among the claim 23-25.

27. host cell as claimed in claim 26 is characterized in that, described cell is intestinal bacteria.

28., it is characterized in that described cell is a methanogen as each described host cell among the claim 23-25.

29. host cell as claimed in claim 28 is characterized in that, described cell is to ruminate the methane tyrothricin.

30. a conjugate molecule, it comprises each described polypeptide among the claim 1-10.

31. a conjugate molecule, it comprises claim 3 or 8 described polypeptide.

32., it is characterized in that described molecule also comprises anti-methane and generates compound, signal sequence, antibody or antibody fragment, peptide nucleic acid(PNA), antimicrobial peptide or microbiotic as claim 30 or 31 described conjugate molecules.

33. fusion molecule that comprises each described polypeptide among the claim 1-10.

34. fusion molecule that comprises claim 3 or 8 described polypeptide.

35., it is characterized in that described molecule also comprises anti-methane and generates compound, signal sequence, antibody or antibody fragment, peptide nucleic acid(PNA), antimicrobial peptide or microbiotic as claim 33 or 34 described fusion molecule.

36. one kind with claim 1-10 in each described polypeptide bonded antibody or antibody fragment.

37. antibody as claimed in claim 36 or antibody fragment is characterized in that, described antibody or antibody fragment are polyclonal.

38. antibody as claimed in claim 36 or antibody fragment is characterized in that, described antibody or antibody fragment are monoclonal.

39. one kind isolating

Phage, it comprises each described at least a polypeptide among the claim 1-10.

40. one kind isolating

Phage, it comprises claim 3 or 8 described at least a polypeptide.

41. one kind isolating

Phage, it comprises each described at least a polynucleotide among the claim 11-20.

42. one kind isolating

Phage, it comprises claim 13 or 18 described at least a polynucleotide.

43. pharmaceutical composition that comprises each described polypeptide among the claim 1-10.

44. pharmaceutical composition that comprises each described polynucleotide among the claim 11-20.

45. pharmaceutical composition that comprises each described phage among the claim 39-42.

46. a method that suppresses the methanogen cell, described method comprises: randomly produce or separation claim 3 or 8 described polypeptide; And b) described cell is contacted with described polypeptide.

47. method as claimed in claim 46 is characterized in that, described cell is to ruminate the methane tyrothricin.

48. method as claimed in claim 47 is characterized in that, described cell is to ruminate methane tyrothricin bacterial strain M1 ^T(DSM1093).

49. a method that suppresses the methanogen cell, described method comprises: a) randomly produce or separation claim 31 or 32 described conjugate molecules; And b) described cell is contacted with described conjugate molecule.

50. method as claimed in claim 49 is characterized in that, described cell is to ruminate the methane tyrothricin.

51. method as claimed in claim 50 is characterized in that, described cell is to ruminate methane tyrothricin bacterial strain M1 ^T(DSM1093).

52. a method that suppresses the methanogen cell, described method comprises: a) randomly produce or separation claim 34 or 35 described fusion molecule; And b) described cell is contacted with described fusion molecule.

53. method as claimed in claim 52 is characterized in that, described cell is to ruminate the methane tyrothricin.

54. method as claimed in claim 53 is characterized in that, described cell is to ruminate methane tyrothricin bacterial strain M1 ^T(DSM1093).

55. a method that suppresses the methanogen cell, described method comprises: a) randomly produce or separation claim 40 or 42 described phages; And b) described cell is contacted with described phage.

56. method as claimed in claim 55 is characterized in that, described cell is to ruminate the methane tyrothricin.

57. method as claimed in claim 56 is characterized in that, described cell is to ruminate methane tyrothricin bacterial strain M1 ^T(DSM1093).

Images