RU2520738C2 - PHAGE φ-mru POLYNUCLEOTIDES AND POLYPEPTIDES AND THEIR APPLICATION - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biochemistry, in particular to polypeptides, which are the inhibitors of methanogen cell and biological markers for detection of φmru phage, as well as polynucleotides, which code the said polypeptides. Disclosed are expression vectors and cloning vectors, which contain the said polynucleotides and host cells, containing the said vectors. Described are conjugated or fused molecules, which are the inhibitors of the methanogen cell and biological markers for detection of φmru phage, as well as antibodies, binding with the said polypeptides. Also disclosed is φmru phage, isolated with application of the described polypeptides. The invention also relates to pharmaceutical compositions and methods of inhibiting the methanogen cell with application of the described polypeptides, conjugated or fused molecules.

EFFECT: application of the invention makes it possible to lyse the methanogen cells inhibiting a paunch of ruminants, and/or deliver inhibitors of the methanogen cells.

24 cl, 8 dwg, 6 ex

Description

RELATED APPLICATIONS

This application claims priority to US Application No. 60/975104, filed September 25, 2007, US Application No. 60/989840, filed November 22, 2007, and US Application No. 60/989841, filed November 22, 2007, the contents of each of which are incorporated into this application. description by reference in full.

FIELD OF THE INVENTION

The present invention relates to compositions and methods for the delivery of inhibitory molecules to microbial cells, in particular methane-producing cells. In particular, the present invention relates to a new phmru phage, including phage induction, phage particles and phage genome, as well as phage polypeptides, as well as polynucleotides that encode these polypeptides. The present invention also relates to expression vectors and host cells for the production of these polypeptides. The present invention further relates to methods for determining targeted delivery and inhibition of microbial cells, in particular methane producing cells, using the described phage, polypeptides, polynucleotides, expression vectors and host cells.

BACKGROUND OF THE INVENTION

In New Zealand, agricultural activity accounts for the majority of greenhouse gas emissions. Therefore, reducing agricultural greenhouse gas emissions is important for New Zealand's compliance with the Kyoto Protocol. Under this protocol, greenhouse gases are required to be reduced to 1990 levels by the end of the first commitment period (2008-2012). Towards the end of this period, the Agricultural Sector Groups and the Government of New Zealand approved the Pastoral Greenhouse Gas Research Consortium (PGGRC) to identify ways to reduce New Zealand's agricultural greenhouse gas emissions.

An important part of PGGRC's activity was research on methane emissions from New Zealand pastures. Reducing methane emissions from ruminants is of commercial interest for two reasons. First, failure to comply with Kyoto obligations will force the government to acquire carbon credits. Currently, the cost of this is estimated at $ 350 million. Secondly, the formation of methane leads to a loss of 8-12% of the total energy produced in the rumen. This energy could be used instead to improve the productivity of the ruminant.

Methane is produced in the rumen by microorganisms called methane producers, which are part of the taxonomic type Euryarchaeota in the kingdom of Archaea . Most methanogens grow in CO ₂ and H ₂ as the only sources of energy, but some can use acetate or methyl compounds for growth. There are several different genera of archaea methanogen producers in the rumen, but species of the genus Methanobrevibacter , in particular M. ruminantium and M. Smithii, are considered to be the predominant methanogen producers in ruminants of New Zealand. M. ruminantium is currently the subject of a genome sequencing project funded by PGGRC. This project represents the first sequencing of the genome of rumen methane producers, and its goal is to improve understanding of the biology of Methanobrevibacter to detect targets for inhibiting the formation of methane.

Inhibition of methane producers or inactivation of their methane production pathway is required to reduce the production of methane in the rumen. A method of inhibiting the formation of methane is the delivery of specific inhibitory molecules into the cells of methane producers. This can be achieved, for example, by the use of agents such as a bacteriophage, which specifically targets methane producers. Some phages were described for methane producers of non-ruminant animals, but there were no published reports on the ability of the phage to infect or lyse scar methane producers. Therefore, it would be very preferable to identify a phage that has the ability to infect methane producer cells and / or deliver inhibitors.

Summary of the invention

The invention relates to an isolated phage φmru, including a phage particle and / or phage genome obtained in whole or in part, as well as to isolated polynucleotides and polypeptides of this phage, described in detail in this application.

The present invention also relates to an isolated polypeptide containing at least one phage amino acid sequence selected from the group consisting of SEQ ID NO: 1-69. In a separate aspect, the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2-5 and 62-68. In a further aspect, the polypeptide comprises the amino acid sequence of SEQ ID NO: 63. In another aspect, the polypeptide is a fragment, for example, containing at least one amino acid sequence extending from residues 32-186 of the sequence SEQ ID NO: 63.

The present invention further relates to an isolated polynucleotide comprising the coding sequence of at least one phage polypeptide. In one aspect, the polynucleotide comprises a coding sequence of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69. In a particular aspect, the polynucleotide comprises a coding sequence for a sequence selected from the group consisting of SEQ ID NO: 2-5 and 62-68. In a further aspect, the polynucleotide comprises a coding sequence for SEQ ID NO: 63. In another aspect, the polynucleotide comprises a fragment of a coding sequence, for example at least one amino acid sequence extending from residues 32-186 of the sequence SEQ ID NO: 63.

In a further aspect, the present invention relates to an isolated polynucleotide comprising a phage nucleic acid sequence selected from the group consisting of SEQ ID NO: 74-142. In a particular aspect, the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 75-78 and 135-141, or in particular is SEQ ID NO: 136. In another aspect, the polynucleotide is a fragment or oligonucleotide containing, for example, a nucleic acid sequence extending from nucleotides 94-558 of the sequence SEQ ID NO: 136. In addition, the invention encompasses an isolated polynucleotide or fragment thereof that hybridizes with any of the nucleic acid sequences of SEQ ID NO: 74-142. The present invention further encompasses an isolated polynucleotide comprising a complementary, backward complementary, reverse sequence or fragments thereof, any of the nucleic acid sequences.

The present invention relates to an expression vector containing a polynucleotide containing the coding sequence of at least one phage polypeptide. In one aspect, the expression vector comprises a coding sequence of at least one amino acid sequence selected from the group consisting of sequences of SEQ ID NO: 1-69. In a particular aspect, the expression vector comprises the coding sequence of at least one amino acid sequence of SEQ ID NOs: 2-5 and 62-68. In a further aspect, the expression vector comprises the coding sequence of at least one amino acid sequence of SEQ ID NO: 63. In another aspect, the expression vector comprises a coding sequence of at least one amino acid sequence extending from residues 32-186 of the sequence SEQ ID NO: 63.

As a particular aspect, the present invention relates to an expression vector that produces a phage φmru, in whole or in part, as described in detail in this application. In particular, the expression vector may produce phage particles, a phage genome or a modified phage containing any changes, derivatives, variants or fragments thereof.

The present invention also relates to a host cell, for example, a microbial host cell containing at least one expression vector.

The present invention in particular relates to an antibody induced against a polypeptide or polynucleotide described in this application. In certain aspects, the antibody is directed to at least one polypeptide sequence selected from the group consisting of SEQ ID NO: 1-69 or a modified sequence thereof. In alternative aspects, the antibody is induced against at least a polynucleotide fragment selected from the group consisting of SEQ ID NO: 74-142, or a complementary or modified sequence thereof. In another aspect, the antibody contains one or more fusions or conjugates with at least one cellular inhibitor, for example, anti-methane compounds (e.g. bromoethanesulfonic acid), antibodies and antibody fragments, lytic enzymes, peptide nucleic acids, antimicrobial peptides and other antibiotics described in detail in this application.

The present invention further relates to modified phage polypeptides, for example at least one of SEQ ID NO: 1-69, including the biologically active changes, fragments, variants and derivatives described herein. The present invention further relates to modified antibodies, for example, directed to at least one of the sequences of SEQ ID NO: 1-69, including biologically active changes, fragments, variants and derivatives described in this application. Also described are polynucleotides encoding these modified polypeptides, as well as changes, fragments, variants and derivatives of the described polynucleotides, expression vectors containing these polynucleotides, and host cells containing these vectors. In particular aspects, the modified polynucleotides, or polypeptides, or corresponding expression vectors, or host cells are used in the compositions and methods of the invention.

In addition, the present invention relates to phage polypeptides, for example at least the polypeptide SEQ ID NO: 1-69 or its modified sequences, which include fusions or conjugates with at least one cellular inhibitor, for example compounds against the formation of methane (for example, bromoethanesulfonic acid), antibodies and antibody fragments, lytic enzymes, peptide-nucleic acids, antimicrobial peptides and other antibiotics described in detail in this application.

The invention relates to a composition containing an isolated polypeptide, for example at least the polypeptide SEQ ID NO: 1-69, or a modified sequence thereof. The present invention further relates to a composition comprising an antibody, for example, directed to at least one of SEQ ID NO: 1-69, or a modified sequence thereof. Also described is a composition containing an isolated polynucleotide, for example at least one of SEQ ID NO: 74-142, or a complementary or modified sequence thereof. Additionally described is a composition that contains an expression vector, or a host cell containing an expression vector, in accordance with the present invention. The composition may contain any biologically active changes, fragments, variants and derivatives described in this application. The compositions may contain at least one cellular inhibitor (for example, in the form of a fusion or conjugate), and can be obtained, for example, in the form of pharmaceutical compositions or as food additives, in particular feed components for ruminants.

The invention also relates to a composition according to the invention as part of a kit for the targeted delivery and / or inhibition of microbial cells, especially methanogen producing cells, in accordance with the described methods. These kits contain: a) at least one composition described herein; and b) optionally, instructions for use, for example, for targeted delivery to cells or inhibition of cell growth or replication for methane producers or other microorganisms.

The present invention relates to a method for producing a phage, said method comprising: a) culturing an expression vector or a host cell containing an expression vector that contains at least a portion of the phage genome under conditions suitable for producing this phage; and b) extracting this phage from the culture. In particular aspects, this phage contains at least one polypeptide selected from the group consisting of SEQ ID NO: 1-69, or modified sequences thereof. In additional aspects, this phage contains at least one polynucleotide selected from the group consisting of SEQ ID NO: 74-142, or their modified sequences.

The present invention also relates to a method for producing a phage polypeptide, the method comprises: a) culturing an expression vector or a host cell containing an expression vector that contains at least part of the coding sequence of at least one phage polypeptide under conditions suitable for expression of the polypeptide ; and b) recovering the polypeptide from the culture. In particular aspects, the polypeptide comprises at least one amino acid sequence selected from the group consisting of SEQ ID NOS: 1-69, or modified sequences thereof.

The present invention additionally relates to a method for producing a phage polypeptide, for example at least one of SEQ ID NO: 1-69, which contains a fusion or conjugate with at least one cellular inhibitor, for example, compounds against the formation of methane (e.g. bromoethanesulfonic acid), antibodies and antibody fragments, lytic enzymes, peptide nucleic acids, antimicrobial peptides and other antibiotics described in detail in this application. Such a method comprises: a) culturing an expression vector or a host cell containing an expression vector that contains the coding sequence of at least one phage polypeptide under conditions suitable for expression of the polypeptide; b) the formation of phage fusion or conjugate (for example, by expression of a fused sequence or chemical conjugate with a cell inhibitor); and c) recovering a fusion or conjugate. In particular aspects, the polypeptide comprises at least one amino acid sequence selected from the group consisting of SEQ ID NOS: 1-69, or modified sequences thereof.

In addition, the present invention relates to a method for inhibiting (for example, growth or replication) of a microbial cell, in particular a methanogen producer cell, comprising: a) optionally, obtaining or isolating at least one phage polypeptide; and b) contacting the cell with a phage polypeptide. In a particular aspect, the polypeptide comprises at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or a modified sequence thereof.

As an additional feature, the present invention also encompasses a method of inhibiting (for example, inhibiting the growth or replication) of a microbial cell, in particular a methane producer cell, comprising: a) optionally, obtaining or isolating at least one phage polypeptide that further comprises at least one cellular inhibitor; and b) contacting the cell with a phage polypeptide. In a particular aspect, the polypeptide contains at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or a modified sequence thereof.

The present invention also relates to a method for determining and / or measuring levels of a phage or corresponding phage polypeptide or polynucleotide, comprising: 1) contacting a sample obtained from an individual with an antibody induced against a phage polypeptide (for example, at least one of SEQ ID NO: 1-69, or their modified sequences) or the corresponding polynucleotide; and 2) determining the presence or levels of an antibody complex formed with a polypeptide or polynucleotide in a sample. Such methods can also be used to determine and / or measure the levels of microbial cells, in particular methane producer cells.

The present invention also relates to a method for determining and / or measuring levels of a phage or corresponding phage polynucleotide (e.g., a phage coding sequence), comprising: 1) contacting a sample obtained from an individual with a complementary polynucleotide (e.g., a sequence complementary to any of the SEQ ID sequences NO: 74-142, or their modified sequences); and 2) determining the presence or levels of a hybridization complex formed with a phage polynucleotide in this sample. Such methods can also be used to determine and / or measure the levels of microbial cells, in particular methane producer cells.

In particular aspects, the methods of the invention utilize in vivo or in vitro expression components. In other aspects, the methods utilize polypeptides produced by recombinant, synthetic or semi-synthetic methods, or polypeptides produced by endogenous methods.

Other aspects and embodiments of the present invention are described below.

Brief Description of the Drawings

The present invention is described with reference to specific embodiments thereof and with reference to the drawings.

FIG. 1A-1B. M. ruminantium prophage φmru showing the putative sequences of the integration site att L and att R (FIG. 1A), predicted functional modules of the phage and gene structure (FIG. 1B).

FIG. 1C: Induction of phage using sterile air (oxidative stress).

FIG. 1D: Initial phage induction using mitomycin C.

FIG. 1E: Agarose gel electrophoresis of PCR-induced amplicons (oxygen stimulus) and non-induced M. ruminantium . Lanes 2 and 4: 1 kb ladder DNA marker from Invitrogen. Lanes 1 and 3 represent PCR using a pair of R1F-L2R primers on DNA isolated from induced and non-induced cultures of M. ruminantium , respectively.

FIG. 2. Open reading frame of the prophage φmru, explanations and comments.

FIG. 3. Open reading frame of the prophage φmru, explanations, predicted function and comments.

FIG. 4A-4B. M. ruminantium prophage φmru, sequence information, including coding sequences of phage φmru (FIG. 4A), and amino acid sequences of phage φmru (FIG. 4B).

FIG. 5. Alignment of the sequences of phage φmru ORF 2058 with PeiP from M. marburgensis and PeiW from M. wolfeii .

FIG. 6: Protein sequence of logo signal peptide sequences from M. ruminantium obtained using LogoBar showing core consensus signal.

FIG. 7: Inhibitory effect of ORF 2058 on remaining M. ruminantium cells.

FIG. 8: Inhibitory effect of ORF 2058 on M. ruminantium cell growth and methane production.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

"Altered" nucleic acid sequences encoding phage polypeptides, in the context of the present invention, include sequences with deletions, insertions or substitutions of different nucleotides, resulting in a polynucleotide that preferably encodes the same or functionally equivalent polypeptides. The encoded polypeptide or antibody may also be “modified” and contain deletions, insertions or substitutions of amino acid residues that produce a silent change and result in a functionally equivalent polypeptide. Intentional amino acid substitutions can be made based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues, while maintaining biological activity (e.g., association with the cell or penetration into the cell or cell lysis), or immunological activity (e.g., one or more antibody binding sites) of this polypeptide. For example, negatively charged amino acids may include aspartic and glutamic acid; positively charged amino acids may include lysine and arginine; and amino acids with uncharged polar terminal groups having similar hydrophobicity values may include leucine, isoleucine and valine, glycine and alanine, asparagine and glutamine, serine and threonine, and phenylalanine and tyrosine.

"Amino acid sequence" in the context of the present invention, refers to an oligopeptide, peptide, polypeptide or protein sequence, or any fragments thereof, and to natural, recombinant, synthetic or semi-synthetic molecules. The sequences of the invention contain at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250 amino acids, preferably at least 5-10, from 10-20, from 20-30, 30-40, 40-50, 50-100, 100-150, 150-200, or 200-250, or 250-4000 amino acids, and preferably retain biological activity (e.g., association with the cell, penetration into the cell or cell lysis) or immunological activity (for example, one or more antibody binding sites) of the original sequence. In cases where the “amino acid sequence” cited in the present description refers to the amino acid sequence of a molecule of a natural polypeptide, it is believed that the amino acid sequence and similar terms do not limit the amino acid sequence to the full, original amino acid sequence associated with the full-sized molecule.

"Amplification" in the context of the present invention refers to the production of additional copies of the nucleic acid sequence and is mainly carried out using polymerase chain reaction (PCR) techniques well known in the art (Dieffenbach, CW and GS Dveksler (1995) PCR Primer, a Laboratory Manual , Cold Spring Harbor Press, Plainview, NY).

The term “antibody” should be understood in its broadest sense and the inclusion of intact monoclonal antibodies and polyclonal antibodies is contemplated. The term also encompasses antibody fragments and derivatives, provided that they exhibit the desired biological activity. Antibodies encompass immunoglobulin molecules and immunologically active parts of immunoglobulin (Ig) molecules, i.e. molecules that contain an antigen-binding site that specifically binds (immunologically interacts) with the antigen. Antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fc, Fab, Fab ', and Fab ₂ fragments and the Fab expression library.

Antibody molecules belong to any of the classes of IgG, IgM, IgA, IgE, and IgD, which differ from each other by the nature of the heavy chain located in the molecule. These molecules also include subclasses such as IgG1, IgG2, and others. The light chain may be a kappa chain or a lambda chain. The reference in the present description to antibodies includes a reference to all classes, subclasses and types. Also included are chimeric antibodies, for example monoclonal antibodies or fragments thereof that are specific for more than one source, for example one or more, mouse, human, or ruminant sequences. Additionally included camelid antibodies or nanobodies. It will be understood that each reference to “antibodies” or any similar term in the present description includes intact antibodies, as well as any fragments, measurements, derivatives or variants thereof.

The terms “biologically active” or “functional”, as used herein, refer to a polypeptide that retains one or more structural, biological or biochemical functions (eg, association with a cell, penetration into a cell or lysis of a cell) of a sequence.

The terms “cell inhibitor” or “inhibitor,” as used herein, refer to agents that reduce or block the growth or replication of microbial cells, especially methane producing cells. A cell inhibitor can act to reduce or block, for example, cell division. An inhibitor can reduce or block, for example, DNA synthesis, RNA synthesis, protein synthesis, or post-translational modifications. An inhibitor can also reduce or block the activity of enzymes involved in the methane formation cascade. An inhibitor can target a cell for recognition by components of the immune system. Cell inhibition also includes cell killing and cell death, for example, by lysis, apoptosis, necrosis, etc. Suitable inhibitors include, but are not limited to, compounds against the formation of methane (e.g., bromoethanesulfonic acid), antibodies and antibody fragments that lyse enzymes, peptide nucleic acids, antimicrobial peptides and other antibiotics described in detail in this application.

The terms “complementary” or “complementarity”, in the context of the present invention, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base pairing. For the A-G-T sequence, the complementary sequence is T-C-A, the backward complementary sequence is A-C-T, and the reverse sequence is T-G-A. The complementarity between two single-stranded molecules can be partial, in which only some of the nucleic acids bind, or can be complete when there is absolute complementarity between single-stranded molecules. The degree of complementarity between nucleic acid chains has significant effects on the efficiency and strength of hybridization between nucleic acid chains. This is of particular importance in amplification reactions, which depend on the binding between nucleic acid chains, and in the creation and use of PNA molecules.

The term "derivative" in the context of the present invention refers to the chemical modification of a nucleic acid encoding a phage polypeptide, or a nucleic acid complementary to it. Such modifications include, for example, replacing hydrogen with an alkyl, acyl, or amino group. In preferred aspects, the nucleic acid derivative encodes a polypeptide that retains the biological or immunological function of a naturally occurring molecule. A derived polypeptide is a polypeptide that is modified by glycosylation, pegylation, or any similar method that retains one or more biological functions (e.g., association with a cell, penetration into a cell, or lysis of a cell) or the immunological function of a sequence that it is derived from.

The term "homology" in the context of the present invention refers to the degree of complementarity. Homology may be partial (i.e., identity less than 100%) or complete (i.e., 100% identity). A partially complementary sequence that at least partially inhibits the hybridization of an identical sequence with a target nucleic acid is called using the functional term “substantially homologous”. Inhibition of hybridization of a fully complementary sequence to a target sequence can be investigated by hybridization analysis (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or hybridization probe will compete for or inhibit the binding of a fully homologous sequence to the target sequence under conditions of low stringency. This is not to say that low stringency conditions are such that non-specific binding is allowed; low stringency conditions require that the binding of two sequences to each other be a specific (i.e., selective) interaction.

The term "hybridization" in the context of the present invention refers to any process by which a nucleic acid strand binds to a complementary strand via base pairing.

An “insertion” or “addition” in the context of the present invention refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides, respectively, compared to a natural molecule.

"Methanoproducer" in the context of the present invention refers to microorganisms that produce methane gas, which include Methanobrevibacter , Methanothermobacter , Methanomicrobium , Methanobacterium , and Methanosarcina . Typical metanoprodutsenty include, but not limited to, Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter acididurans, Methanobrevibacter thaueri, Methanobacterium bryantii, Methanobacterium formicicum, Methanothermobacter marburgensis, Methanothermobacter wolfeii, Methanosphaera stadtmanae, Methanomicrobium mobile, Methanosarcina barkeri, Methanosarcina mazei, Methanococcoides burtonii, and Methanolobus taylorii . All genders and species of methane producers are covered by this term.

"Microbial" cells in the context of the present invention relate to natural or genetically modified microbial cells, including archebacteria, such as methanoproducers, halophiles and thermoacidophils, and eubacteria, such as cyanobacteria, spirochetes, proteobacteria, as well as gram-positive and gram-negative bacteria.

The term “modified” refers to altered sequences and to fragments, variants and derivatives of the sequences described in the present invention.

A "nucleic acid sequence" or "nucleotide sequence" in the context of the present invention refers to a sequence of a polynucleotide, oligonucleotide or fragments thereof, and to DNA or RNA of natural, recombinant, synthetic or semi-synthetic origin, which may be single-stranded or double-stranded, and may be semantic or antisense strand, and coding or non-coding regions. The sequences of the present invention most preferably include sequences encoding a polypeptide that contain at least 12, 15, 30, 45, 60, 75, 90, 105, 120, 135, 150, 300, 450, 600, 750 nucleotides, preferably in at least 15-30, 30-60, 60-90, 90-120, 120-150, 150-300, 300-450, 450-600, or 600-750 nucleotides, or at least 1000 nucleotides, or at least at least 1,500 nucleotides. It will be understood that each reference to a “nucleic acid sequence” or “nucleotide sequence” in the present invention will include the original full-length sequence, as well as any complementary sequences, fragments, changes, derivatives or variants thereof.

The term "oligonucleotide" refers to a nucleic acid sequence containing at least 6, 8, 10, 12, 15, 18, 21, 25, 27, 30 or 36 nucleotides, or at least 12 to 36 nucleotides, or at least at least 15 to 30 nucleotides, which can be used, for example, in PCR amplification, sequencing or hybridization assays. In the context of the present invention, the oligonucleotide is essentially equivalent to the terms “amplifiers”, “primers”, “oligomers”, “oligomers” and “probes”, as commonly defined in this field.

"Polypeptide" in the context of the present invention refers to the isolated polypeptides of the invention obtained from any species, preferably microbial, from any source, whether natural, synthetic, semisynthetic or recombinant. In particular, the phage polypeptide can be obtained from methanogen producing cells, such as Methanobrevibacter cells, in particular M. ruminantium , or M. smithii cells. For recombinant production, the polypeptide of the present invention can be obtained from microbial or eukaryotic cells, for example, Escherichia , Streptomyces , Bacillus , Salmonella , yeast, insect cells such as Drosophila , animal cells such as COS and CHO cells, or plant cells. It will be understood that each reference to a “polypeptide” in the context of the present invention will include an original, full-length sequence, as well as any changes, derivatives or variations thereof.

The term “polynucleotide”, used in the singular or plural, generally refers to any nucleic acid sequence, for example, any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, or a modified RNA or DNA. This term includes, without limitation, single-stranded and double-stranded DNA, DNA containing single-stranded and double-stranded regions, single-stranded and double-stranded RNA and RNA, containing single-stranded and double-stranded regions, hybrid molecules containing DNA and RNA, which can be single-stranded or, more often, double-stranded , or contain single and double helical regions. Also included are RNA or DNA containing three-helix regions, or both RNA and DNA. In particular, mRNA, cDNA and genomic DNA, and any fragments thereof are included. This term includes DNA and RNA that contain one or more modified bases, such as tritium labeled bases, or unusual bases, such as inosine. Polynucleotides of the present invention can encompass coding or non-coding sequences, or sense or antisense sequences, or iRNAs, such as siRNAs. It will be understood that each reference to a “polynucleotide” or similar term in the context of the present invention will include full-length sequences, as well as any complementary sequences, fragments, measurements, derivatives or variants thereof.

"Peptide-nucleic acid" or "PNA" in the context of the present invention refers to an antisense molecule, or an antigenic agent that contains bases linked through a peptide backbone.

The term "ruminant" in the context of the present invention refers to animals that have a scar as a special type of digestive organ. Ruminants include, but are not limited to, cattle, sheep, goats, bulls, moose, caribou, and deer.

The terms “stringency conditions” or “stringency” in the context of the present invention refer to hybridization conditions defined by nucleic acid, salt and temperature. These conditions are well known in the art and can be modified in order to identify or identify identical or related polynucleotide sequences. See, for example, Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY. Numerous equivalent conditions involving either low or high stringency depend on factors such as length and nature of the sequence (DNA, RNA, nucleotide composition), nature of the target (DNA, RNA, nucleotide composition), environmental conditions (in solution or immobilized on solid substrate), the concentration of salts or other components (e.g. formamide, dextran sulfate and / or polyethylene glycol), and the reaction temperature (within a range of about 5 ° C below the melting point of the probe to about 20 ° C-25 ° C below temperature ur melting). One or more factors can be modified to create conditions of either low or high rigidity, different from the conditions listed above, but equivalent to them.

The term "individual" includes humans and animals that are not related to humans. Non-human animals include, but are not limited to, birds and mammals such as ruminants, and in particular mice, rabbits, cats, dogs, pigs, sheep, goats, cows and horses.

The terms "substantially purified" or "isolated" in the context of the present invention refers to nucleic or amino acid sequences that are isolated from their cellular, recombinant or synthetic medium, and are at least 60% free, preferably 75% free, and most preferably at least 90% free or at least 99% free of other components with which they are associated in a cellular, recombinant or synthetic medium.

"Transformation" in the context of the present invention describes a process by which exogenous DNA enters and modifies a recipient cell. This can occur under natural or artificial conditions using various methods well known in the art. The transformation may be based on any known method of inserting sequences of foreign nucleic acids into a prokaryotic or eukaryotic host cell. The method is selected based on the type of transformable host cell, and may include, but not limited to, viral infection, electroporation, heat shock, lipofection, and particle bombardment. Such "transformed" cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of a host chromosome. They also include cells that transiently express inserted DNA or RNA for limited periods of time.

A “variant” of a polypeptide in the context of the present invention refers to an amino acid sequence that is altered by one or more amino acids. A polynucleotide variant is altered by one or more nucleotides. A variant may result in “conservative” changes in which a substituted amino acid has similar structural or chemical properties, for example, replacing leucine with isoleucine. Less commonly, an option may result in “non-conservative” changes, such as replacing glycine with tryptophan. Similar minor changes may also include amino acid deletions or insertions, or both. Guidance on determining which amino acid residues can be replaced, inserted or removed without loss of biological or immunological activity can be found using computer programs well known in the art, such as LASERGENE (DNASTAR) software.

The present invention also encompasses variants that at least retain one biological activity (e.g., association with a cell, penetration into a cell, or lysis of a cell) or immunological activity of a polypeptide. A preferred embodiment is one having substantially the same or functionally equivalent sequence, for example at least 80%, and more preferably at least 90%, identical to the described sequence. The most preferred option is one whose sequence is at least 95%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99 , 8%, or at least 99.9% identical to the sequence described in the present invention. The percentage of identity is determined by aligning the two compared sequences, as described below, determining the number of identical residues in the aligned part, dividing this number by the total number of residues in the sequence of the invention (desired), and multiplying this result by 100. A suitable alignment program is AlignX (Vector NTI).

Description of the invention

Methane is formed in the front of the digestive tract of ruminants by methane producers, which act as the final carbon reducers in the rumen system. The multi-stage pathway for methane production is well illuminated, mainly from the study of methane producers of non-ruminant animals, but the adaptations that allow methane producers to grow and persist in the rumen are not entirely understood. Methanobrevibacter ruminantium is a well-known methanogen producer in New Zealand ruminants. As described herein, the genome size of M. ruminantium was sequenced and it was shown to be approximately 3.0 Mb, with a GC content of 33.68%. It was unexpectedly discovered that the M. ruminantium genome contains a prophage sequence (designated φmru) with various functional modules encoding phage integration, DNA replication and packaging, capsid proteins, lysis and lysogenic conversion functions.

The M. ruminantium phage was identified during high throughput sequencing when it was found that the 30-40 Kb genome region was highly represented in sequenced clones. This suggests that part of the genome was represented in a higher number of copies than normal, and replication of the resident phage could be attributed. The highly represented region was studied, and detailed bioinformational analyzes of the alleged open reading frames present indicated that it contained phage-like genes. It has been shown that a low GC region found at the distal end of the phage sequence (lysogenic conversion) contains a predicted sulfur modification DNA system (dnd) that can provide additional modification to the host DNA or foreign DNA. The prophage sequence of M. ruminantium is described in detail in this application. In various aspects of the present invention, prophage polynucleotides and polypeptides can be used as agents for inhibiting methane producers and / or methane formation in the rumen, and to further clarify the role of M. ruminantium in methane formation.

The present invention, therefore, relates to phage polypeptides, including those that contain at least one of the sequences of SEQ ID NO: 1-69, and their fragments, variants and derivatives. The present invention also relates to the use of these polypeptides for targeted delivery and inhibition of microbial cells, in particular methane producing cells. The present invention further relates to the use of polypeptides for inhibiting the growth or replication of such cells. The polypeptides of the present invention can be expressed and used in various assays to determine their biological activity. These polypeptides can be used for large-scale synthesis and isolation protocols, for example, for commercial production. Such polypeptides can be used to induce antibodies, to isolate appropriate antibody sequences, and to quantify the levels of amino acid sequences. The polypeptides of the present invention can also be used as compositions, for example pharmaceutical compositions, and as feed additives, for example, feed components for ruminants. The polypeptides of the present invention also benefit health. In health-related aspects, methane-producing inhibitors can be used to restore energy to an individual, which is usually lost as methane. In specific aspects, rumen slow release devices can be used in conjunction with the polypeptides and compositions (e.g., pharmaceutical compositions and feed additives) of the present invention.

The polypeptides of the present invention contain at least one sequence selected from the group consisting of: (a) polypeptides containing at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or fragments thereof, variants or derivatives; (b) polypeptides containing the functional domain of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, and fragments and variants thereof; and (c) polypeptides containing at least a specific amount of contiguous residues of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or variants or derivatives thereof. In one embodiment, the invention relates to an isolated polypeptide comprising an amino acid sequence of at least one of SEQ ID NO: 1-69. Together, these sequences are referred to herein as the polypeptides of the invention.

The present invention also relates to polynucleotides that encode at least one phage polypeptide, including SEQ ID NO: 1-69, and fragments, variants and derivatives thereof. The present invention also relates to the use of these polynucleotides for the preparation of expression vectors and host cells for targeted delivery and inhibition of microbial cells, in particular methanogen producing cells. The present invention further encompasses the use of these polynucleotides to inhibit the growth or replication of such cells. The isolated polynucleotides of the present invention are also applicable in genome mapping, physical mapping, and in the cloning of genes of more or less related phage. The probes obtained using the polynucleotides of the present invention can be used to detect the presence and study of gene expression profiles in any organism that has sufficiently homologous DNA and RNA sequences in their cells using techniques that are well known in the art, such as slot microchip blotting or analysis. Primers prepared using the polynucleotides of the present invention can be used for sequencing and PCR amplifications. The polynucleotides of the present invention can also be used as compositions, for example pharmaceutical compositions, and as feed additives, for example, ruminant feed components. Polynucleotides of the present invention also benefit health. For such use, polynucleotides can be presented as expression vectors or host cells containing expression vectors. In specific aspects, rumen slow release devices may be used in conjunction with polynucleotides, vectors, host cells, and compositions (e.g., pharmaceutical compositions and feed additives) of the present invention.

The polynucleotides of the present invention contain at least one sequence selected from the group consisting of: (a) sequences containing the coding sequence of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or fragments thereof or options; (b) complementary sequences, reverse sequences, and backward complementary to coding sequences of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or fragments or variants thereof; (c) open reading frames contained in the coding sequence of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, and fragments and variants thereof; (d) functional domains of the coding sequence of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, and fragments and variants thereof; and (e) sequences containing at least a specific amount of contiguous residues of a coding sequence of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69, or variants thereof. In one embodiment, the present invention encompasses an isolated polynucleotide comprising the coding sequence of at least one amino acid sequence selected from the group consisting of SEQ ID NO: 1-69.

The polynucleotides of the present invention contain at least one sequence selected from the group consisting of: (a) sequences containing at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 74-142, or fragments thereof, or options; (b) complementary sequences, reverse sequences, and reverse complementary sequences of a coding sequence of at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 74-142, or fragments or variants thereof; (c) open reading frames contained in a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 74-142, and fragments and variants thereof; (d) functional domains of the coding sequence of at least one nucleic acid sequence selected from the group consisting of SEQ ID NOS: 74-142, and fragments and variants thereof; and (e) sequences containing at least a specific amount of contiguous residues of at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 74-142, or variants thereof. Also presented are oligonucleotide probes and primers and their variants derived from any of the described sequences. All of these polynucleotides and oligonucleotides in the context of this application are collectively referred to as polynucleotides of the present invention.

It will be understood by those skilled in the art that as a result of the degeneracy of the genetic code, a plurality of nucleotide sequences encoding the polypeptides of the present invention can be obtained, to some extent carrying minimal homology with respect to the nucleotide sequences of any known and natural gene. Therefore, the present invention considers all, without exception, possible variants of the nucleotide sequence that could be obtained by selecting combinations based on possible choices of codons. These combinations are obtained in accordance with the standard triplet genetic code of bacteria, as applied to natural amino acid sequences, and all such variants are considered described separately.

The nucleotide sequences that encode phage polypeptides, or fragments or variants thereof, are preferably capable of hybridizing to the nucleotide sequence of a natural sequence under suitably selected stringency conditions. However, it may be preferable to obtain nucleotide sequences encoding a polypeptide or fragment or derivative thereof having a substantially different codon usage frequency. Codons can be selected to increase the rate at which expression of this polypeptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which specific codons are used by that host. For example, codons can be optimized for expression in E. coli in accordance with known methods. Other reasons for substantially altering the nucleotide sequence encoding the polypeptides and its derivatives without altering the encoded amino acid sequences include obtaining RNA transcripts having more desirable properties, such as a longer half-life, than transcripts derived from a natural sequence.

The present invention also encompasses the production of DNA sequences, or fragments thereof, that encode polypeptides, or fragments or variants thereof, exclusively by synthetic chemistry. Once obtained, the synthetic sequence can be integrated into any of the many available expression vectors and cell systems using reagents that are well known in the art. Moreover, synthetic chemistry can be used to introduce mutations into a sequence encoding a polypeptide, or any variants or fragments thereof. The invention also encompasses polynucleotide sequences that are capable of hybridizing with the claimed nucleotide sequences, and in particular those shown in SEQ ID NO: 74-149, or their complementary sequences, under various stringency conditions, as described by Wahl, GM and SL Berger (1987 ; Methods Enzymol. 152: 399-407) and Kimmel, AR (1987; Methods Enzymol. 152: 507-511).

DNA sequencing methods that are well known and generally available in the art can be used to practice any of the embodiments of the present invention. Enzymes such as Klenow DNA polymerase I fragment, SEQUENASE (US Biochemical Corp, Cleveland, OH), Taq polymerase (Perkin Elmer), thermostable T7 polymerase Amersham Pharmacia Biotech (Piscataway, NJ), or a combination of polymerases and correcting exonucleases can be used in the methods. such as those on the ELONGASE Amplification System sold by Life Technologies (Gaithersburg, MD). Preferably, this process is automated by devices such as Hamilton Micro Lab 2200 (Hamilton, Reno, NV), Peltier Thermal Cycler (PTC200; MJ Research, Watertown, MA) ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer), or Genome Sequencer 20 ^TM (Roche Diagnostics).

Nucleic acid sequences encoding these polypeptides can be extended using an incomplete nucleotide sequence and using various methods known in the art to detect upstream sequences, such as promoters and regulatory elements and downstream elements, such as terminators and non-coding RNA structures. For example, in one method that can be used, restriction site PCR, universal primers are used to search for an unknown sequence adjacent to a known locus (Sarkar, G. (1993) PCR Methods Applic. 2: 318-322). In particular, genomic DNA was first amplified in the presence of a primer to a linker sequence and a primer specific for a known site. The amplified sequences were then subjected to a second round of PCR with the same linker primer and another specific primer located inside the first. The products of each round of PCR are transcribed with a suitable RNA polymerase followed by reverse transcriptase.

Another suitable method is reverse PCR, also called IPCR (see, for example, Ochman H, Gerber AS, Hartl DL. Genetics. 1988 Nov; 120 (3): 621-3). Reverse PCR can be used in cases where only one internal sequence of the target DNA is known. The reverse PCR method involves a series of cleavages and self-ligations with DNA cut by a restriction endonuclease. This cutting leads to the fact that the known sequence is at both ends of the unknown sequences. In accordance with this method, the target DNA is easily cut into smaller fragments of several thousand bases by restriction enzyme digestion. Self-ligation is then induced at low concentrations, causing the rearrangement of the phosphate skeleton and the generation of ring DNA of the ligation product. The target DNA is then subjected to restriction digestion using known endonuclease. As a result, a cut occurs within a known internal sequence, generating a linear product with known terminal sequences. This product can then be used for standard PCR carried out with primers complementary to known internal sequences.

Capillary electrophoresis systems that are commercially available can be used to analyze the size or confirmation of the nucleotide sequence of sequencing or PCR products. In particular, in capillary sequencing, flowing polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are activated by a laser, and the determination of the emitted wavelengths using a charge-coupled camera can be used. The output / light intensity can be converted into an electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer) and the entire process from loading samples to computer analysis and electronic data display can be controlled by a computer. Capillary electrophoresis is particularly preferred for sequencing small parts of DNA, which may be in limited quantities in a particular sample.

Recently, pyrosequencing has emerged as an effective sequencing technique. See, for example, Ronaghi, M. et al. 1996. Real-time DNA sequencing using detection of pyrophosphate release. Anal. Biochem. 242: 84-89; Ronaghi, M. et al. 1998. A sequencing method based on real-time pyrophosphate. Science 281: 363-365; Ronaghi, M. et al. 1999. Analyses of secondary structures in DNA by pyrosequencing. Anal. Biochem. 267: 65-71; Ronaghi 2001. Genome Res. Vol. 11, Issue 1, 3-11; Nyrén The history of pyrosequencing. Methods Mol Biol. 2007; 373: 1-14. Pyrosequencing has advantages in accuracy, flexibility, parallel data processing, and can be easily automated. Moreover, this technique dispenses with the need for labeled primers, labeled nucleotides and gel electrophoresis. In accordance with this method, polymerase catalyzes the incorporation of nucleotides into the nucleic acid chain. As a result of this inclusion, pyrophosphate molecules are released and subsequently converted under the action of sulfurylase into ATP. Glow is formed in the luciferase reaction, during which the luciferin molecule is oxidized. After the addition of each nucleotide, a washing step is carried out to allow multiple additions. Nucleotides are continuously destroyed by the action of a nucleotide-degrading enzyme, allowing you to add a subsequent nucleotide. Pyrosequencing has been successfully used as a platform for large-scale sequencing, including genomic and metagenomic analysis (see, for example, The Genome Sequencer FLX ™ from 454 Life Sciences / Roche).

The SOLiD ^™ System has also been developed for sequencing (see, for example, Applied Biosystems. Application Fact Sheet for the SOLiD ™ System. Foster City, CA). This technique is based on the sequential ligation of dye-labeled oligonucleotides with clonal amplified DNA fragments connected to magnetic beads. In this method, the DNA sequence is obtained by measuring serial ligation. The ligation reaction is based on the recognition of the probe, not sequential addition, and, therefore, less prone to error accumulation. The nature of chemism virtually eliminates the possibility of random insertions or deletions. The ligation step and the phosphatase treatment of non-ligated probes prevents phase shift. Additionally, after seven ligation cycles, the original primer is removed from the matrix and the new primer hybridizes at position n-1. Using this “restart” phase reduces system noise and allows you to read longer sequences. In addition, dibasic coding is used to distinguish between measurement errors in contrast to true polymorphisms. Changes in one position are identified as random errors and can be removed using software when analyzing data. As an analytical platform, the SOLiD ^TM System is used in large-scale sequencing, digital gene expression, ChIP and methylation studies, and is especially useful for identifying genomic variants.

In another embodiment of the present invention, polynucleotides or fragments thereof that encode polypeptides can be used in recombinant DNA molecules to direct expression of the polypeptides or fragments or variants thereof in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences can be obtained that encode essentially the same or functionally equivalent amino acid sequence, and these sequences can be used for cloning and expression of phage polypeptides. The nucleotide sequences of the present invention can be constructed using methods generally known in the art for changing amino acid coding sequences for a variety of reasons, including but not limited to modifications that modify the cloning, processing and / or expression of gene product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to construct nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, change glycosylation profiles, change codon preferences, introduce mutations, and so on.

In another embodiment of the present invention, natural, modified, or recombinant nucleic acid sequences encoding polypeptides can be ligated to a heterologous sequence to encode a fusion protein. For example, it may be appropriate to encode a chimeric sequence that can be recognized by a commercially available antibody. A fusion protein can also be designed to contain a cleavage site between the polypeptide of the invention and the heterologous protein sequence, so that the polypeptide can be cleaved and purified from the heterologous portion.

In another embodiment, the sequences encoding the polypeptides can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers, MH et al. (1980) Nucl. Acids Res. Symp. Ser. 215 223, Horn, T. et al. (1980) Nucl. Acids Res. Symp. Ser. 225-232). Alternatively, the polypeptide itself can be obtained using chemical methods to synthesize an amino acid sequence or fragment thereof. For example, polypeptide synthesis can be carried out using various solid phase methods (Roberge, JY et al. (1995) Science 269: 202-204; Merrifield J. (1963) J. Am. Chem. Soc. 85: 2149-2154) and automated synthesis can be achieved, for example, using the peptide synthesizer “ABI 431A Peptide Synthesizer” (Perkin Elmer). Various fragments of the polypeptides can be chemically synthesized separately and combined using chemical methods to obtain a full-sized molecule.

The newly synthesized polypeptide can be isolated using preparative high performance liquid chromatography (e.g. Creighton, T. (1983) Proteins Structures and Molecular Principles, WH Freeman and Co., New York, NY). The composition of synthetic polypeptides can be confirmed by amino acid analysis or sequencing (for example, using the Edman cleavage technique; Creighton, supra). Additionally, the amino acid sequence of the polypeptide, or any part thereof, can be changed during direct synthesis and / or combined using chemical methods with sequences from other proteins, or any parts thereof, to obtain a variant of the molecule.

For the expression of biologically active polypeptides, nucleotide sequences encoding a polypeptide or functional equivalents can be inserted into the corresponding expression vector, i.e. a vector that contains the necessary elements for transcription and translation of the built-in coding sequence. Methods that are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding this polypeptide and the corresponding transcriptional and translational control elements. These methods include in vitro recombinant DNA technologies, synthetic methods, and in vivo genetic recombination. Such technologies are described by Sambrook, J. et al. (2001) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, and Ausubel, FM et al. (2007) Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY.

A variety of expression vectors / host systems can be used to contain and express sequences encoding the polypeptides of the invention. They include, but are not limited to microorganisms, such as bacteria transformed with a recombinant bacteriophage, a plasmid or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; cellular systems of insects infected with viral expression vectors (e.g., baculovirus); plant cell systems transformed with viral expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or bacterial expression vectors (e.g. Ti or pBR322 plasmids); or animal cell systems. For bacteria, suitable plasmids include pET, pRSET, pTrcHis2, and pBAD plasmids from Invitrogen, pET and pCDF plasmids from Novagen, and Director ^TM plasmids from Sigma-Aldrich. For methane producers, suitable plasmids include, but are not limited to, pME2001, pMV15, and pMP1. In particular, Escherichia coli can be used with the pET expression vector. The present invention is not limited to the expression vector used or the host cell.

“Control elements” or “regulatory sequences” are untranslated regions of enhancer vectors, 5 ′ and 3 ′ promoters of untranslated regions that interact with host cell proteins to transcribe and translate. Such elements may vary in strength and specificity. Depending on the vector system and host used, any number of suitable transcriptional and translational elements, including constitutive and inducible promoters, can be used. For example, when cloning into bacterial systems, inducible promoters, such as the hybrid lacZ promoter BLUESCRIPT phagemids (Stratagene, LaJolla, CA) or pSPORT1 plasmids (Life Technologies) and the like, can be used. The polyhedrin promoter of baculovirus can be used in insect cells. Promoters or enhancers derived from plant cell genomes (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into this vector.

In bacterial systems, the number of expression vectors can be selected depending on the use of this polypeptide. For example, in cases where large quantities of the polypeptide are needed, vectors that direct a high level of expression of fusion proteins that are easy to clean can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors, such as BLUESCRIPT (Stratagene), in which the sequence encoding the polypeptide can be ligated into a vector in a frame with sequences for amino-terminal Met and subsequent 7 residues of β-galactosidase so that a fusion protein is formed; pIN vectors (Van Heeke, G. and SM Schuster (1989) J. Biol. Chem. 264: 5503-5509); and the like.

pGEX vectors (Promega, Madison, WI) can also be used to express polypeptides as fusion proteins with glutathione S-transferase (GST). Basically, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption on glutathione-agarose beads, followed by elution in the presence of free glutathione. Proteins obtained in such systems can be created containing heparin, thrombin or factor Xa cleavage sites with a protease, so that the cloned polypeptide of interest can be freed from the GST portion as desired. In yeast, Saccharomyces cerevisiae , a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For a review, see Ausubel et al. (supra) and Grant et al. (1987) Methods Enzymol. 153: 516-544.

Specific initiation signals can also be used to achieve more efficient translation of sequences encoding the polypeptides of the invention. Such signals include the ATG start codon and adjacent sequences. In cases where the sequences encoding the polypeptides, their start codon and overlying sequences are inserted into the corresponding expression vector, additional transcriptional or translational control signals may not be necessary. However, in cases where only the coding sequence, or a fragment thereof, is inserted, exogenous translational control signals, including the ATG start codon, must be provided. Moreover, the start codon must be in the correct reading frame to ensure translation of the entire insert. Exogenous translation elements and starting codons can be of various origins, both natural and synthetic. Expression efficiency can be increased by including enhancers that are appropriate for the particular cell system used, such as those described in the literature (Scharf, D. et al. (1994) Results Probl. Cell Differ. 20: 125-162).

In addition, the strain of the host cell can be selected by its ability to modulate the expression of the inserted sequences or process the expressed polypeptide in the desired manner. Such sequence modifications include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation. Post-translational processing, which cleaves the “prepro” form of the polypeptide, can also be used to facilitate proper incorporation, the formation of a folded structure and / or function. Various host cells that have a specific cellular mechanism and characteristic mechanisms of post-translational activities are available from the American Type Culture Collection (ATCC; Bethesda, MD) and can be selected to ensure the correct modification and processing of the sequence. Specific host cells include, but are not limited to, methanogen producing cells, such as Methanobrevibacter cells, in particular M. ruminantium , or M. smithii cells. Host cells of interest include, for example, Rhodotorula , Aureobasidium , Saccharomyces , Sporobolomyces , Pseudomonas , Erwinia and Flavobacterium ; or other organisms such as Escherichia , Lactobacillus , Bacillus , Streptomyces , and the like. Particular host cells include Escherichia coli , which is particularly suitable for use in the present invention, Saccharomyces cerevisiae , Bacillus thuringiensis , Bacillus subtilis , Streptomyces lividans , and the like.

There are several techniques for introducing nucleic acids into eukaryotic cells cultured in vitro . These techniques include chemical methods (Felgner et al., Proc. Natl. Acad. Sci., USA, 84: 7413 7417 (1987); Bothwell et al., Methods for Cloning and Analysis of Eukaryotic Genes, Eds., Jones and Bartlett Publishers Inc., Boston, Mass. (1990), Ausubel et al., Short Protocols in Molecular Biology, John Wiley and Sons, New York, NY (1992); and Farhood, Annal. NY Acad. Sci., 716: 23 34 (1994)), the use of protoplasts (Bothwell, supra) or electrical impulses (Vatteroni et al., Mutn. Res., 291: 163 169 (1993); Sabelnikov, Prog. Biophys. Mol. Biol., 62: 119 152 (1994); Bothwell et al., Supra; and Ausubel et al., Supra), the use of attenuated viruses (Davis et al., J. Virol. 1996, 70 (6), 3781 3787; Brinster et al. J. Gen Virol. 2002, 83 (Pt 2), 369 381; Moss, Dev. Biol. Stan., 82:55 63 (1994); and Bothwell et al., Supra), as well as physical methods (F ynan et al., supra; Johnston et al., Meth. Cell Biol., 43 (Pt A): 353 365 (1994); Bothwell et al., supra; and Ausubel et al., supra).

Successful delivery of nucleic acids to animal tissue can be achieved using cationic liposomes (Watanabe et al., Mol. Reprod. Dev., 38: 268 274 (1994)), by direct injection of naked DNA or RNA into the muscle tissue of the animal (Robinson et al., Vacc., 11: 957 960 (1993); Hoffman et al., Vacc. 12: 1529 1533; (1994); Xiang et al., Virol., 199: 132 140 (1994); Webster et al. , Vacc., 12: 1495 1498 (1994); Davis et al., Vacc., 12: 1503 1509 (1994); Davis et al., Hum. Molec. Gen., 2: 1847 1851 (1993); Dalemans et al. Ann NY Acad. Sci. 1995, 772, 255 256. Conry, et al. Cancer Res. 1995, 55 (7), 1397-1400), and embryos (Naito et al., Mol. Reprod. Dev., 39: 153 161 (1994); and Burdon et al., Mol. Reprod. Dev., 33: 436 442 (1992)), by intramuscular injection of self-replicating RNA vaccines (Davis et al., J Virol 199 6, 70 (6), 3781 3787; Balasuriya et al. Vaccine 2002, 20 (11 12), 1609 1617) or by intracutaneous injection of DNA using the gene gun technology (Johnston et al., Supra).

A number of protocols for determining and measuring the expression of the polypeptides of the invention using either polyclonal or monoclonal antibodies specific for this protein are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence-activated cell sorting (FACS). An immunological analysis based on monoclonal antibodies with two sites can be used with monoclonal antibodies reactive against two non-interfering epitopes of the polypeptide, but competition binding assays can also be used. These and other assays are described, inter alia, by Hampton, R. et al. (1990; Serological Methods, a laboratory Manual, APS Press, St Paul, MN) and Maddox, D. E. et al. (1983; J. Exp. Med. 158: 1211-1216).

A number of labels and conjugation methods are known to those skilled in the art and can be used in various nucleic acid and amino acid analyzes. Methods for producing labeled hybridization or PCR probes for detecting sequences associated with polynucleotides include oligolabeling, nick translation, end tagging, or PCR amplification using labeled nucleotide. Alternatively, sequences encoding the polypeptides, or any fragments or variants thereof, can be cloned into a vector to obtain a probe mRNA. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by adding the appropriate RNA polymerase, such as T7, T3 or SP6 and labeled nucleotides. These techniques can be carried out using a variety of commercially available kits from Amersham Pharmacia Biotech, Promega, and US Biochemical. Suitable reporter molecules or labels that can be used to facilitate detection include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents such as substrates, cofactors, inhibitors, magnetic particles, and the like.

Expression vectors or host cells transformed with expression vectors can be replicated under conditions suitable for expression and extraction of the polypeptide from the culture. This culture may contain components for in vitro or in vivo expression. Components in vitro expression include components for rabbit reticulocyte lysate, lysates of E. coli, and wheat germ extracts, e.g. Expressway ™ system or RiPs from Invitrogen, Genelator ^TM system from iNtRON Biotechnology, EcoPro ™ or STP3 ™ system from Novagen, TNT® Quick system Coupled by Promega, and EasyXpress by QIAGEN. Polypeptides derived from culture may be secreted or intracellularly contained depending on the sequence and / or vector used. In specific aspects, expression vectors that encode a phage polypeptide can be designed to contain signal sequences that directly secrete this polypeptide through a prokaryotic or eukaryotic cell membrane.

Other constructs may include an amino acid domain that will facilitate the purification of the polypeptide. Such domains include, but are not limited to, metal chelating peptides, such as histidine-triprofan modules (e.g. 6X-HIS (SEQ ID NO: 150)), which allow purification on immobilized metals, protein A domains, which allow purification on immobilized immunoglobulin; and the domain used in the FLAG® extension / affinity purification system (Immunex Corp., Seattle, WA). Suitable epitope labels include 3XFLAG®, HA, VSV-G, V5, HSV, GST, GFP, MBP, GAL4, and β-galactosidase. Suitable plasmids include plasmids containing a biotin tag (e.g., PinPoint ™ plasmids from Promega), calmodulin binding protein (e.g. pCAL plasmids from Stratagene), streptavidin binding protein (e.g. InterPlay ™ plasmids from Stratagene), c-myc or FLAG® tag (e.g., Sigma-Aldrich immunoprecipitation plasmids), or a histidine tag (e.g., QIAExpress plasmid from QIAGEN).

To facilitate purification, the expression vectors may contain a cleavable linker sequence, for example, specific for factor Xa or enterokinase (Invitrogen, San Diego, CA). For example, this vector may include one or more linkers between the purification domain and the polypeptide. One such expression vector provides expression of a fusion protein containing a polypeptide of the present invention and a nucleic acid encoding 6 histidine residues upstream of a thioredoxin or enterokinase cleavage site. Histidine residues facilitate IMAC purification (affinity chromatography with immobilized metal ion described by Porath, J. et al. (1992) Prot. Exp. Purif. 3: 263-281), while the enterokinase cleavage site provides a means for purifying the fusion polypeptide squirrel. A review of vectors that contain fusion proteins is presented by Kroll, D. J. et al. (1993; DNA Cell Biol. 12: 441-453).

Antibodies of the present invention can be obtained using methods generally known in the art, for example, for use in purification or diagnostic methods. In particular, polypeptides or polynucleotides can be used to produce antibodies in accordance with well-known protocols. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric and single chain antibodies, Fab fragments and fragments obtained using the Fab expression library. Neutralizing antibodies (i.e., antibodies that inhibit function) are particularly preferred for use in the present invention.

For the production of antibodies, various hosts, including goats, rabbits, rats, mice, humans, and others, can be immunized by administering a polypeptide, polynucleotide, or any fragment thereof that has immunogenic properties. Depending on the type of host, various adjuvants may be used to enhance the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels, such as aluminum hydroxide, and surfactants, such as lysolecithin, polyols, pluronyl polyols, polyanions, peptides, oil emulsions, cochlear lymphocytes hemocyanin and dinitrophenol. Among the adjuvants used in humans, BCG (Calmett-Guerin bacilli) and Corynebacterium parvum are particularly preferred.

Preferably, the polypeptides or fragments used for the induction of antibodies have an amino acid sequence containing at least five amino acids, and more preferably at least 10 amino acids. It is also preferred that they are identical to part of the amino acid sequence of a natural protein, and that they can contain the entire amino acid sequence of a small natural molecule. Short stretches of amino acids can be fused with those of another protein, such as snail lymph hemocyanin, and an antibody obtained against this chimeric molecule.

Monoclonal antibodies can be obtained using any technique that provides for the production of antibody molecules using a stable cell line in culture. These techniques include, but are not limited to, hybridoma technology, human B cell hybridoma technology, and EBV hybridoma technology (Kohler, G. et al. (1975) Nature 256: 495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81: 31-42; Cote, RJ et al. (1983) Proc. Natl. Acad. Sci. 80: 2026-2030; Cole, SP et al. (1984) Mol. Cell Biol. 62: 109-120). Antibodies can also be obtained by inducing in vivo production in a lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents, as described in the literature (Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. 86: 3833 -3837; Winter, G. et al. (1991) Nature 349: 293-299).

In addition, techniques can be used to purify “chimeric antibodies,” for example, combining antibody genes to produce molecules with appropriate antigenic specificity and biological activity (Morrison, SL et al. (1984) Proc. Natl. Acad. Sci. 81: 6851- 6855; Neuberger, MS et al. (1984) Nature 312: 604-608; Takeda, S. et al. (1985) Nature 314: 452-454). Alternatively, the techniques described for preparing single chain antibodies can be adapted using methods known in the art to produce specific single chain antibodies. Antibodies with related specificity, but of a different idiotype composition, can be obtained by chain shuffling from random combinatorial libraries of immunoglobulins (Burton D. R. (1991) Proc. Natl. Acad. Sci. 88: 11120-3).

Specialists in this field to which the present invention relates, the terms "diatel" and "triatel" will be understood. They are molecules that contain a heavy chain variable domain (VH) coupled to a light chain variable domain (VL) by a short peptide linker that is too short to allow pairing between two domains on the same chain. This promotes pairing with the complementary domains of one or more other chains, and stimulates the formation of dimeric or trimeric molecules with two or more functional antigen-binding sites. The resulting antibody molecules can be monospecific or multispecific (for example, bispecific in the case of diabodies). Such antibody molecules can be obtained from two or more antibodies using a methodology standard in the field to which the present invention relates; for example, as described by Todorovska et al. (Design and application of diabodies, triabodies and tetrabodies for cancer targeting. J. Immunol. Methods. 2001 Feb 1; 248 (1-2): 47-66).

Antibody fragments that contain specific binding sites can also be obtained. For example, such fragments include, but are not limited to, F (ab ') ₂ fragments that can be obtained by pepsin cleavage of the antibody molecule, and Fab fragments that can be obtained by restoring the disulfide bridges of F (ab') ₂ fragments. Alternatively, Fab expression libraries can be designed to be able to quickly and easily identify monoclonal Fab fragments with the desired specificity (Huse, WD et al. (1989) Science 254: 1275-1281).

Various immunoassays can be used for screening to identify antibodies with binding specificity. Numerous protocols for competitive binding or quantitative radioimmunoassays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically include measuring the formation of a complex between a polypeptide or polynucleotide and an antibody specific for it. Immunological analysis based on monoclonal antibodies with two sites using monoclonal antibodies reactive against two non-interfering epitopes is preferred, but a competitive binding assay (Maddox, supra) can also be used.

The phage polypeptides described in the present invention are capable of targeted delivery, penetration and / or inhibition of cells, and are also suitable as carrier molecules for the delivery of additional inhibitory molecules to microbial cells. The chemical reactions for combining amino acids and compounds are well developed and a number of different types of molecules can be combined with polypeptides. The most common connection methods are based on the presence of free amino (alpha-amino or Lys), sulfhydryl (Cys), or carboxyl groups (Asp, Glu, or alpha-carboxyl). Connection methods can be used to connect a polypeptide to a cellular inhibitor via a carboxy or amino terminal residue. In some cases, the sequence includes numerous residues that may interact with the selected chemistry. This can be used to obtain multimers containing more than one cellular inhibitor. Alternatively, the polypeptide may be shortened or selected so that reactive residues are located either at the amino or carboxyl end of the sequence.

For example, a reporter molecule, such as fluorescein, can be specifically included in the lysine residue (Ono et al., 1997) using N - α -Fmoc- Nε -1- (4,4-dimethyl-2,6 dioxocyclohex-1- ylidene-3-methylbutyl) -L-lysine during polypeptide synthesis. After synthesis, 5- and 6-carboxyfluoresceinsuccinimidyl esters can be combined, after which 4,4-dimethyl-2,6 dioxocyclohex-1-ylidene is removed by treatment with hydrazine. Therefore, the coupling of an inhibitory molecule with a phage polypeptide can be accomplished by incorporating a lysine residue in the polypeptide sequence, then by reaction with a suitable derivative cell inhibitor.

An EDC (1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride) or carbodiimide compound method can also be used. Carbodiimides can activate the carboxyl groups of the side chain of aspartic and glutamic acid, as well as the carboxy-terminal group, to make them reactive sites for connection with primary amines. The activated polypeptides are mixed with a cellular inhibitor to obtain the final conjugate. If the cell inhibitor is activated first, the EDC method will connect the cell inhibitor via the N-terminal alpha-amine and, possibly, through the amine in the Lys side chain, if present in the sequence.

M-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) is a heterobifunctional reagent that can be used to couple polypeptides to cell inhibitors via cysteines. The connection occurs with the thiol group of cysteine residues. If the selected sequence does not contain Cys, it is common to place the Cys residue at the N- or C-terminus to produce a highly controlled polypeptide compound with a cell inhibitor. For synthesis purposes for cysteine, it may be appropriate to position the polypeptide at the N-terminus. MBS is particularly suitable for use in the present invention.

Glutaraldehyde can be used as a bifunctional binding reagent that connects two compounds through their amino groups. Glutaraldehyde provides a highly flexible spacer between the polypeptide and the cell inhibitor for a suitable presentation. Glutaraldehyde is a very reactive compound and will interact with Cys, Tyr, and His to a limited extent. The glutaraldehyde crosslinking method is particularly suitable when the polypeptide contains only one free amino group at its amino terminus. In cases where the polypeptide contains more than one free amino group, large multimeric complexes can be formed.

In one aspect, the polypeptides of the present invention can be fused (for example, by cloning within the frame) or crosslinked (for example, by chemical bonding) with cellular inhibitors, such as antimicrobial agents. Among these agents are antimicrobial peptides, for example a bactericidal / penetration enhancing protein, cationic antimicrobial proteins, lysozymes, lactoferrins and cathelicidins (for example, from neutrophils; see, for example, Hancock and Chapple, 1999, Antimicrob. Agents Chemother. 43: 1317-1323. ; Ganz and Lehrer, 1997, Curr. Opin. Hematol. 4: 53-58; Hancock et al., 1995, Adv. Microb. Physiol. 37: 135-175). Antimicrobial peptides further include defensins (for example, from epithelial cells or neutrophils) and platelet microbiocidal proteins (see, for example, Hancock and Chapple, 1999, Antimicrob. Agents Chemother. 43: 1317-1323). Additional antimicrobial peptides include, but are not limited to, gramicidin S, bacitracin, polymyxin B, tachyplezin, bactenecin (e.g., cattle bactenecin), ranalexin, cecropin A, indolicidin (e.g., cattle indolicidin), and nisin (e.g., bacterial lowlands).

Ionophores are also included as antimicrobials, which facilitate the transfer of an ion (e.g., sodium) through a lipid barrier, such as a cell membrane. Two ionophore compounds particularly suitable for the present invention are RUMENSIN ^™ (Eli Lilly) and Lasalocid (Hoffman LaRoche). Other ionophores include, but are not limited to, salinomycin, avoparcin, aridcin, and actaplanin. Other antimicrobial agents include penicillin, Monensin ™ and azithromycin, metronidazole, streptomycin, kanamycin and penicillin, as well as, in general, ß-lactams, aminoglycosides, macrolides, chloramphenicol, novobiocin, rifampin and fluoroquinolones (see e.g. 2003, Applied Environ. Microbiol. 69: 74-83; Eckburg et al., 2003, Infection Immunity 71: 591-596; Gijzen et al., 1991, Applied Environ. Microbiol. 57: 1630-1634; Bonelo et al. 1984, FEMS Microbiol. Lett. 21: 341-345; Huser et al., 1982, Arch. Microbiol. 132: 1-9; Hilpert et al., 1981, Zentbl. Bakteriol. Mikrobiol. Hyg. 1 Abt Orig . C 2: 21-31).

Particularly effective inhibitors are compounds that block or inhibit the formation of methane, including bromoethanesulfonic acid, for example 2-bromoethanesulfonic acid (BES), or their salts, for example sodium salt. Sodium molybdate (Mo) is an inhibitor of sulfate reduction, and can be used with bromoethanesulfonic acid. Other anti-methane compounds include, but are not limited to, nitrate, formate, methyl fluoride, chloroform, chloral hydrate, sodium sulfate, ethylene and unsaturated hydrocarbons, acetylene, fatty acids such as linoleic and cis-oleic acid, saturated fatty acids such as behenic and stearic acid, as well as lumazine (for example, 2,4-pteridinedione). Additional compounds include 3-bromopropanesulfonate (BPS), propionic acid, and ethyl 2-butinoate.

Additionally included as antimicrobial agents are lytic enzymes, including phage lysozyme, endolysin, lysozyme, lysine, phage lysine, muralizin, muramidase, and virolisin. Suitable enzymes demonstrate the ability to hydrolyze specific bonds in the bacterial cell wall. Specific lytic enzymes include, but are not limited to, glucosaminidases, which hydrolyze glycosidic bonds between amino sugars (e.g., N-acetylmuramic acid and N-acetylglucosamine) of peptidoglycan, amidases that cleave the N-acetylmuramoyl-L-alaninamide cross-linking glycane chain a peptide, and endopeptidases that hydrolyze the interpeptide bond (for example, cysteine endopeptidases), and endo isopeptidases that act on the pseudo-murein of methanogen producers of the Methanobacteriacaea family.

The polypeptides encoded by ORF 2058 or ORF 2055, described in detail herein and below, are useful as lytic enzymes specific for rumen methane producers. Natural enzymes can be obtained from fresh φmru-lysed M. ruminantium cells. Alternatively, ORF 2058 or ORF 2055 can be cloned into an expression vector in a heterologous host, such as Escherichia coli . This was done previously with PeiP and PeiW, and it was shown that the recombinant proteins are active against the cell walls Methanothermobacter under reducing conditions (Luo et al., 2002). ORF 2058 or ORF 2055 lytic enzymes or any other lytic enzymes can be used in compositions, for example, as a feed additive for ruminants, or can be included in a slow release capsule or bolus device for delivery over an extended period of time in the rumen. Lithium enzymes can be used either in combination or sequentially with other methane production inhibitor (s) to avoid adaptation of the host methane producers and resistance to the enzymes. Random and / or directed mutations in enzymes can also be used to avoid adaptation. The lytic / lysogenic switching components (e.g. ORF 1981 and ORF 1983-ORF 1986) can be used in the same way as lytic enzymes.

Additionally, PNA are included as antimicrobial agents. PNAs are hybrid peptide nucleic acids in which the phosphate backbone has been replaced by an achiral and neutral backbone formed from N- (2-aminoethyl) glycine units (see, for example, Eurekah Bioscience Collection. PNA and Oligonucleotide Inhibitors of Human Telomerase. G Gavory and S. Balasubramanian, Landes Bioscience, 2003). Bases A, G, T, C are attached to the amino nitrogen of the skeleton via methylene carbonyl bonds (P.E. Nielsen et al., Science 1991. 254: 1497-1500; M. Egholm et al., Nature 1993. 365: 566-568). PNAs bind complementary sequences with high specificity and higher affinity for similar DNA or RNA (M. Egholm et al., Supra). PNA / DNA or PNA / RNA hybrids also exhibit higher thermal stability than the corresponding DNA / DNA or DNA / RNA duplexes (M. Egholm et al., Supra). PNA also have high chemical and biological stability due to the unnatural amide skeleton, which is not recognized by nucleases or proteases (V. Demidov et al., Biochem Pharmacol 1994. 48: 1310-1313). Typically, PNAs are at least 5 bases in length, and include terminal lysine. PNAs can be pegylated to further increase their lifespan (Nielsen, P. E. et al. (1993) Anticancer Drug Des. 8: 53-63).

In one particular aspect, the polypeptides of the invention can be fused (e.g., by cloning within the frame) or crosslinked (e.g., by chemical coupling) with cellular inhibitors, such as antibodies or fragments thereof. Antibodies or antibody fragments can be directed to microbial cells, or specifically methanogen producing cells, or one or more cell components. For example, cell surface proteins, such as extracellular receptors, may be targeted. Included are immunoglobulin molecules and immunologically active parts of immunoglobulin (Ig) molecules, i.e. molecules that contain an antigen-binding site that specifically binds (immunologically interacts) with the antigen.

The polypeptides of the invention find practical use in targeted delivery to a microbial cell, in particular a methanogen producer cell. In some aspects, the polypeptides can be used to connect or bind to a cell wall or membrane, penetrate the cell and / or inhibit cell growth or replication. As such, the polypeptides can be used for transient or prolonged attachment to the cell, or for penetration of the cell wall or membrane and / or accumulation in the extracellular environment. It is understood that phage polypeptides, as well as corresponding polynucleotides, expression vectors, host cells, and antibodies of the invention can be used to target various microorganisms, for example Methanobrevibacter ruminantium , which is the main methane producer in ruminants, and Methanobrevibacter smithii , which is the main methane producer in people. For targeted action, the microbial cell can be brought into contact with a phage polypeptide isolated from one or more natural sources, or obtained using expression vectors and / or host cells, or synthetic or semi-synthetic chemistry, as described in detail in this application. To enhance penetration, the polypeptide may be fused or linked to one or more signal sequences (predicted consensus sequence: [ML] KKKK [K] {0,1} X {0.9} [IL] [IFL] [IL] [IL] [IS] [LIA] X {0.4} [LIVF] [LIAV] [LI] [ILV] [LAIV] [ILFV] [LIVF] [SAL] [ILV] [GSA] [AS] [VAI] [SA ] A (SEQ ID NO: 151), see FIGURE 6. See also Pérez-Bercoff, Å., Koch, J. and Bürglin, TR (2006) LogoBar: bar graph visualization of protein logos with gaps. Bioinformatics 22, 112 -114. In specific aspects, the polypeptide is delivered to individuals in the form of the composition described in detail in this application, for example, by using a device for slow release ruminant animals.

In some embodiments, the polypeptide is fused or crosslinked with a cellular inhibitor, for example, an anti-methane compound (e.g., bromoethanesulfonic acid), an antibody or antibody fragment, a lytic enzyme, a peptide nucleic acid, an antimicrobial peptide, or other antibiotic. This inhibitor polypeptide is delivered to the individual in the form of a composition for inhibiting the growth and / or replication of microbial cells, in particular methane producing cells. This composition contains, for example: a) an isolated phage, phage particle, phage genome or a change thereof, fragment, variant or derivative; b) an isolated phage polypeptide, or a change, fragment, variant or derivative thereof; c) an isolated polynucleotide, or a change, fragment, variant or derivative thereof; d) an expression vector containing this polynucleotide; or e) a host cell containing this expression vector. The compositions of the invention may be specially packaged as part of kits for the targeted delivery, penetration and / or inhibition of microbial cells, especially methanogen producing cells, in accordance with the described methods. These kits contain at least one composition provided herein and instructions for use for targeted delivery or penetration into cells or inhibition of cell growth or replication of methane producers or other microorganisms.

As an additional embodiment, the invention relates to a pharmaceutical composition in combination with a pharmaceutically acceptable carrier for use with any of the methods described above. Such pharmaceutical compositions may contain a phage polypeptide in combination with a cellular inhibitor. Alternatively, the pharmaceutical compositions may contain an expression vector or a host cell, described in detail in this application. The compositions may be administered alone or in combination with at least one other agent, such as a stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, physiological saline, buffered saline, dextrose, or water. Compositions can be administered to an individual alone or in combination with other agents, drugs (eg, antimicrobials), or hormones.

In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers containing excipients and excipients that facilitate the processing of the active compounds into preparations that can be used pharmaceutically. Further details on the production and administration technology can be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, PA). The pharmaceutical compositions used in the present invention can be administered by any means, including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, percutaneous, subcutaneous, intraperitoneal, intranasal, enteric, local, sublingual or .

Pharmaceutical compositions for oral administration can be prepared using pharmaceutically acceptable carriers well known in the art at dosages suitable for oral administration. Such carriers provide pharmaceutical compositions in the form of tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, and the like for oral administration. Pharmaceutical preparations for oral administration can be obtained by combining the active compounds with a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, followed by the addition of suitable excipients, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein excipients, such as sugars, including lactose, sucrose, mannitol or sorbitol; starch from corn, wheat, rice, potatoes, or other plants; cellulose, for example methyl cellulose, hydroxypropyl methyl cellulose or sodium carboxymethyl cellulose; gums, including Arabian and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrants or solubilizers, such as crosslinked polyvinylpyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate can be added.

Pharmaceutical formulations that can be used orally include easy-to-swallow capsules made from gelatin, as well as soft, sealed capsules made from gelatin, and a coating such as glycerol or sorbitol. Easy-to-swallow capsules may contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid or liquid polyethylene glycol with or without stabilizers. Dragee cores may be used in combination with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol and / or titanium dioxide, glaze solutions and suitable organic solvents or solvent mixtures. Dyes or pigments may be added to the tablets or dragee coatings to identify the product or to characterize the amount of active substance, i.e. doses.

Pharmaceutical compositions suitable for parenteral administration can be prepared in aqueous solutions, preferably in physiologically compatible buffers, such as Hanks's solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or carriers include fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers can also be used for delivery. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to enable the preparation of high concentration solutions. For topical or nasal administration, penetrants corresponding to the particular barrier to be penetrated are used in the compositions. Such penetrants are generally known in the art.

The pharmaceutical compositions of the present invention can be obtained by a method known in the art, for example by conventional mixing, dissolving, granulating, making dragees, eluting, emulsifying, encapsulating, incorporating, or lyophilizing processes. The pharmaceutical composition can be presented in the form of salt and can be formed with many acids, including, but not limited to, hydrochloric, sulfuric, acetic, dairy, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protic solvents than the corresponding free base forms. In other cases, the preferred preparation may be lyophilized powder, which may contain any or all of the following: 1-50 mM histidine, 0.1% -2% sucrose and 2-7% mannitol, at a pH in the range from 4.5 to 5 5 combined with buffer prior to use. After receiving the pharmaceutical compositions, they can be placed in an appropriate container and labeled for the treatment of this condition. For use of the composition of the invention, such a label would contain an amount, frequency and route of administration.

Pharmaceutical compositions suitable for use in the present invention include compositions in which the active ingredients are contained in an effective amount to achieve the intended purpose. For any compound, a therapeutically effective dose can be determined first either in cell studies, for example in microbial cells, or in particular in methane producer cells, or in animal models, usually mice, rabbits, dogs or pigs, or in ruminant animals such as sheep, cattle, deer and goats. An animal model can also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine appropriate doses and routes of administration to the individual. Normal dose amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g or more, depending on the route of administration. Guidance on specific dosages and delivery methods is provided in the literature and is generally available to practitioners in the art. Specialists in this field will use other compositions for polynucleotides than for polypeptides. Similarly, the delivery of polynucleotides or polypeptides will be individual for specific cells, conditions, locations, etc.

Phage-based drugs are known, and methods for preparing such compositions are published in the art. Phage drugs have been described, for example, for targeted delivery to Staphylococcus (e.g. S. aureus ), Pseudomonas (e.g. P. aeruginosa ), Escherichia (e.g. E. coli ), Klebsiella (e.g. K. ozaenae , K. rhinoscleromatis scleromatis and K. pneumonia ), Proteus , Salmonella , Shigella (see, for example, Carlton, RM (1999). Archivum Immunologiae et Therapiae Experimentalis, 47: 267-274; Liu, J. et al. (2004). Nat. Biotechnol 22, 185-191; Projan, S. (2004). Nat. Biotechnol. 22, 167-168; Sulakvelidze, A., Alavidze, Z. and Morris, JG (2001). Antimicrobial Agents and Chemotherapy, 45 (3 ): 649-659; Weber-Dabrowska, Mulczyk, M. and Gorski, A. (2000). Archivum Immunologiae et Therapiae Experimentalis, 48: 547-551). Phage drugs have their inherent advantages over traditional antimicrobials in that the phage is highly specific and does not affect the normal microflora of the human body; the phage does not infect eukaryotic cells, and has no known serious side effects; the phage can be localized at the site of infection; and the phage can replicate exponentially, therefore only a small dose of drugs is required, and generally low cost (see, for example, Sulakvelidze et al., supra). For a current review, see Fischetti VA, Nelson D, Schuch R. Reinventing phage therapy: are the parts greater than the sum? Nat Biotechnol. 2006 Dec; 24 (12): 1508-11.

Peptide and polypeptide-based drugs have been described, for example, for denileukin, diphitox, octeotide, vapreotide, lanreotide, peptides of the RC-3940 series, decapeptyl, lupron, zoladex, cetrorelix (see, for example, Lu et al., 2006, AAPS J 8: E466-472), hemocidins, staphopenes (see, e.g., Dubin et al., 2005, Acta Biochemica Polonica, 52: 633-638), as well as indolicidin, defensins, lantibiotics, B17 microcidin, histatin and maganine (see e.g., Yeaman and Yount, 2003, Pharmacol Rev 55: 27-55). General guidance on peptide and polypeptide drugs can also be found in Degim et al., 2007, Curr Pharm Des 13: 99-117 and Shai et al., 2006, Curr Prot Pept Sci, 7: 479-486. Recently approved peptide-based drugs include Hematide ™ (a peptide-based synthetic drug, stimulating erythropoiesis, Affymax, Inc.), exenatide (synthetic exendin-4, Amylin / Eli Lilly), natrekor (neziritide, natriuretic peptide, Scios) , plenaxis (Abarelix, Praecis Pharmaceuticals), and SecreFlo (secretin, Repligen).

The exact dose will be determined by the practitioner taking into account factors associated with the individual for whom treatment is required. Dose and administration are established to provide sufficient levels of the active agent or to maintain the desired effect. Factors that can be taken into account include the severity of the pathological condition, the general health of the individual, age, body weight and gender of the individual, diet, time and frequency of administration, combination (s) of drugs, sensitivity and tolerance / response to treatment . Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week or once every two weeks, depending on the half-life and the rate of excretion of a particular composition.

Especially suitable for the compositions of the invention (e.g., pharmaceutical compositions) are slow release formulations or mechanisms. For example, intra-scar devices include, but are not limited to, Time Capsule ™ Bolus from Agri-Feeds Ltd., New Zealand, originally developed by AgResearch Ltd., New Zealand, as described in WO 95/19763 and NZ 278977, and CAPTEC by Nufarm Health & Sciences, a division of Nufarm Ltd., Auckland, New Zealand, as described in AU 35908178, PCT / AU81 / 100082, and Laby et al., 1984, Can. J. Anim. Sci. 64 (Suppl.), 337-8, each of which is incorporated herein by reference. As a specific example, the device may include a spring and a piston that pushes the composition toward the hole at the end of the vessel.

As a further embodiment, the present invention relates to a composition for an aqueous additive, for example an irrigation composition or a feed additive, for example a feed for ruminants, for use with any of the methods discussed above. In specific aspects, the feed additive comprises at least one edible plant substance and the peptide or polypeptide of the present invention. Alternatively, the feed additive contains at least one edible plant substance and a polypeptide or peptide or polynucleotide encoding the peptide or polypeptide described herein, for example, as an expression vector or a host cell containing an expression vector. In particular, the composition further includes a cell inhibitor fused or linked to the resulting sequence. Preferred plant material includes any of hay, grass, grain or forage cereals, for example legumes, hay, grass hay, corn silage, cereal silo, bean silo, corn grain, oats, barley, grains, beer grains, soy flour and flour from cotton seeds. In particular, cereal silage is useful as a feed composition for ruminants. The plant material can be genetically modified so that it contains one or more components of the invention, for example, one or more polypeptides or peptides, polynucleotides or vectors.

In another embodiment, antibodies that are induced against the polypeptides or polynucleotides of the present invention can be used to determine the presence of microorganisms, especially methane producers, or in assays to monitor the levels of such microorganisms. Antibodies suitable for diagnostic purposes can be obtained in the same manner as described above. Diagnostic tests include methods that use an antibody and label to detect a polypeptide in human body fluids or extracts of cells or tissues. Antibodies can be used with or without modification and can be labeled by combining them either covalently or non-covalently with a reporter molecule. A variety of reporter molecules that are known in the art can be used, some of which are described above.

A number of protocols for measuring levels of a polypeptide or polynucleotide are known in the art (e.g., ELISA, RIA, FACS, and blotting, such as Southern, Northern, Western blotting), and provide a basis for determining the presence or levels of a microorganism, especially methane producers. Normal or standard levels are established by combining body fluids or cell extracts taken from healthy individuals, such as healthy people or ruminants, with the antibody under conditions suitable for complex formation. The value of the standard complexation can be determined quantitatively by various methods, but preferably by a photometric method. The amounts of the polypeptide or polynucleotide expressed in the individual and in the processed samples (for example, samples from the individuals treated) are compared with standard values. The deviation between the standard values and the values obtained from the individual sets the parameters for determining the presence or levels of the microorganism.

In a specific embodiment of the present invention, polynucleotides can be used for diagnostic purposes using specific hybridization and / or amplification techniques. Polynucleotides that may be used include oligonucleotides, complementary RNAs and DNA molecules and PNAs. Polynucleotides can be used to identify and quantify gene expression in samples in which expression may correlate with the presence or levels of the microorganism. Diagnostic analysis can be used to distinguish between the absence, presence and change of levels of microorganisms and to monitor levels during therapeutic intervention.

In one aspect, hybridization with PCR probes can be used to identify nucleic acid sequences, especially genomic sequences that encode the polypeptides of the present invention. The specificity of the probe, whether it is obtained from a highly specific region, for example 10 unique nucleotides in the 5 ′ regulatory region, or a less specific region, for example in the 3 ′ coding region, and the stringency of hybridization or amplification (maximum, high, intermediate or low) will determine whether the probe identifies only natural sequences, alleles, or related sequences. Probes can also be used to detect related sequences, and preferably should contain at least 50% of the nucleotides from any of the coding sequences. Hybridization probes of the subject invention can be DNA or RNA and originate from the nucleotide sequence of SEQ ID NO: 74-142, or complement, or their modified sequences, or from genomic sequences, including the promoter, enhancer elements, and introns of the natural sequence.

Methods for producing specific DNA hybridization probes include cloning nucleic acid sequences into vectors to obtain mRNA probes. Such vectors are known in the art, commercially available, and can be used for in vitro synthesis of RNA probes by adding the corresponding RNA polymerases and the corresponding labeled nucleotides. Hybridization probes can be labeled with a number of reporter groups, for example, radionuclides, such as ³² P or ³⁵ S, or enzyme labels, such as alkaline phosphatase, coupled to the probe via avidin / biotin coupling systems, and the like. Polynucleotides can be used in Southern or Northern analysis, dot blotting or other membrane techniques; in PCR methods; or in test strips, rods, ELISA assays, or microarrays using liquids or tissues from an individual's biopsy specimens to detect the presence or levels of the microorganism. Such qualitative and quantitative methods are known in the art.

In a particular aspect, nucleic acid sequences can be used in various assays, labeled by standard methods and added to a liquid or tissue sample from an individual under conditions suitable for hybridization and / or amplification. After an appropriate incubation period, the sample is washed and the signal is measured and compared with a standard value. If the signal value in the test sample varies significantly compared to the signal value of the control sample, the presence of altered levels of nucleotide sequences in the sample indicates the presence or levels of the microorganism. Such analyzes can also be used to evaluate the effectiveness of a particular treatment regimen in animal studies, in clinical trials, or when monitoring an individual’s treatment.

To provide a basis for diagnosing the presence or levels of a microorganism, a normal or standard expression profile is established. This can be done by combining body fluids or cell extracts taken from healthy individuals with a polynucleotide or fragment thereof, under conditions suitable for hybridization and / or amplification. Standard levels can be quantified by comparing levels obtained from healthy individuals with levels from an experiment in which a known amount of substantially purified polynucleotide is used. The standard values obtained from normal samples can be compared with the values obtained from samples from individuals who underwent treatment against microbial growth. The deviation between the standard values and the values of the individual is used to establish the presence or levels of the microorganism.

After the microorganism has been identified and the treatment protocol has been started, hybridization and / or amplification analyzes can be repeated regularly to determine if the expression level begins to decrease in an individual compared to that observed in a normal individual. The results obtained from subsequent analyzes can be used to demonstrate the effectiveness of treatment over a period of time ranging from several days to months.

Specific diagnostic applications for oligonucleotides derived from nucleic acid sequences may include the use of PCR. Such oligomers can be synthesized chemically, obtained enzymatically or obtained in vitro . Oligomers will preferably consist of two nucleotide sequences, one with a sense orientation (5 '. → .3') and the other with an antisense orientation (3 '. → .5') used under optimized conditions to identify a specific nucleotide sequence or state. The same two oligomers, a set of oligomers for nested PCR, or even a degenerate pool of oligomers can be used under less stringent conditions to identify and / or quantify closely related DNA or RNA sequences.

Methods that can also be used for quantitative analysis of expression include radioactively labeled or biotinylated nucleotides, co-amplification of a control nucleic acid, and standard curves on which experimental results are interpolated (Melby, PC et al. (1993) J. Immunol. Methods, 159: 235-244; Duplaa, C. et al. (1993) Anal. Biochem. 229-236). The speed of quantitative analysis of multiple samples can be increased by conducting this study in the ELISA format, where the oligomer of interest is in various dilutions and the spectrophotometric or colorimetric response gives a quick quantitative determination.

In further embodiments, oligonucleotides or longer fragments derived from any polynucleotides described herein can be used as targets in a microchip. The microchip can be used to monitor the expression level of a huge number of genes simultaneously (to obtain a transcript image), and to identify genetic variants, mutations, and polymorphisms. This information can be used to determine gene function, to understand the genetic basis of a disease, to diagnose a disease, and to develop and monitor the activities of therapeutic agents. In one embodiment, a microchip is prepared and used in accordance with methods known in the art, for example, those described in PCT Application WO 95/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619).

In one aspect, oligonucleotides can be synthesized on the surface of a microarray using a chemical coupling technique and an inkjet application device, such as described in PCT Application WO95 / 251116 (Baldeschweiler et al.). In another aspect, a “grid” matrix similar to a dot or slot blot (HYBRIDOT apparatus, Life Technologies) can be used to systematize and connect fragments of cDNA or oligonucleotides to a substrate surface using a vacuum system, thermal, UV, mechanical method, or chemical bonding method. In another aspect, the matrix can be obtained manually, or by using available devices, materials, and devices (including multichannel microdosing or robotic tools; Brinkmann, Westbury, NY) and may contain, for example, 24, 48, 96, 384, 1024 , 1536 or 6144 spots or holes (for example, in the form of a multi-well plate), or more, or any other multiple of from 2 to 1,000,000, which is suitable for the effective use of commercially available use of technical means.

To analyze a sample using microarrays, polynucleotides are extracted from a biological sample. Biological samples can be obtained from any body fluid (blood, urine, saliva, sputum, gastric juice, etc.), cultured cells, biopsy specimens, or other tissue preparations. To obtain probes, polynucleotides extracted from a sample are used to obtain nucleic acid sequences that are complementary to nucleic acids on a microchip. If the microchip consists of cDNA, antisense RNAs are suitable probes. Therefore, in one aspect, mRNA is used to produce cDNA, which in turn, and in the presence of fluorescent nucleotides, is used to obtain fragments or antisense RNA probes. These fluorescently labeled probes are incubated with the microchip so that the probe sequences hybridize with the cDNA of the microchip oligonucleotides. In another aspect, the nucleic acid sequences used as probes may contain polynucleotides, fragments, and complementary or antisense sequences obtained using restriction enzymes, PCR methods, and oligolabeling kits (Amersham Pharmacia Biotech) well known in the field of hybridization technology.

In another embodiment of the present invention, the polypeptides of the invention or their functional or immunogenic fragments or oligopeptides can be used to screen libraries of compounds in any of a variety of drug screening methods. The fragment used in such a screening can be free in solution, fixed on a solid substrate, transferred to the cell surface or located intracellularly. The formation of binding complexes between the polypeptide and the test substance can be measured.

One drug screening technique that can be used involves high throughput screening for compounds having binding affinity for a polypeptide of interest, as described in PCT published application WO 84/03564. In this method, a large number of various small test compounds are synthesized on a solid substrate, for example plastic pins, or some other surfaces. Test compounds are reacted with the polypeptide, or fragments thereof, and washed. The bound polypeptide is then detected by methods well known in the art. The purified polypeptide can also be applied directly to tablets for use in the aforementioned drug screening methods. Alternatively, non-neutralizing antibodies can be used to capture the polypeptide and immobilize it on a solid support.

In another method, competitive assays can be used to screen drugs in which neutralizing antibodies capable of binding to the polypeptide specifically compete with the test compound for binding to the polypeptide. Thus, antibodies can be used to detect the presence of a test compound that shares one or more antigen binding sites with an antibody.

EXAMPLES

The examples described in this application are intended to illustrate embodiments of the present invention. Other options for implementation, methods and types of analysis are within the competence of specialists in the field of molecular diagnostics and do not need a detailed description. Other embodiments within the scope of the prior art are considered part of this invention.

EXAMPLE 1: estimation of genome size

The Methanobrevibacter ruminantium M1 ^T strain (DSM1093) was grown in BY + medium (minimal medium, Joblin et al., 1990), which consists of [g / L] NaCl (1), KH ₂ PO ₄ (0.5), (NH ₄ ) ₂ SO ₄ (0.25), CaCL ₂ · 2H ₂ O (0.13), MgSO ₄ · 7H ₂ O (0.2), K ₂ HPO ₄ (1), clarified scar fluid (300 ml) dH ₂ O (360 ml), NaHCO ₃ (5), resazurin (0.2 ml), L-cysteine-HCl (0.5), yeast extract (2), and Balch trace element solution (10 ml) (added trace elements; Balch et al., 1979), which consists of (g / l) nitrile triacetic acid (1.5), MgSO ₄ · 7H ₂ O (3), MnSO ₄ · H ₂ O (0.5), NaCl ( 1), FeSO ₄ · 7H ₂ O (0,1), CoCl ₂ · 6H ₂ O (0,1), CaCl ₂ (0,1), ZnSO ₄ · 7H ₂ O (0,1), CuSO ₄ · 5H ₂ O (0.01), AlK (SO ₄ ) ₂ · 12H ₂ O (0.01), H ₃ BO ₃ (0.01), Na ₂ MoO ₄ · 2H ₂ O (0.01), N iSO ₄ · 6H ₂ O (0.03), Na ₂ SeO ₃ (0.02), and Na ₂ Wo ₄ · 2H ₂ O (0.02). Genomic DNA was extracted by freezing cell debris in liquid N ₂ and ground using a pre-chilled sterile mortar and pestle. Cell homogenates were immersed in agarose plugs, and subsequent manipulations were performed in these plugs to reduce the physical fragmentation of genomic DNA. Cleavages were performed with restriction endonucleases, and DNA fragments were separated using pulsed field gradient gel electrophoresis (PFGE).

EXAMPLE 2: DNA cloning and sequencing

The DNA of the M. ruminantium genome was sequenced by Agencourt Biosciences Corporation (Massachusetts, USA) using the cloning approach of stochastic genomic fragments (Fleischmann et al., 1995) and Macrogen Corporation (Rockville, MD, USA) using pyrosequencing. Briefly, M. ruminantium DNA libraries were constructed in Escherichia coli by random physical destruction of genomic DNA and separation of fragments by gel electrophoresis. Large fragments in the range of 40 Kb were extracted from the gel and used to obtain a large insert phosmide library. DNA fragments in the range from 2 to 4 Kb were extracted and used to obtain a small insert plasmid library. Clones obtained from both large and small insertion libraries were grown, and their phosmid or plasmid DNA was recovered and sequenced using high-throughput sequencing technology. A sufficient number of clones was sequenced to obtain a theoretical 8-fold coverage of the M. ruminantium genome. Pyrosequencing was performed on randomly split genomic DNA fragments with a final theoretical 10-fold coverage.

EXAMPLE 3: assembly and description of the sequence of prophage

DNA sequences were aligned to find overlapping sequences and assembled into continuous (contig) sequences using the Paracel Genome Assembler (Paracel Inc, CA, USA) and the Staden package (Stadenet al.,1998), in combination with a sequence of both standard and inverted PCR. The contigs were analyzed using an open reading frame finder (ORF) GLIMMER (GeneLocatorInterpolatedMarkovModelER Delcher et al., 1999), and each ORF was analyzed using BLASTP with gaps (BasicLocalAlignmentSearchTool (Altschul et al., 1997) regarding the replenished nucleotide and protein databases of the National Center for Biotechnological Information (NCBI). Contigs from an 8-fold preliminary sequence were randomly joined by artificial sequence linking to obtain a “pseudomolecule,” and submitted to the Institute for Genomic Research (TIGR, DC, USA) for auto annotation. Contigs collected by 10-fold pyrosequencing were re-analyzed using GLIMMER, and ORFs were auto-annotated using GAMOLA (Global Annotation of Multiplexed On-site Blasted DNA sequences; Altermann and Klaenhammer, 2003). ORFs were classified by function using an orthologous protein (COG) cluster database (threshold 1e-02) (hypertext transfer protocol: // world wide web.pnas.org/cgi/content/full/102/11/3906; Tatusov et al., 2001).

Protein motifs were determined using HMMER (hypertext transfer protocol: //hmmer.wustl.edu), using the PFAM HMM and TIGRFAM libraries, and general and local alignment (hypertext transfer protocol: //pfam.wustl.edu) and standard and fragment models TIGRFAM HMM (hypertext transfer protocol: // world wide web.tigr.org/TIGRFAMs), respectively (threshold 1e-02). tRNAs were identified using TRNASCAN-SE (Lowe and Eddy, 1997), and nucleotide repeats were identified using the KODON software package (Applied Maths, Austin, TX, USA) and REPUTER (Kurtz and Schleiermacher, 1999). Automated annotations were subsequently verified manually. A genomic atlas of visualizations was compiled using GENEWIZ (Jensen et al., 1999), and key data structures were obtained using proprietary algorithms. The reconstruction path from the predictedM. ruminantium ORFeoma was performed in combination with KEGG (Kyoto Encyclopedia of Genes and Genomes, Kanehisa et al., 2004) on-line databases using proprietary software (PathwayVoyager; Altermann and Klaenhammer, 2005).

EXAMPLE 4: sequence results and analysis

Estimation of the genome size of M. ruminantium by digestion with restriction enzymes of genomic DNA, and the determination of fragment sizes by PFGE, showed one chromosome of approximately 2.5-2.9 Mb. Initial sequencing of large and small insertion clones (6-fold approximate coverage) and sequence assembly into contigs showed that the 40 Kb genome region was highly represented (> 20 times), especially within a small insertion library. Perhaps this was due to the high number of plasmid copies (although no extrachromosomal DNA was identified) or the lysogenic bacteriophage that replicated during the growth of the culture used for DNA extraction. Due to this large distortion of the sequence, additional sequencing (2-fold theoretical genome coverage) was performed only for small insertion clones with a final 8-fold coverage resulting from Senger sequencing. The 8-fold phase sequence was assembled into 756 contigs, which were connected via 105 scaffolds. Further pyrosequencing was carried out until an additional ~ 10-fold coverage and inclusion of these sequences in the assembly, resulting in the number of contigs decreasing to 27. Subsequent closure of the breaks using inverted PCR and PCR technology of long fragments, reduced the number of contigs to 14 with the remaining one improper assembly.

During the high-throughput sequencing phase, the standard error was observed when the sequence was covered with respect to the region (~ 50 kb) of a significantly higher G + C content immediately adjacent to the low G + C region (~ 12 Kb). Genome sequence analysis using GAMOLA and GeneWiz led to the discovery of a prominent high-GC region located immediately adjacent to the large low-GC peak. Detailed analyzes of a region with a high G + C content showed the presence of gene products with similarities to integrase like phage, large subunit of phage terminal, phage portal protein, capsid protein of phage, and predicted peptidase acting as phage lysine (FIG. 3). These gene products were used as anchor points for the entire structure of the putative M. ruminantium prophage, named φmru. Based on the analysis of the secondary structures of DNA, the probable integration sites att L and att R were identified (FIG. 1A). The phage integration at the att site appears to have a damaged putative membrane protein encoded by ORF 1980 and 2069, and this gene may contain the original integration site for the phage genome φmru, attB .

The general structure (FIG. 1B) and the DNA sequence (FIG. 4A) φmru were determined based on the generally recognized modular structure of phage genomes combined with similarities to the sequence and functional databases. See, for example, Altermann E, Klein JR, Henrich B. Primary structure and features of the genome of the Lactobacillus gasseri temperate bacteriophage (phi) adh. Gene. 1999 Aug 20; 236 (2): 333-46; Desiere F, Lucchini S, Canchaya C, Ventura M, Brüssow H. Antonie Van Leeuwenhoek. Comparative genomics of phages and prophages in lactic acid bacteria. 2002 Aug; 82 (1-4): 73-91. The predicted phage ORM phage φmru has been successfully classified into modules encoding phage integration, DNA replication and packaging, phage structural proteins and the cassette, and approximately 40% of phage ORFs have been functionally characterized. A terminator-like structure in a large non-coding region (244 nucleotide pairs), flanked by a large number of direct and indirect repeats, and defined in the DNA replication module, was characterized as the putative start point for DNA replication. Several genes were predicted within the antisense strand genomic sequence of the phage, and they coincided with regions with a low GC content. It should be determined whether these genes inactivate phage function, or indicate an incorrect assembly in the phage genome.

It was found that the region with a low GC content between the putative phage lysine and att R contains a DNA modification system under the influence of sulfur, dnd (destruction during electrophoresis), including restriction of type II m6 adenine methyltransferase DNA and a transcriptional regulator, probably specific to the dnd system. Moreover, non-coding RNA structures were identified both within the phage genome and flanking it. Within the putative DNA replication module, rbcL was identified. rbcL is a 5 'UTR RNA stabilizing element from Chlamydomonas reinhardtii . It is believed that this family is involved in the stabilization of the rbcL gene, which encodes the large subunit of ribulose-1,5-bisphosphate carboxylase. Mutations in this family can lead to a 50-fold increase in transcript destruction.

Three intron structures of group I were identified, flanking the phage genome. The catalytic introns of group I are large ribozymes of autonomous splicing. They catalyze their own excision from mRNA, tRNA and rRNA precursors in a number of organisms. The secondary crustal structure consists of 9 paired regions (P1-P9). They are multiples of essentially two domains — the P4-P6 domain (formed from stacking of P5, P4, P6 and P6a helices) and the P3-P9 domain (formed from P8, P3, P7 and P9 helices). The secondary structure noted for this family represents only this conservative core. The catalytic introns of group I often have long ORFs built into the loop regions. These non-coding RNA structures are located in non-coding regions between the overlying ORF 1980 (SEQ ID NO: 74), the underlying ORF 2065 (SEQ ID NO: 141) and attR and above ORF 2069 (SEQ ID NO: 142).

EXAMPLE 5A: phage genes

The discovery of the prophage sequence within the genomic sequence of M. ruminantium was unexpected. Previously, it was not reported that the M1 strain Methanobrevibacter ruminantium (DSM 1093) is susceptible to either lytic or lysogenic phage, although there have been reports of a phage identified for other Methanobrevibacter species (Baresi and Bertani, 1984; Knox and Harris, 1986). The sequence of the prophage φmru is significantly higher in G + C content than the surrounding M. ruminantium genome, which suggests that it originates from another organism. The observed homology levels make it impossible to suggest the obvious host from which it originates, and indicate that φmru is not like any other phage encountered so far.

The φmru DNA sequence is inserted within the putative M. ruminantium membrane protein and is flanked by DNA sequences with secondary structures comparable to attL and attR sites . Despite the lack of strict homology with other known proteins, all characteristics of phage functional modules could be identified in the φmru sequence. An interesting feature of this sequence is a region with a low G + C content at the 3 'end, which demonstrates homology with proteins involved in the DNA modification system under the influence of sulfur (dnd). These genes are located above the attR φmru attachment site and are therefore likely introduced into the M. ruminantium genome during phage integration. This region encodes several dnd-associated ORFs (dnd 1, 2, and 3), and a type II methylase subunit along with the putative transcriptional regulator.

The dnd phenotype makes its DNA susceptible to degradation during electrophoresis. Analysis of the corresponding functions of the dnd ORF suggested the inclusion of sulfur or a sulfur-containing substance in the host genome. It has also been discovered that the Dnd phenotype exists in the DNA of widespread bacterial species of various origins and different habitats. Similarly organized gene clusters were found in several bacterial genomes representing different genera and in eDNA of marine organisms, suggesting that such a modification is a widespread phenomenon. It has been demonstrated that the coincidence between the Dnd phenotype and the modification of DNA under the influence of sulfur occurs in several characteristic bacterial genomes during in vivo (35) S-labeling experiments (Zhou X, He X, Liang J, Li A, Xu T, Kieser T , Helmann JD, Deng Z. A novel DNA modification by sulphur. Mol Microbiol. 2005 Sep; 57 (5): 1428-38).

R \ M type II systems are the simplest and most common. Instead of acting as a complex, methyltransferase and endonuclease are encoded as two separate proteins and they act independently. There is no specific protein. Both proteins recognize the same recognition site, and therefore compete for activity. Methyl transferase acts as a monomer methylating duplex on one chain at a time. Endonuclease acts as a homodimer that facilitates the cleavage of both chains. The splitting occurs in a certain position close to the recognition sequence, or within it. At this point, it is not clear how the proposed functional activity acts with the dnd system. However, it is clear that the phage is suitable as a carrier for gene delivery. In particular, the lysogenic conversion region can be used as a gene substitution site.

It is likely that the dnd system was transferred to M. ruminantium via phage. As such, the role of the dnd of the φmru system in the protection or modification of M. ruminantium or foreign DNA is unknown. Another interesting feature of the φmru sequence is the number of ORFs encoded on the antisense chain. These ORFs correspond to low GC regions and have weak BLAST correspondences with proteins from a number of organisms. This could suggest that these genes have been accumulated within the φmru genome since its integration into M. ruminantium . It is not clear whether these ORFs represent a continuous accumulation of inserts that can inadvertently lead to phage inactivation and domestication, or whether φmru is fully active.

One φmru gene of particular interest for minimizing methane is ORF2058 located in the lysis cassette. ORF 2058 is described as peptidase and has the correspondence of the protein family (Pfam) (Score: -13.7, E-value: 0.00054) with the C39 peptidase protein family. These proteins are cysteine peptidases and are part of a larger group of CA peptidases, as determined using the MEROPS peptidase database (Rawlings et al., 2006). The C39 peptidase family is usually associated with ABC transporters, and they function as maturation proteases during the secretion and processing of bacteriocins. The CA peptidase group also includes viral cysteine endopeptidases, such as C71 protozoan endoisopeptidases, which cleave cross-linked protozoa of the protozoan cell wall. The cell walls of methane-producing protozoa, belonging to the Methanobacteriales family , contain parallel chains of pseudomurein, a polymer of N- acetyl-L-thalosaminuric acid, cross-linked with a peptide. Pseudomureinendoisopeptidases C71 are able to cleave peptide cross-linking of the protozoa cell wall and lyse these cells.

Based on the position and synteny with pseudo- mureinendoisopeptidase from Methanothermobacter marburgensis of phage ΨM2 (FIG. 3), ORF 2058 can play the role of a methane producer lysine gene that encodes a lytic enzyme involved in lysis of the cell wall before phage progeny are released. The alignment of ORF 2058 with PeiP from M. marburgensis and PeiW from M. wolfeii (FIG. 5) shows a low overall homology between these proteins. However, there is conservation of histidine and aspartic acid residues involved in the catalytic triad of endoisopeptidase, and the cysteine residue in ORF 2058 is located near the stored cysteine PeiP and PeiW, which creates the third conserved site of the catalytic triad (Makarova et al ., 1999, Luo et al ., 2002 ) Moreover, the Gly-His-Tyr motif surrounding His catalytic residue in PeiP and PeiW is also found in ORF 2058. These observations indicate that ORF 2058 is a φmru lysine gene that functions to lyse M. ruminantium cells during lytic cycle of phage. The differences observed between ORF 2058 and PeiP and PeiW may reflect different peptide cross-linking of the protozoan cell wall and, therefore, substrate specificity.

EXAMPLE 5B: phage induction

Methanobrevibacter ruminantium strain M1 ^T (DSM1093) was grown on BY + medium (basic medium, Joblin et al., 1990), which consists of [g / L] NaCl (1), KH ₂ PO ₄ (0.5), (NH ₄ ) ₂ SO ₄ (0.25), CaCL ₂ · 2H ₂ O (0.13), MgSO ₄ · 7H ₂ O (0.2), K ₂ HPO ₄ (1), clarified rumen fluid (300 ml), dH ₂ O (360 ml), NaHCO ₃ (5), resazurin (0.2 ml), L-cysteine-HCl (0.5), yeast extract (2), and Balch trace element solution (10 ml) (added trace elements; Balch et al., 1979), which consists of (g / l) nitrile triacetic acid (1.5), MgSO ₄ · 7H ₂ O (3), MnSO ₄ · H ₂ O (0.5), NaCl (1) , FeSO ₄ · 7H ₂ O (0,1), CoCl ₂ · 6H ₂ O (0,1), CaCl ₂ (0,1), ZnSO ₄ · 7H ₂ O (0,1), CuSO ₄ · 5H ₂ O (0.01), AlK (SO ₄ ) ₂ · 12H ₂ O (0.01), H ₃ BO ₃ (0.01), Na ₂ MoO ₄ · 2H ₂ O (0.01), NiSO ₄ · 6H ₂ O (0, 03), Na ₂ SeO ₃ (0.02), and Na ₂ Wo ₄ · 2H ₂ O (0.02).

At optical densities (OD) measured at a wavelength of 600 (OD ₆₀₀ ) between 0.10 and 0.14, M. ruminantium was stimulated with 1 ml and 2 ml of sterile air (~ 160-320 μl of oxygen), respectively (Figure 1C ) and 2 μg / ml mitomycin C (Figure 1D). Characteristic lysis curves could be observed for both stimuli, with a latent period of ~ 90 min for an air stimulus. Initial results for mitomycin C stimulation show a very short latency period. In order to verify the exclusion of phage from the host genome, 2 oligonucleotides were generated that are facing both phage attachment sites, respectively (R1F: caaagagagattaaagaagcagacg; SEQ ID NO: 146 and L2R agtagtgttggaatcagtgaaaagg; SEQ ID NO: 147). This pair of primers only produces amplicon if the phage genome recycles after exclusion.

Figure 1E shows initial exclusion experiments when M. ruminantium was stimulated with air. After induction, a distinct and unambiguously identifiable amplicon of the expected size was detected, indicating the completed exclusion and recirculation. A similar, albeit weaker, band was also found in uninduced M. ruminantium cells, indicating that φmru is capable of spontaneous exclusion during normal unstimulated growth.

EXAMPLE 5C: biological studies of lytic enzymes

The polypeptide encoded by ORF 2058 is used as a lytic enzyme specific for rumen methane producers and has been subcloned into an E. coli expression vector to produce a recombinant protein. ORF 2058 was amplified by PCR using Mbbrum11for22 primers (1122For, cac cat ggt tag att cag cag aga c; SEQ ID NO: 148) and Mbbrum11rev22 (1122 Rev, tca tgc agg aca gac aac ata gta g; SEQ ID NO: 149 ) in the volume of the reaction mixture, 150 μl, containing: 121.5 ng of genomic DNA of M. ruminantium strain M1; 0.2 μM of 1122For and 1122Rev primers; 15 μl of Accuprime Pfx buffer (with dNTPs, InVitrogen); 2.4 μl Accuprime Pfx (InVitrogen). PCR conditions were 2 min at 95 ° C for initial denaturation followed by 35 cycles of 15 seconds at 95 ° C, 30 seconds at 55 ° C, and 40 seconds at 68 ° C. Final elongation was not used. The PCR product was purified and quantitatively analyzed using Nanodrop (Thermo Scientific, GA, USA).

ORF 2058 cloning: PCR-amplified ORF 2058 was cloned into either pET 100 or pET 151-D Topo vectors (InVitrogen) according to the manufacturer's recommendations and transformed into chemically competent TOP 10 cells (InVitrogen). Transformants were analyzed using the method of molecular colonies by PCR, and plasmid DNA was purified and sequenced. Clones with DNA sequences corresponding to ORF 2058 sequences were selected.

ORF 2058 expression: plasmid DNA from clones containing verified ORF 2058 inserts was transformed by electroporation into electrocompetent BL21 * or Rosetta 2 cells. It was found that the best growth conditions for the expression of soluble ORF 2058 protein in LB medium, with induction between 0.48-0.6 absorbance at 600 nm using 0.5 mM IPTG and continuous growth for approximately six hours at 30 ° C. Then the cells were harvested by centrifugation and frozen at -20ºC.

Cell lysis: cell debris was thawed and resuspended in the following buffer (pH 7.5): 300 mM NaCl, 2 mM DTT, 10 mM imidazole, 20 mM Tris, 20% glycerol, 1% Triton-X, 5 mM CaCl ₂ , and 10 IM MgCl ₂ . Lysozyme was added to a final concentration of 1 mg / ml, followed by incubation on ice with gentle stirring for 30 minutes. DNase I and RNase I were each added to a final concentration of 5 μg / ml, followed by incubation on ice with gentle stirring for 30 minutes. The cell lysate was centrifuged at 12,000 rpm for 15 minutes, and the crude lysate was filtered through a 0.8 μm filter.

Nickel affinity chromatography: the filtered supernatant as a result of cell lysis was applied to an 80 ml nickel affinity column and eluted using a 20 mM - 250 mM imidazole gradient in the following buffer (pH 7.5): 300 mM NaCl, 2 mM DTT, 20 mM Tris, and 20% glycerol. Fractions eluted from the column containing ORF 2058 expressed protein were concentrated using a Millipore ultra filter cell with a membrane separating 10,000 kDa. The ORF 2058 construct in pET100 expressed in E. coli BL21 * cells was eluted from the nickel column with the following elution buffer, pH 8.2 (20 mM Tris, 250 mM imidazole, 300 mM NaCl, 10 mM b-mercaptoethanol , 10% glycerol ), and the enzyme was stored in a buffer to which glycerol and dithiothreitol were additionally added until a final concentration of 40% glycerol, 1 mM dithiothreitol, pH 8.2 was reached.

Desalination: desalination of the concentrated protein expressed from pET 151 construct in Rosetta 2 cells was performed using a 250 ml BioGel P6 DG (BioRad, CA, USA) column with the following buffer (pH 7.0): 20 mM MOPS, 1 mM DTT, 300 mM NaCl, and 20% glycerol. Column fractions were concentrated as described above, and the final sample was filtered and quickly frozen in liquid nitrogen until storage at -20 ° C.

Lysis of the resulting M. ruminantium cells: five ml of cultures of M. ruminantium M1 (DSM 1093) were grown in BY + medium in Hungate tubes until the late logarithmic phase, and cells were collected by centrifuging Hungate tubes at 5000 × g at room temperature for 30 minutes. The tubes were transferred to an anaerobic chamber (atmosphere 95% CO ₂ - 5% H ₂ , Coy Laboratory Products, MI, USA), in which the supernatant was discarded and cells from 10 ml of culture were resuspended in 1 ml of MOPS buffer pH 6.8 (50 mM MOPS 5 mM CaCl _2, 1 mM dithiothreitol). The cell suspension was adjusted to OD (600 nm) ~ 0.12 by dilution with additional MOPS buffer.

A standardized cell suspension (50 μl) was placed in a microtiter plate and various concentrations of the lytic enzyme ORF 2058 (obtained from pET 100 construct) were added and the total volume of the reaction mixture was adjusted to 250 ml with buffer. Mixtures of cells and protein were incubated at 37 ° C and OD readings were recorded. The effect of adding the enzyme (μg of the enzyme added to the study) on the remaining M. ruminantium cells is shown in FIG. 7. Enzyme additions reduced OD 600 nm of suspended cells in a dose-dependent manner compared to control cells without enzyme addition. This indicates that the lytic enzyme ORF 2058 has the ability to infect and lyse the remaining M. ruminantium cells under anaerobic conditions.

Lysis of growing M. ruminantium cells: M. ruminantium was grown in RM02 medium. RM02 medium was composed of the following ingredients (g / l): KH ₂ PO ₄ (1,4), (NH ₄ ) ₂ SO ₄ (0,6), KCl (1,5), trace element solution SL10 (1 ml) solution of selenite / tungsten, (1 ml), 0.1% (w / v) solution of resazurin (4 drops). The components were mixed and boiled under conditions without O ₂ 100% CO ₂ , and cooled in an ice bath while sparging 100% CO ₂ . After cooling, NaHCO ₃ (4.2 g) and L-cysteine · HCl · H ₂ O (0.5 g) were added, and 9.5 ml of the medium was placed in Hungate tubes when the tubes were aerated with 100% CO ₂ . The tubes were autoclaved and stored in the dark for 24 hours prior to use. Before inoculation, NoSubRFV was added (0.5 ml per tube containing substrates, yeast extract, vitamins). After inoculation, the tubes were gassed with 80% CO _2/20% H ₂ and 25 lbs / ^in2. M. ruminantium was grown until the middle of logarithmic growth (OD 600 nm ~ 0.1); at this point, the lytic enzyme ORF 2058 (obtained from clone pET 151 D Topo) was added to the cultures at various concentrations. Incubation of the cultures was continued and OD readings were recorded. The effect of the addition of the enzyme on the growth and formation of the membrane of M. ruminantium (% membrane formation relative to the non-added control after 217 hours of growth is shown in parentheses) is shown in FIG. 8. The results show that the lytic enzyme ORF 2058 significantly affects the growth of M. ruminantium in a dose-dependent manner, reducing the OD 600 nm of growing cultures within 2 hours of addition. The two highest levels of enzyme addition also reduced membrane formation to a degree similar to that with the addition of chloroform (adding 100 μl / 10 ml of culture).

EXAMPLE 6: General Information

The unexpected discovery of M. ruminantium genome sequencing was the presence of a prophage sequence. Genomic sequence analysis identified an area with an unusually high GC content that contained a number of phage related genes. The entire structure of the proposed prophage was identified using additional bioinformation analyzes and designated as φmru. About 40% of phage genes were assigned to discrete functional groups, including phage integration, DNA replication and packaging, phage structural proteins and lysis. It has been found that DNA sequences flanking the phage genome represent potential sites for phage integration (attL and attR).

Apparently, the phage itself integrated into the putative membrane protein.M. ruminantium,which probably contains the initial site for the integration of methanogen producer for the phmru phage genome,attB.Moreover, it is believed that a terminator-like structure found within the DNA replication module represents the origin of phage DNA replication. The low GC region at the 3 'end of the phage genome contains what appears to be a sulfur modification system for DNA, including a gene that probably controls the expression of the dnd system. These genes were probably introduced into the M. genome.ruminantiumduring phage integration, their role in modifying phage, host DNA or foreign DNA remains to be determined. Saving dnd systemM ruminantiummakes it possible to assume that it benefits the owner. However, the role of the dnd system φmru in the modificationM. ruminantiumor foreign DNA remains under investigation.

Another interesting feature of the φmru sequence is a number of genes encoded on the antisense strand that correspond to regions with a low GC content and have weak correspondences with proteins from a number of organisms. This suggests that these genes have accumulated within the φmru genome since its integration intoM. ruminantiumand it may be that these genes represent a continuous accumulation of inserts that could accidentally lead to inactivation of the phage and domestication of the phage. High GC content in the phmru phage sequence compared to the genomeM. ruminantium gives the opportunity to suggest that it comes from another organism. However, the previous host is not obvious, because the φmru proteins are to some extent unique compared to other phages encountered to date.

The φmru genes of particular interest in methane reduction are genes located within the lytic cassette. One gene in particular encodes a protein that is similar to the C39 family of peptidases. This family of peptidases includes, among others, viral cysteine endopeptidases, such as phage endoisopeptidases C71 protozoa, which cleave the cross-linking peptides of pseudomurein, which makes up the cell walls of Methanobrevibacter . Based on the localization of the gene within the phage genome and the synthesis of endogenous pseudomurein from other phage genomes of methane producers that are not in the rumen, this gene can play a role as a lysine gene encoding the lytic enzyme involved in cell lysis before phage progeny are released. This gene and the enzyme encoded by it are of obvious interest as a control mechanism for M. ruminantium and other rumen methane producers with similar cell walls.

Ruminant phages and their enzymes, which are involved in the lysis of host cells, present great opportunities for controlling both populations of methane producers and other community members (bacteria, protozoa, and fungi) in the rumen. In addition, it is possible to identify key targets of host enzymes that are sensitive to inhibition by phage proteins through an understanding of the phage's life cycles. The inventors conducted studies of the composition of the rumen phage in cows, sheep and deer, and showed that they demonstrate a change in time in number and type. New Zealand methane-producing isolates that are affected by phage have also been identified. Pure cultures of methane producers were used to evaluate the lytic enzymes of the phage, and culture-based and PCR-based techniques were developed to screen for the new phage. It was shown that the purified phage from scar samples lend themselves to random DNA analysis of a sequence that allows the detection of prophage enzymes.

There are several advantages to using phage or its enzymes in minimizing environmental impact techniques to reduce methane emissions. Phages are natural components of the microbiological community in the rumen, and therefore should not be considered as antibacterial treatment (they could easily overcome any regulatory restrictions). Phages are usually specific for a narrow range of hosts, potentially making it possible to selectively target them to methane producers. Phage therapy is currently considered a treatment for antibiotic-resistant organisms and is generally considered safe. After receipt, the phage is usually relatively stable. The introduction of strains of methanoproducers into the rumen, which are exposed to phage, could have long-term therapeutic effects, in particular, if inoculation takes place at an early age (for example, in young lambs and calves). It is known that some methane producers either contain phage genomes that are sensitive to lytic phage or undergo autolysis (resembling lytic enzymes), including Methanobrevibacter smithii (strain PS), Methanobacterium bryantii, and Methanobrevibacter strain MF-1. One notable example of a phage used to inhibit agriculturally problematic phages is the use of phage for targeted delivery to Escherichia coll. 0157: H7.

Methanobrevibacter ruminantium was chosen for genome sequencing due to dominance in the rumen under various nutritional conditions (based on cultivation data and molecular determination), accessibility of cultures, convenience for routine cultivation in a laboratory, and a relatively large number of preliminary studies and primary sources available for this organism. The present invention provides important data regarding the M. ruminantium genome and provides a detailed picture of this phage in the rumen. The prophage sequence φmru provides specific reagents for inhibiting M. ruminantium and for further genetic manipulations to aid in determining gene function. This phage can be used to block conservative functions / components among methane producers to prevent or reduce the formation of methane in the rumen.

References

Altermann E, Klaenhammer TR (2005) Pathway Voyager: pathway mapping using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. BMC Genomics 6: 60-66.

Altermann, E Klaenhammer TR (2003) GAMOLA: a new local solution for sequence annotation and analyzing draft and finished prokaryotic genomes. OMICS: A journal of integrative biology 7 , 161-169.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402.

Balch WE, Fox GE, Magrum LJ, Woese CR, Wolfe RS (1979) Methanogens: reevaluation of a unique biological group. Microbiological Reviews 43 , 260-296.

Baresi, L. and Bertani, G. 1984. Isolation of a bacteriophage for a methanogenic bacterium. In Abstracts of the Annual Meeting of the American Society for Microbiology . Washington DC: American Society for Microbiology, p. 133.

Bickle, T. A. and D. H. Kruger. 1993. Biology of DNA restriction. Microbiol. Rev. 57: 434-450.

Bult CJ, et al. (1996) Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii . Science 273 , 1058-1073.

Coutinho PM, Henrissat B (1999) Carbohydrate-active enzymes: an integrated database approach. In 'Recent Advances in Carbohydrate Bioengineering' (Eds HJ Gilbert, G Davies, B Henrissat and B Svensson) pp. 3-12 (The Royal Society of Chemistry, Cambridge) (Carbohydrate Active Enzymes database, http://www.cazy.org/).

Delcher AL, Harmon D, Kasif S, White O, Salzberg SL (1999) Improved microbial gene identification with GLIMMER. Nucleic Acids Research 27 , 4636-4641.

Fleischmann, RD, et al. (1995) Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269 , 496-512.

Fricke WF, Seedorf H, Henne A, Kruer M, Liesegang H, Hedderich R, Gottschalk G, Thauer RK (2006) The genome sequence of Methanosphaera stadtmanae reveals why this human intestinal archaeon is restricted to methanol and H ₂ for methane formation and ATP synthesis. Journal of Bacteriology 188 , 642-658.

Godde JS, Bickerton A (2006) The repetitive DNAe called CRISPRs and their associated genes: evidence of horizontal transfer among prokaryotes. Journal of Molecular Evolution 62, 718-729.

Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR / Cas subtypes exist in prokaryotic genomes. PLoS Computational Biology 1: 474-483

Jansen R, Embden JD, Gaastra W, Schouls LM (2002) Identification of genes that are associated with DNA repeats in prokaryotes. Molecular Microbiology 43, 1565-1575.

Jansen R, van Embden JD, Gaastra W, Schouls LM (2002) Identification of a novel family of sequence repeats among prokaryotes. OMICS: A journal of integrative biology 6 , 23-33.

Jensen LJ, Friis C, Ussery DW (1999) Three views of microbial genomes. Research in Microbiology 150, 773-777.

Joblin KN, Naylor GE, Williams AG (1990) Effect of Methanobrevibacter smithii on xylanolytic activity of anaerobic ruminal fungi. Applied and Environmental Microbiology 56 , 2287-2295.

Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M (2004) The KEGG resource for deciphering the genome. Nucleic Acids Research 32, D277-D280.

Kiener, A., Konig, H., Winter, J. and Leisinger, T. 1987. Purification and use of Methanobacterium wolfeii pseudomurein endopeptidase for lysis of Methanobacterium thermoautotrophicum . J. Bacteriol. 169, 1010-1016.

Knox, MR and Harris, JE 1986. Isolation and characterization of a bacteriophage of Methanobrevibacter smithii . In Abstracts of the XIV International Congress on Microbiology . Manchester: International Union of Microbiological Societies.

Kurtz S, Schleiermacher C (1999) REPuter: fast computation of maximal repeats in complete genomes. Bioinformatics 15, 426-427.

Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25, 955-964.

Loenen, W. and N. Murray. 1986. Modification enhancement by restriction alleviation protein (Ra1) of bacteriophage lambda. J. Mol. Biol. 190: 11-22.

Lucchini, S., F. Desiere, and H. Brussow. 1999. Comparative genomics of Streptococcus thermophilus phage species supports a modular evolution theory. J. Virol. 73: 8647-8656.

Luo, YN, Pfister, P., Leisinger, T. and Wasserfallen, A. 2002. Pseudomurein endoisopeptidases PeiW and PeiP, two moderately related members of a novel family of proteases produced in Methanothermobacter strains . FEMS Microbiol. Lett. 208, 47-51.

Makarova, K. S., Aravind, L. and Koonin, E. V. 1999. A superfamily of archaeal, bacterial, and eukaryotic proteins homologous to animal transglutaminases. Protein Sci. 8, 1714-1719.

Makarova KS, Grishin NV, Shabalina, SA, Wolf YI, Koonin EV (2006) A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biology Direct 1: 7-32.

New Zealand Statistics 2005 (www.stats.govt.nz)

New Zealand's Greenhouse Gas Inventory 1990-2004. The National Inventory Report and Common Reporting Format. (2006) Ministry for the Environment. http://www.mfe.govt.nz/publications/climate/nir-apr06/nir-apr06.pdf.

Reeve JN, Nolling J Morgan RM, Smith DR (1997) Methanogenesis: genes, genomes and who's on first? Journal of Bacteriology 179 , 5975-5986.

Rawlings, ND, Morton, FR and Barrett, AJ 2006. MEROPS : the peptidase database. Nucleic Acids Res. 34, D270-D272.

Samuel BS, Hansen EE, Manchester JK, Coutinho PM, Henrissat B, Fulton R, Latreille P, Kim K, Wilson RK, Gordon JI (2007) Genomic adaptations of Methanobrevibacter smithii to the human gut. Proceedings of the National Academy of Sciences USA 104 , 10643-10648.

Smith DR, et al. (1997) Complete genome sequence ofMethanobacterium thermoautotrophicumH: Functional analysis and comparative genomics.Journal of bacteriology 179, 7135-7155.

Smith PH, Hungate RE (1958) Isolation and characterization of Methanobacterium ruminantium n. sp. Journal of Bacteriology 75, 713-718.

Staden R, Beal KF, Bonfield JK (1998) The Staden Package. Methods in Molecular Biology: Bioinformatics Methods and Protocols 132 , 115-130.

Tatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS, Kiryutin B, Galperin MY, Fedorova ND, Koonin EV (2001) The COG database: new developments in phylogenetic classification of proteins from complete genomes Nucleic Acids Research 29 , 22-28.

All publications and patents mentioned in the above description are incorporated by reference.

Where reference to the above description is given to integers having known equivalents, these equivalents are included as separately indicated. Although the present invention has been described in relation to particularly preferred embodiments, it should be understood that the present invention, as claimed, should not be inappropriately limited to such specific embodiments. It is understood that further modifications may be made with respect to the present invention, as described herein, without departing from the spirit and scope of the invention.

Claims (24)

1. The selected polypeptide, which is an inhibitor of methanogen producer cells and a biological marker for detection of phage φmru, and which is characterized by: a) an amino acid sequence selected from the group consisting of SEQ ID NO: 2-5; b) an amino acid sequence that is at least 90% identical to the sequence selected from the group consisting of SEQ ID NO: 2-5; or c) an amino acid sequence that is at least 80% identical to the sequence selected from the group consisting of SEQ ID NO: 2-5. 2. The selected polypeptide, which is an inhibitor of methanogen producer cells and a biological marker for detection of phage φmru, and which is characterized by: a) an amino acid sequence selected from the group consisting of SEQ ID NO: 1, 6-61, 62, 63, 64-68 69 and 72; b) an amino acid sequence that is at least 90% identical to the sequence selected from the group consisting of SEQ ID NO: 1, 6-61, 62, 63, 64-68, 69 and 72; or c) an amino acid sequence that is at least 80% identical to the sequence selected from the group consisting of SEQ ID NO: 1, 6-61, 62, 63, 64-68, 69 and 72. 3. An isolated polynucleotide that encodes a polypeptide that is an inhibitor of a methane producer cell and a biological marker for detecting phmru phage, and which is characterized by: a) a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 2-5; b) a nucleotide sequence selected from the group consisting of SEQ ID NO: 75-78; c) a nucleotide sequence that encodes an amino acid sequence that is at least 90% identical to the sequence selected from the group consisting of SEQ ID NO: 2-5; or d) a nucleotide sequence that encodes an amino acid sequence that is at least 80% identical to the sequence selected from the group consisting of SEQ ID NO: 2-5, or e) a sequence complementary to the sequence of any one of claims. (a) - (d).  4. An isolated polynucleotide that encodes a polypeptide that is an inhibitor of a methane producer cell and a biological marker for detecting phmru phage, and which is characterized by: a) a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of SEQ ID NO: 1, 6- 61, 62, 63, 64-68, 69 and 72; b) a nucleotide sequence selected from the group consisting of SEQ ID NO: 74, 79-134, 135, 136, 137-141 and 142; c) a nucleotide sequence that encodes an amino acid sequence that is at least 90% identical to the sequence selected from the group consisting of SEQ ID NO: 1, 6-61, 62, 63, 64-68, 69 and 72; or d) a nucleotide sequence that encodes an amino acid sequence that is at least 80% identical to the sequence selected from the group consisting of SEQ ID NO: 1, 6-61, 62, 63, 64-68, 69 and 72, or e) a nucleotide sequence complementary to a sequence according to any one of paragraphs. (a) - (d). 5. Cloning vector containing a polynucleotide according to claim 3 or 4. 6. Cloning vector containing a polynucleotide that encodes a polypeptide according to claim 1 or 2. 7. The expression vector containing the polynucleotide according to claim 3 or 4. 8. An expression vector containing a polynucleotide that encodes a polypeptide according to claim 1 or 2. 9. The host cell for the production of the polypeptide according to claim 1 or 2, where the cell contains a vector according to claims 6, 8. 10. The host cell for the production of polynucleotide according to claim 3 or 4, where the cell contains a vector according to claims 5, 7. 11. A host cell for replicating a vector according to any one of claims 5 to 8, which is a prokaryotic cell or methanogen producer cell containing the vector according to claims 5-8. 12. The host cell according to claim 11, which is Escherichia coli or Methanobrevibacter ruminantium, including Methanobrevibacter ruminantium strain M1 ^T (DSM1093). 13. A conjugated molecule or a fusion molecule that is an inhibitor of a methane producer cell and a biological marker for detecting a phmru phage containing the polypeptide according to claim 1 or 2, or a polynucleotide according to claim 3 or 4. 14. A conjugated molecule or fusion molecule that is an inhibitor of a methane producer cell and contains a polypeptide according to claim 1 or 2, and which further comprises a compound against the formation of methane, a signal sequence, an antibody or antibody fragment, a peptide nucleic acid, an antimicrobial peptide, or an antibiotic . 15. The antibody or antibody fragment that binds to the peptide according to claim 1 or 2, obtained using the polypeptide according to claim 1 or 2. 16. The antibody or antibody fragment of claim 15, which is monoclonal. 17. The isolated phage φmru, which is isolated using a biological marker according to claims 1 to 4, which is an inhibitor of a methane producer cell and contains a) at least one polypeptide according to claim 1 or 2; or b) at least one polynucleotide according to claim 3 or 4. 18. A pharmaceutical composition for inhibiting a methane producer cell, comprising an effective amount of a) a polypeptide according to claim 1 or 2; b) a polynucleotide according to claim 3 or 4; c) a vector according to any one of claims 5 to 8; or d) phage according to claim 17. 19. A method of inhibiting a methanogen producer cell, comprising: a) optionally, preparing or isolating a polypeptide according to claim 1 or 2; and b) contacting the cell with the polypeptide according to claim 1 or 2. 20. A method of inhibiting a methanogen producer cell, comprising: a) optionally, producing or isolating a conjugated molecule or fusion molecule according to claim 13 or 14; and b) contacting the cell with the conjugated molecule or fusion molecule of claim 13 or 14.  21. A method of inhibiting a methanogen producer cell, comprising: a) optionally, producing or isolating a phage according to claim 17; and b) contacting the cell with the phage according to claim 17. 22. The method according to any one of claims 19-21, wherein the cell is a ruminant methane producer cell or obtained from a ruminant. 23. The method of claim 22, wherein the cell is Methanobrevibacter ruminantium. 24. The method according to item 23, in which the cell is a Methanobrevibacter ruminantium strain M1 ^T (DSM1093).

Images